This is a table of type adverb and their frequencies. Use it to search & browse the list to learn more about your study carrel.
adverb | frequency |
---|---|
also | 3249 |
however | 1718 |
well | 1477 |
significantly | 1098 |
therefore | 634 |
highly | 576 |
recently | 525 |
even | 483 |
furthermore | 470 |
respectively | 457 |
previously | 418 |
often | 412 |
moreover | 397 |
directly | 343 |
now | 339 |
together | 320 |
still | 313 |
especially | 310 |
particularly | 296 |
currently | 294 |
specifically | 269 |
less | 258 |
rather | 258 |
interestingly | 239 |
first | 229 |
rapidly | 225 |
mainly | 222 |
finally | 214 |
yet | 211 |
thereby | 208 |
similarly | 207 |
prior | 199 |
alone | 193 |
already | 186 |
potentially | 184 |
long | 184 |
generally | 183 |
relatively | 182 |
indeed | 166 |
later | 165 |
much | 162 |
strongly | 161 |
far | 160 |
almost | 152 |
usually | 150 |
clearly | 150 |
widely | 148 |
probably | 143 |
largely | 143 |
early | 143 |
primarily | 140 |
effectively | 140 |
fully | 139 |
approximately | 139 |
additionally | 139 |
subsequently | 134 |
completely | 132 |
commonly | 130 |
efficiently | 127 |
likely | 124 |
hence | 124 |
least | 122 |
typically | 118 |
frequently | 118 |
partially | 114 |
genetically | 113 |
simultaneously | 113 |
newly | 110 |
possibly | 109 |
closely | 109 |
importantly | 106 |
selectively | 104 |
markedly | 104 |
just | 102 |
differentially | 100 |
poorly | 97 |
initially | 97 |
better | 95 |
negatively | 93 |
consequently | 91 |
predominantly | 90 |
naturally | 90 |
successfully | 88 |
critically | 88 |
extremely | 87 |
clinically | 87 |
positively | 83 |
normally | 83 |
sometimes | 83 |
instead | 81 |
dramatically | 81 |
functionally | 79 |
quickly | 77 |
greatly | 77 |
always | 77 |
nevertheless | 75 |
easily | 75 |
immediately | 74 |
perhaps | 74 |
longer | 73 |
earlier | 72 |
ultimately | 71 |
extensively | 71 |
notably | 67 |
regardless | 65 |
preferentially | 64 |
mostly | 63 |
eventually | 63 |
broadly | 63 |
readily | 62 |
statistically | 61 |
daily | 61 |
slightly | 60 |
likewise | 58 |
severely | 57 |
nearly | 57 |
conversely | 57 |
overall | 56 |
gradually | 56 |
constitutively | 56 |
consistently | 55 |
namely | 55 |
double | 55 |
actively | 54 |
accordingly | 54 |
worldwide | 52 |
increasingly | 52 |
continuously | 51 |
back | 51 |
