adjective

This is a table of type adjective and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adjective	frequency
human	1341
viral	1118
different	698
high	567
zoonotic	522
novel	515
respiratory	491
important	479
like	457
immune	453
new	438
positive	419
genetic	417
specific	384
natural	365
several	365
severe	358
acute	356
many	341
phylogenetic	339
large	331
similar	320
infectious	306
non	302
molecular	302
potential	301
mammalian	287
recent	275
higher	272
low	268
multiple	264
significant	260
brown	246
first	239
long	227
present	222
available	216
small	215
evolutionary	213
european	209
experimental	208
adipose	207
nucleotide	206
common	206
wild	205
possible	204
african	203
genomic	198
diverse	194
additional	191
single	181
social	179
bacterial	175
likely	174
close	170
little	170
major	165
previous	161
infected	158
ecological	158
distinct	158
white	152
key	151
dependent	151
related	150
functional	147
individual	146
complete	145
unique	142
pathogenic	141
consistent	141
antiviral	141
avian	139
egyptian	137
clinical	136
greater	134
direct	134
various	131
total	129
lower	128
anti	125
current	123
domestic	122
insectivorous	121
full	121
negative	121
public	120
serological	117
wide	116
innate	114
unknown	113
particular	113
future	113
susceptible	110
comparative	110
global	109
vascular	109
geographic	108
fecal	108
supplementary	107
environmental	107
inflammatory	106
free	106
primary	105
mean	104
structural	101
due	101
responsible	99
maximum	97
chinese	96
american	94
second	93
great	93
biological	93
capable	91
australian	91
reproductive	90
sympathetic	88
oral	88
cellular	88
big	88
limited	86
able	85
identical	85
whole	84
short	84
frugivorous	83
central	82
adaptive	82
metabolic	81
local	81
independent	80
southern	78
mitochondrial	78
special	77
final	77
black	76
highest	76
female	75
cold	75
active	75
seasonal	75
species	74
porcine	74
disordered	74
least	73
broad	73
geographical	73
epidemiological	73
nucleic	73
partial	73
urban	73
taxonomic	72
tailed	72
perivascular	72
old	72
fatal	72
divergent	71
sensory	70
cross	70
healthy	69
certain	69
canine	68
early	68
western	66
main	66
statistical	65
general	65
strong	64
rapid	64
less	64
last	64
larger	64
relative	63
north	63
enteric	63
real	61
extensive	60
effective	60
seropositive	60
largest	60
juvenile	59
intrinsic	59
secondary	57
putative	57
initial	57
critical	57
bovine	57
average	56
endemic	56
essential	56
fat	56
immunological	56
overall	55
male	54
japanese	53
intermediate	53
open	52
clear	52
next	52
difficult	52
paramyxovirus	52
random	52
red	52
south	52
relevant	51
nosed	51
live	51
brazilian	51
widespread	50
past	50
necessary	50
migratory	50
jamaican	50
variable	48
better	47
recombinant	47
true	47
tropical	46
reverse	46
intact	46
asian	46
subsequent	45
physiological	45
numerous	45
conserved	45
mild	44
deadly	44
neutral	43
complex	43
reactive	43
separate	43
pairwise	42
nuclear	42
mesenteric	42
eastern	42
annual	42
normal	41
best	41
bayesian	41
fungal	40
endothelial	40
appropriate	40
indirect	40
useful	40
hemorrhagic	39
feline	39
comprehensive	39
inter	38
ancient	38
anthropogenic	38
cardiovascular	38
northern	38
morphological	38
representative	38
spatial	38
standard	38
lethal	37
chronic	37
fresh	37
temporal	37
regulatory	37
rich	37
suitable	37
typical	36
smaller	36
quantitative	36
distant	36
apparent	36
ancestral	36
efficient	35
alternative	35
mixed	35
linear	35
protective	35
vertebrate	34
unlikely	34
selective	34
oxidative	34
frequent	34
endogenous	34
microbial	33
co	33
comparable	33
post	33
preliminary	33
pro	33
sensitive	33
synonymous	33
top	32
scientific	32
respective	32
original	32
conventional	32
captive	32
dead	31
basic	31
beige	31
crucial	31
green	31
primate	31
detectable	31
sufficient	30
sterile	30
rural	30
flexible	30
economic	30
contractile	30
commercial	30
intestinal	29
evident	29
abundant	29
acoustic	29
differential	29
terrestrial	29
fast	29
homologous	29
pathological	29
unclear	29
detailed	28
emergent	28
dry	28
late	28
arterial	28
anal	28
online	28
rhinolophoid	28
longitudinal	28
rectal	28
traditional	28
substantial	28
systemic	28
pregnant	28
entire	27
absent	27
antigenic	27
asymptomatic	27
bactericidal	27
cameroonian	27
extant	27
hydrophobic	27
longer	27
minimum	27
nervous	27
virological	27
convergent	26
behavioral	26
blue	26
closest	26
parasitic	26
rare	26
regional	26
stable	26
young	26
physical	26
korean	25
much	25
continuous	25
diagnostic	25
good	25
international	25
observed	25
niv	25
peripheral	25
polyclonal	25
pre	25
terminal	25
earlier	24
empirical	24
indian	24
cultured	24
considerable	24
circular	24
extreme	24
exact	24
multi	24
placental	24
subcutaneous	24
unclassified	24
valuable	24
vast	24
yellow	24
obvious	24
minimal	23
accurate	23
corresponding	23
hematophagous	23
interesting	23
mass	23
medical	23
nested	23
raw	23
systematic	23
unable	23
unusual	23
veterinary	23
virulent	23
lesser	22
causative	22
closer	22
ectoparasite	22
false	22
internal	22
native	22
mammal	22
orthologous	22
parallel	22
third	22
vespertilionid	22
murine	22
focal	21
blind	21
broader	21
chiropteran	21
equine	21
eukaryotic	21
fewer	21
italian	21
indicative	21
rotavirus	21
rufous	21
serious	21
smooth	21
therapeutic	21
virome	21
coronary	20
ongoing	20
mexican	20
posterior	20
constitutive	20
amino	20
agricultural	20
persistent	20
sub	20
safe	20
simple	20
wet	20
successful	20
temperate	20
transmissible	20
shorter	20
illegal	19
characteristic	19
classical	19
constant	19
cytopathic	19
eared	19
endocrine	19
gregarious	19
invasive	19
inducible	19
intramuscular	19
moderate	19
outer	19
passive	19
resistant	19
strict	19
varied	19
obese	18
easy	18
maternal	18
generic	18
poor	18
upper	18
right	18
proper	18
lowest	17
adjacent	17
associated	17
dendritic	17
elevated	17
exceptional	17
fetal	17
forested	17
intracellular	17
huge	17
modern	17
rhinolophid	17
neurological	17
unidentified	17
unannotated	17
universal	17
personal	17
olfactory	17
older	17
notable	17
historical	16
canonical	16
cytoplasmic	16
diseased	16
encephalitis	16
faecal	16
flying	16
gastrointestinal	16
grateful	16
probable	16
inhibitory	16
monoclonal	16
myd88	16
neotropical	16
optimal	16
winged	16
robust	16
microsatellite	16
dietary	15
fundamental	15
following	15
fatty	15
equal	15
aware	15
compatible	15
brief	15
biochemical	15
nutritional	15
aforementioned	15
adrenergic	15
monthly	15
interstitial	15
overt	15
technical	15
paracrine	15
venezuelan	15
transgenic	15
transcriptional	15
thermogenic	15
viable	15
surprising	15
subgenus	15
serial	15
powered	15
supernatant	15
enhanced	14
genus	14
french	14
epithelial	14
enormous	14
deficient	14
downstream	14
demographic	14
deep	14
daily	14
haemorrhagic	14
gray	14
double	14
hepatic	14
wider	14
vital	14
specialized	14
sick	14
principal	14
hydrophilic	14
prevalent	14
monophyletic	14
lymphoid	14
light	14
orf8	14
dynamic	13
intra	13
inner	13
histological	13
financial	13
excellent	13
colonial	13
dense	13
closed	13
bent	13
baseline	13
liquid	13
isolated	13
latter	13
unexpected	13
neuronal	13
peninsular	13
prominent	13
spanish	13
synthetic	13
taphozous	13
theoretical	13
trinidadian	13
worldwide	13
visual	13
west	13
middle	13
kenyan	12
institutional	12
occasional	12
legged	12
logistic	12
heavy	12
host	12
aquatic	12
evolved	12
disturbed	12
conclusive	12
beneficial	12
arthropod	12
malaysian	12
enzootic	12
plausible	12
uncommon	12
potent	12
urgent	12
unsuccessful	12
unrelated	12
undisturbed	12
unpublished	12
subject	12
soluble	12
regular	12
rabid	12
qualitative	12
pteropid	12
energetic	11
nonstructural	11
nearby	11
national	11
giganteus	11
generalized	11
fragmented	11
actual	11
dominant	11
digestive	11
degenerate	11
computational	11
challenging	11
opportunistic	11
absolute	11
nt	11
greatest	11
periodic	11
swat	11
permissive	11
weak	11
visceral	11
uninfected	11
truncated	11
thermal	11
unstructured	11
structured	11
renal	11
remarkable	11
reliable	11
reciprocal	11
retrospective	11
practical	11
incidental	10
fluorescent	10
german	10
ideal	10
immunohistochemical	10
integrated	10
incomplete	10
intensive	10
jurisdictional	10
equivalent	10
external	10
cardiac	10
epidemiologic	10
dramatic	10
differentiated	10
dark	10
controversial	10
contemporary	10
competent	10
basal	10
atherosclerotic	10
left	10
analytical	10
later	10
volant	10
leptospiral	10
somatic	10
marine	10
vp4	10
visible	10
unstimulated	10
unexplained	10
thorough	10
taxonomical	10
sympatric	10
sustained	10
southeastern	10
unbiased	10
skeletal	10
nonredundant	10
sized	10
massive	10
mechanistic	10
minor	10
microscopic	10
proinflammatory	10
round	10
salivary	10
siberian	10
deceased	9
follicular	9
educational	9
excessive	9
feasible	9
febrile	9
flavivirus	9
impossible	9
forward	9
hev	9
hypertensive	9
iberian	9
improved	9
cultural	9
cumulative	9
auditory	9
cryptic	9
correct	9
continued	9
continental	9
composite	9
complementary	9
climatic	9
british	9
bornaviral	9
bold	9
bipartite	9
insufficient	9
artificial	9
analogous	9
informed	9
impaired	9
intergenic	9
productive	9
transcriptomic	9
interspecific	9
tight	9
superior	9
sporadic	9
smallest	9
simian	9
semi	9
saharan	9
restricted	9
redundant	9
reassortant	9
pulmonary	9
progressive	9
riparian	9
prior	9
multivariable	9
predominant	9
meaningful	9
metagenomic	9
microglial	9
marked	9
multifunctional	9
multifocal	9
mx1	9
necropsy	9
nan	9
official	9
pivotal	9
ethiopian	8
etiologic	8
extended	8
flag	8
former	8
fourth	8
legal	8
frozen	8
headed	8
heterogeneous	8
hierarchical	8
homogeneous	8
intraperitoneal	8
enveloped	8
ethical	8
atherogenic	8
endoparasitic	8
earliest	8
domesticated	8
diluted	8
diarrheal	8
devastating	8
covs	8
cooperative	8
complement	8
chemosensory	8
chemical	8
catalytic	8
bodied	8
binary	8
malagasy	8
longest	8
temporary	8
median	8
sectional	8
naive	8
worth	8
urinary	8
uniform	8
undiscovered	8
ultrasonic	8
toothed	8
thermoneutral	8
southeast	8
sociodemographic	8
slow	8
slim	8
seronegative	8
serologic	8
sylvatic	8
scarce	8
pseudo	8
neonatal	8
saphenous	8
oropharyngeal	8
pan	8
predictive	8
promising	8
prime	8
reasonable	8
reassortment	8
reduced	8
relaxed	8
repetitive	8
ribosomal	8
fit	7
intense	7
foetal	7
footed	7
gabonese	7
hku2-related	7
horizontal	7
immediate	7
logistical	7
joint	7
known	7
latitudinal	7
laurasiatherian	7
lipped	7
malayan	7
extracellular	7
favorable	7
aged	7
exponential	7
east	7
mmol	7
advanced	7
anonymous	7
antimicrobial	7
bat	7
bicolored	7
binomial	7
clean	7
coastal	7
conspecific	7
crude	7
cyclic	7
cytotoxic	7
digital	7
distinctive	7
mature	7
behavioural	7
modest	7
undetected	7
spermine	7
square	7
super	7
syncytial	7
ubiquitous	7
uncharacterized	7
undescribed	7
univariable	7
simultaneous	7
unpaired	7
valid	7
vesicular	7
viremic	7
vulnerable	7
warm	7
muscular	7
soft	7
weighted	7
sialic	7
paramyxoviral	7
resident	7
mutant	7
myotis	7
naked	7
neighbouring	7
nocturnal	7
occupational	7
near	7
parasite	7
pharyngeal	7
precise	7
prone	7
recurrent	7
religious	7
replicative	7
excess	6
foodborne	6
ferret	6
explanatory	6
exclusive	6
enos	6
epizootic	6
episodic	6
ectoparasitic	6
endoparasite	6
gastroenteritis	6
friendly	6
infection	6
gradual	6
hard	6
harmful	6
helpful	6
hsp90	6
humoral	6
immunocompetent	6
infective	6
localized	6
manual	6
disproportionate	6
dysfunctional	6
adequate	6
definitive	6
cutaneous	6
10-fold	6
2nd	6
abdominal	6
abnormal	6
accidental	6
acid	6
maximal	6
affected	6
agarose	6
airborne	6
ambient	6
astrovirus	6
autonomic	6
bangladeshi	6
beta	6
biotic	6
caribbean	6
catastrophic	6
coevolutionary	6
compact	6
confluent	6
consecutive	6
coronaviral	6
masked	6
half	6
medium	6
stronger	6
rabies	6
retinoic	6
routine	6
segmented	6
sexual	6
simulated	6
slight	6
socio	6
sophisticated	6
spinal	6
stepwise	6
sustainable	6
quasi	6
testicular	6
topographic	6
transdermal	6
transfection	6
transgene	6
transient	6
tremendous	6
ucp1	6
undetectable	6
younger	6
mega	6
quick	6
stranded	6
prokaryotic	6
opposite	6
meta	6
private	6
micro	6
mobile	6
mucosal	6
nasal	6
negligible	6
nonsynonymous	6
northeastern	6
nosocomial	6
noteworthy	6
neurogenic	6
polymorphic	6
overlapping	6
pakit03	6
paralytic	6
peptide	6
periadventitial	6
phenotypic	6
plastic	6
organic	6
poxvirus	6
elderly	5
exciting	5
enough	5
embryonic	5
eligible	5
electric	5
deeper	5
echolocating	5
disulphide	5
disopred3	5
dipeptidyl	5
faint	5
determined	5
exploratory	5
informative	5
family	5
federal	5
foreign	5
fusogenic	5
histopathological	5
hoc	5
hot	5
immunocompromised	5
inappropriate	5
indigenous	5
initio	5
interfemoral	5
cynomolgus	5
dam	5
angiogenic	5
covid-19	5
costly	5
inverted	5
21st	5
accessory	5
ambiguous	5
angolan	5
anticontractile	5
arid	5
attenuated	5
atypical	5
automatic	5
biased	5
biologic	5
bottom	5
capillary	5
categorical	5
cephalic	5
cerebral	5
chimeric	5
classic	5
clustered	5
combinatorial	5
combined	5
commensal	5
conceivable	5
congenital	5
connected	5
cool	5
intriguing	5
pronounced	5
latest	5
suggestive	5
scrotal	5
shouldered	5
solid	5
solitary	5
spatio	5
speculative	5
spherical	5
spontaneous	5
stationary	5
steep	5
stringent	5
suboptimal	5
sudden	5
supplemental	5
rocky	5
symbiotic	5
taxon	5
thoracic	5
ultrastructural	5
underground	5
unprecedented	5
usual	5
variant	5
vasoregulatory	5
vertical	5
warmer	5
wise	5
lean	5
rounded	5
toed	5
rigorous	5
oldest	5
lucifugus	5
relaxing	5
lysosomal	5
mesenchymal	5
mfpyv	5
mock	5
naïve	5
neural	5
neurologic	5
noctule	5
nonoate	5
notorious	5
observational	5
modular	5
paleontological	5
popular	5
radical	5
peculiar	5
primitive	5
prepared	5
powerful	5
premature	5
polygynous	5
pleomorphic	5
phosphorylated	5
permanent	5
expected	4
ecologic	4
exotic	4
eurasian	4
etiological	4
expensive	4
established	4
equatorial	4
enlarged	4
diminished	4
dysregulated	4
dual	4
descriptive	4
dissimilar	4
disposable	4
diarrhea	4
diabetic	4
developmental	4
fascinating	4
detected	4
extra	4
increased	4
favourable	4
inconsistent	4
intracerebral	4
defensive	4
interspecies	4
interested	4
interactive	4
integrative	4
integral	4
insular	4
immunoreactive	4
gene	4
igraph	4
identifiable	4
homogenous	4
hibernal	4
helical	4
haematophagous	4
gross	4
giant	4
demanding	4
approximate	4
defective	4
dangerous	4
batassociated	4
bacteriological	4
australasian	4
associative	4
artibeus	4
aortic	4
annotated	4
anatomical	4
allelic	4
alimentary	4
alcoholic	4
aerial	4
administrative	4
adipogenic	4
adipocyte	4
7-week	4
6-week	4
1st	4
invaluable	4
biannual	4
bigger	4
binding	4
concurrent	4
damaging	4
cytokine	4
cretaceous	4
convenient	4
contrary	4
contaminated	4
connective	4
confident	4
conceptual	4
bioactive	4
compensatory	4
collaborative	4
coalescent	4
clustalw	4
causal	4
caucasian	4
bivariate	4
biogeographic	4
intraspecific	4
symptomatic	4
ionic	4
proof	4
standardized	4
spicy	4
sparse	4
southwestern	4
sole	4
slender	4
shortest	4
shaded	4
sentinel	4
sedentary	4
sapiens	4
rwandan	4
roosting	4
reversible	4
residential	4
reminiscent	4
refractory	4
pyv	4
proteomic	4
stimulated	4
subset	4
successive	4
understudied	4
zoological	4
laryngeal	4
willing	4
weaker	4
unvaccinated	4
untreated	4
unnoticed	4
unexplored	4
underlying	4
sweet	4
unassigned	4
tracheal	4
topological	4
thick	4
tertiary	4
tentative	4
syrian	4
synanthropic	4
proportional	4
thai	4
promiscuous	4
mini	4
multivariate	4
mtdna	4
mouse	4
mortem	4
moribund	4
mononuclear	4
molten	4
molossid	4
mine	4
necrotic	4
mathematical	4
mandibular	4
magnetic	4
macroecological	4
luminal	4
prolonged	4
livingstonei	4
latent	4
narrow	4
microbiological	4
nightly	4
parametric	4
polar	4
postdoctoral	4
nipah	4
preventive	4
physicochemical	4
pharmacological	4
peruvian	4
perennial	4
pathophysiological	4
perfect	4
pandemic	4
noncoding	4
observable	4
obesity	4
noticeable	4
nitric	4
ostensible	4
nonlinear	4
fifth	3
finite	3
generalist	3
flaccid	3
fold	3
gastro	3
gallinaceous	3
gastroenteric	3
gccdc1	3
geneious	3
familiar	3
gccdc1-related	3
feral	3
elongated	3
exterior	3
exogenous	3
eutherian	3
ephemeral	3
enteroaggregative	3
enriched	3
enigmatic	3
electrical	3
easier	3
dutch	3
drnapred	3
dorsal	3
harmless	3
diversified	3
diurnal	3
golden	3
intercontinental	3
hematologic	3
heterologous	3
luciferase	3
dispensable	3
logarithmic	3
likelihood	3
knowledgeable	3
kind	3
junctional	3
involved	3
inverse	3
invariant	3
interordinal	3
inherent	3
inguinal	3
infrared	3
indispensable	3
indirubintreated	3
incongruent	3
inclusive	3
immunologic	3
illustrative	3
iba1	3
humidified	3
homogenized	3
hollow	3
histo	3
hibernation	3
hibernating	3
distal	3
aseptic	3
discrete	3
benign	3
balanced	3
backward	3
axonal	3
autosomal	3
automated	3
authentic	3
attributable	3
asiatic	3
applicable	3
antiinflammatory	3
antibiotic	3
anterograde	3
anecdotal	3
amplified	3
altered	3
alive	3
aligned	3
adverse	3
advantageous	3
adaptable	3
acidic	3
accessible	3
accelerated	3
abovementioned	3
aberrant	3
19th	3
malignant	3
batghv3	3
bilateral	3
developed	3
bitter	3
deterministic	3
detached	3
delayed	3
danish	3
cytosolic	3
cov	3
converted	3
contradictory	3
contiguous	3
conspicuous	3
conservative	3
consequent	3
congruent	3
confocal	3
conditional	3
coloured	3
colombian	3
collective	3
coincidental	3
circumstantial	3
cimicid	3
chi	3
carotid	3
careful	3
cardiometabolic	3
bony	3
bodily	3
lymphocytic	3
unambiguous	3
marginal	3
tolerant	3
theoretic	3
testable	3
tall	3
submandibular	3
subcellular	3
strongest	3
stochastic	3
standalone	3
stained	3
staggering	3
spatiotemporal	3
sooty	3
socioeconomic	3
slower	3
sixth	3
singlestranded	3
shivering	3
shallow	3
secretory	3
rugged	3
rolling	3
retroviral	3
responsive	3
reproducible	3
reported	3
remote	3
randomised	3
thin	3
transfected	3
proximal	3
transneuronal	3
mechanical	3
zikv	3
volatile	3
ventral	3
venous	3
velvety	3
variegated	3
utmost	3
urbanized	3
unrooted	3
unreported	3
unrecognized	3
unmanaged	3
uninformative	3
uneven	3
unequal	3
undetermined	3
underappreciated	3
undefined	3
uncultivable	3
uncoupling	3
unbound	3
unaffected	3
ultrathin	3
ugandan	3
trophic	3
traumatic	3
questionable	3
zambian	3
proviral	3
orthobornavirus	3
orexigenic	3
optimum	3
oligonucleotide	3
offshore	3
odd	3
oceanic	3
occult	3
objective	3
nucleocapsid	3
normotensive	3
normalized	3
nonfluorescent	3
nl63-like	3
neutralization	3
neointimal	3
neglected	3
nearest	3
natal	3
myocardial	3
mutational	3
multinucleate	3
multigene	3
mountainous	3
morphometric	3
morphologic	3
monospecific	3
provincial	3
oriental	3
model	3
outdoor	3
populous	3
proteolytic	3
p38	3
prostacyclin	3
profound	3
professional	3
problematic	3
probabilistic	3
pres1	3
prenatal	3
preferred	3
preferential	3
precautionary	3
poxviral	3
metropolitan	3
polyprotein	3
pet	3
poly	3
paradigmatic	3
parental	3
pectoral	3
perinatal	3
panmictic	3
phylogeographic	3
pointed	3
plain	3
phylogeographical	3
physiologic	3
euthermic	2
eventual	2
exaggerated	2
eubacterial	2
extraintestinal	2
expandable	2
expert	2
explosive	2
exposure	2
extendable	2
extinct	2
exhaustive	2
faster	2
facial	2
fine	2
firm	2
fitted	2
ethological	2
flat	2
focused	2
fruitful	2
gapdh	2
gaseous	2
generalised	2
generous	2
genotypic	2
gentle	2
flagellar	2
epididymal	2
ethnographic	2
ecologically	2
disparate	2
ghsr1a	2
distilled	2
distributional	2
dominating	2
donkey	2
dpp4	2
drastic	2
dsrna	2
duplicate	2
eblv-2	2
eco	2
ectopic	2
erroneous	2
effusive	2
egfp	2
electrostatic	2
empty	2
enclosed	2
ended	2
english	2
enzymatic	2
epidermal	2
epithelioreticular	2
equivocal	2
intricate	2
electrolyte	2
hypervariable	2
glial	2
injured	2
immense	2
imminent	2
immunomodulatory	2
immunosorbent	2
inaccurate	2
inadequate	2
incapable	2
incongruous	2
incorrect	2
indistinguishable	2
informal	2
infrequent	2
inoculation	2
icosahedral	2
insensitive	2
insert	2
interchain	2
interdisciplinary	2
interface	2
interior	2
interquartile	2
intimate	2
intracytoplasmic	2
intradermal	2
intravascular	2
devoid	2
immature	2
ibea	2
globular	2
hepadnaviral	2
glyceraldehyde-3-phosphate	2
granulomatous	2
grenadian	2
grey	2
group	2
guano	2
haematological	2
haematophagus	2
haemosporidian	2
haired	2
healthier	2
heightened	2
heterozygous	2
hypothetical	2
heuristic	2
hfdinduced	2
highly	2
histiocytic	2
histochemical	2
histopathologic	2
historic	2
hku4	2
homo	2
homodimer	2
hsp70	2
hungarian	2
diacidic	2
bridgerian	2
deviant	2
astonishing	2
antiseptic	2
aortae	2
apobec3a	2
arbitrary	2
arboreal	2
archaeal	2
archival	2
archived	2
arithmetic	2
arteriolar	2
assembly	2
assignable	2
atmospheric	2
antimycotic	2
attic	2
autochthonous	2
autocrine	2
autonomous	2
autopsy	2
axillary	2
barcoded	2
bicistronic	2
biggest	2
biogeographical	2
biomedical	2
biophysical	2
antiretroviral	2
antibacterial	2
detrimental	2
afferent	2
-5	2
10x	2
11th	2
14th	2
21a	2
24-h	2
abiotic	2
accepted	2
adrenal	2
adult	2
adventitial	2
advisable	2
aggregated	2
anthropometric	2
aggressive	2
akin	2
alien	2
alkaline	2
allopatric	2
alone	2
alternate	2
alveolar	2
ample	2
amplifi	2
anamnestic	2
antagonistic	2
bodv	2
broadest	2
bthku9-like	2
damaged	2
corneal	2
coronaviruspositive	2
cosmopolitan	2
countless	2
covgrp2	2
cranial	2
crimean	2
crossreactive	2
crucian	2
cterminal	2
cultivable	2
customized	2
daytime	2
buddhist	2
decaying	2
decreased	2
dedicated	2
definite	2
deleterious	2
denser	2
dental	2
denv	2
depauperate	2
dependovirus	2
derivative	2
detectible	2
core	2
coordinated	2
convincing	2
convalescent	2
calcitonin	2
cambodian	2
canadian	2
cancer	2
capsid	2
capsomeric	2
carnivorous	2
caudal	2
central‐southern	2
charged	2
chemotactic	2
christian	2
circulatory	2
clearer	2
clickable	2
coding	2
colored	2
communicable	2
compelling	2
complicated	2
complimentary	2
concrete	2
conflicting	2
contigs	2
continual	2
intravenous	2
peri	2
invariable	2
subordinal	2
societal	2
socioecological	2
solar	2
sortable	2
speciose	2
spliced	2
ssdna	2
stainless	2
statutory	2
straightforward	2
streptococcal	2
subclinical	2
substantive	2
skinny	2
subterranean	2
suburban	2
suited	2
suppressive	2
suppurative	2
surrogate	2
tabbed	2
tantalizing	2
technological	2
territorial	2
throat	2
thymic	2
sociable	2
skewed	2
tonsillar	2
s12250	2
redox	2
refined	2
region	2
reliant	2
repeatable	2
reptilian	2
restrictive	2
resultant	2
retrotranspositional	2
risky	2
runny	2
s12192	2
safer	2
singaporean	2
sarcomatoid	2
sarslike	2
saα-2,6-gal	2
scottish	2
selected	2
seminal	2
seminested	2
seroepidemiological	2
sexed	2
significantly	2
silent	2
silver	2
tiny	2
topical	2
receptive	2
vegan	2
unresolved	2
unspecific	2
unspecified	2
untypical	2
unweighted	2
upstream	2
urbanizing	2
urogenital	2
v3.11	2
v4.7	2
vagal	2
vasoactive	2
vero	2
unprotected	2
versatile	2
vigilant	2
virologic	2
weekly	2
wholesale	2
wintering	2
wns	2
wound	2
year	2
yearly	2
youngest	2
invertebrate	2
unregulated	2
unofficial	2
torpid	2
unconfirmed	2
toxic	2
trans	2
transferable	2
translational	2
transposable	2
tribal	2
trivial	2
tubulin	2
ucp1-specific	2
unanswered	2
unavailable	2
unaware	2
uncontrolled	2
unobstructed	2
unconventional	2
uncoupled	2
understory	2
undiluted	2
undirected	2
undue	2
undulant	2
undulating	2
unfortunate	2
unified	2
univariate	2
unnatural	2
recognizable	2
unfolded	2
realistic	2
neat	2
multidimensional	2
multidisciplinary	2
multifactorial	2
multimeric	2
multiplex	2
municipal	2
mustached	2
mutualistic	2
mycoplasmal	2
myeloid	2
nascent	2
nationwide	2
necropsied	2
mosaic	2
nectarine	2
nematode	2
neutrophilic	2
newborn	2
nigral	2
ninth	2
nipha	2
nlrp3-mediated	2
nod	2
nodular	2
nonendemic	2
nonenveloped	2
multicellular	2
monomeric	2
nonhematophagous	2
longstanding	2
ischaemic	2
reactivity	2
ischemic	2
isoelectric	2
isoflurane	2
isotopic	2
iterative	2
kpg	2
lactating	2
lethargic	2
localised	2
localization	2
longterm	2
moluccan	2
magnetostratiographic	2
mammary	2
married	2
marsupial	2
medicinal	2
medullary	2
metallic	2
microchiropteran	2
mid	2
milder	2
military	2
modified	2
nonfat	2
mate	2
nonhuman	2
precipitous	2
periaortic	2
peridomestic	2
persisting	2
pgem	2
ph	2
philippine	2
phytophagous	2
pioneering	2
pipistrellus	2
polycystic	2
polycytidylic	2
portuguese	2
prescribed	2
pediatric	2
presumptive	2
principle	2
promotional	2
pronged	2
prudent	2
pvatderived	2
pyogranulomatous	2
rabbit	2
rainy	2
nonparametric	2
randomized	2
rational	2
pelvic	2
preventable	2
pathologic	2
orthobornaviral	2
nonspecific	2
nonsialylated	2
pathogenetic	2
nonpathogenic	2
nonviral	2
northeast	2
ns5	2
nucifera	2
nyctophilus	2
onward	2
operational	2
ordinated	2
ornamental	2
numeric	2
oscillating	2
paki	2
panviral	2
osmotic	2
parsimonious	2
patchy	2
pakistani	2
palmitic	2
overwhelming	2
ovary	2
paraphyletic	2
freshwater	1
fulllength	1
freetailed	1
frilled	1
frontal	1
frugiviorous	1
fraught	1
furless	1
fulminant	1
functionless	1
g)]/molecular	1
g2-like	1
g3p	1
gamma-	1
fragmental	1
gambian	1
g9p[7	1
frail	1
flatbed	1
fosmid	1
fixed	1
fibroblastlike	1
fibrous	1
gastric	1
fide	1
fig.1	1
filovirus	1
firststrand	1
fitting	1
flavi-	1
formidable	1
fluid	1
flulike	1
fluorescein	1
fluoresceinated	1
food	1
foreground	1
formal	1
formar	1
gammaherpesvirus	1
harem	1
generalizable	1
hematological	1
handy	1
hanta-	1
harbored	1
harsh	1
heated	1
heatrelated	1
heavier	1
helminth	1
hematophagus	1
generational	1
hemi	1
hemodynamic	1
hemostatic	1
hepaciviral	1
heparinized	1
hepatocellular	1
fergusonii	1
herbal	1
handed	1
hallmark	1
hairpin	1
hairless	1
genetical	1
genital	1
genomoviral	1
ghanaian	1
glucose	1
glycosomal	1
go	1
goat	1
governmental	1
grand	1
grassland	1
gravid	1
greek	1
guangdong/1/96-like	1
h/12	1
habitable	1
haemolytic	1
fewest	1
ebov	1
feotal	1
ecov	1
driest	1
dromic	1
ds-1-like	1
ductular	1
e4-characteristic	1
eastside	1
economical	1
ecosystem	1
ectodermal	1
endocytic	1
ectodomain	1
ecuadorean	1
efferent	1
efsevoked	1
elife.11785.015	1
elusive	1
encephalitic	1
encouraging	1
drier	1
download	1
dotted	1
dose	1
hes1	1
directional	1
discernable	1
discontinuous	1
diseaseassociated	1
disgusting	1
disorderbased	1
dissimilaritybased	1
distinguished	1
distinguishing	1
distressed	1
divided	1
dnase	1
dnastar	1
doctoral	1
doi.org/10.1016/j.meegid.2016.07.034	1
dopaminergic	1
encysted	1
endothermic	1
fcov	1
express	1
excretory	1
exemplary	1
exempt	1
exible	1
existent	1
existing	1
experienced	1
explicit	1
expressional	1
engorged	1
extramural	1
extrinsic	1
exuberant	1
fab	1
facultative	1
fantastical	1
fasta	1
faunal	1
ewat	1
evolution	1
everyday	1
even	1
enteroinvasive	1
enterotoxigenic	1
enteroviruslike	1
entomological	1
enzoonotic	1
epauletted	1
epigenetic	1
epiphyseal	1
epiphytic	1
epochal	1
equimolar	1
ethnic	1
ethopian	1
eucalypt	1
euclidean	1
euthanasia	1
evaporative	1
heretic	1
irf-3-dependent	1
heterogenic	1
diploid	1
intrarectal	1
intuitive	1
investigative	1
invisible	1
involuntary	1
iononetouch	1
ipah	1
irak-1	1
irf-7	1
influenza	1
irreparable	1
isabellinus	1
isolationby	1
itinerant	1
iwat	1
j19(human)-dq113897	1
jaimacan	1
jawed	1
intranasal	1
intragastric	1
intractable	1
intracranial	1
innumerable	1
inoculated	1
inorganic	1
insect-	1
intellectual	1
interconnected	1
interepidemic	1
interferoninducible	1
intergovernmental	1
intermittent	1
intermolecular	1
interpandemic	1
interplay	1
interpretable	1
interventricular	1
intimal	1
intolerant	1
k.‐t.	1
kamv	1
kcnq2	1
leathery	1
leftover	1
lengthy	1
lentic	1
lepidopteran	1
leptinsympathetic	1
leptospira	1
leukemic	1
levantine	1
lifelong	1
limber	1
lineage	1
lingual	1
lipoatrophic	1
lipophilic	1
lived	1
locus	1
log	1
leaved	1
leaky	1
kegggraph	1
leading	1
keratinized	1
kerth	1
klrd1/	1
kz-3b	1
labeled	1
labile	1
laboratoryderived	1
lacrimal	1
lactation	1
lacz	1
lag	1
lambdab	1
lamina	1
larval	1
lateral	1
latin	1
lc529726	1
inland	1
inflexible	1
heterothermic	1
hydrated	1
hoxc9	1
hspa5	1
hts)-based	1
humanderived	1
humane	1
humongous	1
hunting	1
hybrid	1
hygienic	1
inflated	1
hyphae	1
hypohidrotic	1
hypotensive	1
idiopathic	1
idiosyncratic	1
ifnα	1
il-17-mediated	1
ill	1
hottest	1
hotter	1
hostparasite	1
hostile	1
heterotypic	1
hexadecameric	1
hi	1
hidden	1
highfat	1
highlight	1
high‐throughput	1
himalayan	1
hippie	1
hku2	1
hku9-positive	1
hku9-related	1
hku9related	1
hlya	1
holistic	1
homogenised	1
hospitalbased	1
illiterate	1
imaginable	1
immortal	1
inclement	1
incremental	1
incubated	1
incubation	1
indebted	1
indepth	1
indica	1
indiscriminate	1
indonesian	1
indoor	1
industrial	1
inefficient	1
inert	1
inevitable	1
infancy	1
infect	1
inferior	1
infested	1
incompatible	1
inbred	1
immunerelated	1
inborn	1
immunoassay	1
immunoecological	1
immunofluorescent	1
immunoglobulin	1
immunoprecipitated	1
immunoreceptor	1
immunoregulatory	1
immunosorbant	1
immunosuppressive	1
immunotypic	1
impactful	1
imperfect	1
impractical	1
inaccessible	1
inactive	1
inadvertent	1
inbalanced	1
dipteran	1
clustalx	1
dimorphic	1
aqueous	1
antillean	1
antitumor	1
apathogenic	1
apical	1
aplastic	1
apobec3	1
appreciable	1
approximately	1
arabian	1
associate	1
arachidonic	1
arboviral	1
archaic	1
arctic	1
arcuate	1
argentine	1
argentinian	1
aromatic	1
antihuman	1
antigenspecific	1
antifungal	1
antidiabetic	1
ambulatory	1
amenable	1
amnestic	1
amphipathic	1
ampk)-enos	1
anaerobic	1
anaesthetic	1
analyzed	1
anatomic	1
anesthetized	1
animal	1
annulirostris	1
anorectic	1
antebrachial	1
anterior	1
anthropoid	1
anticancer	1
asparagine	1
astroviral	1
dimeric	1
bioacoustical	1
bellied	1
bentwinged	1
betacoronavirusrelated	1
bi	1
bibliographic	1
bibliographical	1
bidirectional	1
bindinginduced	1
bioavailable	1
asymmetric	1
biodefense	1
biodiversity	1
biogeochemical	1
biotechnological	1
bird's	1
blank	1
blood	1
blooded	1
believe	1
belgian	1
batspecific	1
basosquamous	1
atomic	1
attainment	1
attractive	1
au-1-like	1
autocatalytic	1
autochonous	1
autoimmune	1
autophagosome	1
avianfecal	1
awake	1
back	1
background-	1
bacteriologic	1
bad	1
balkan	1
ballistic	1
basolateral	1
amazonian	1
altitudinal	1
alrt	1
4th	1
34-year	1
3730xl	1
39-year	1
392bp	1
3lg1bzsi	1
3mkv3bal	1
3these	1
440bp	1
4these	1
alpha	1
5-min	1
52a	1
54-year	1
57-year	1
5th	1
5′-aaa	1
5′-aga	1
6-year	1
32-year	1
3.1Å	1
2d6n4cve	1
2d	1
-continuous	1
-convalescent	1
-dead	1
-dependent	1
-genesf	1
-next	1
-related	1
-zoonotic	1
1,225-bp	1
10-yearold	1
140mm	1
16s	1
17-year	1
17th	1
19year	1
1x	1
20th	1
63-year	1
84th	1
8ab	1
adiponectin	1
adjusted	1
adjuvant	1
administered	1
adolescent	1
adrf	1
aerobic	1
affluent	1
agatcggaagagcacacgtctgaactcc	1
ageing	1
agrarian	1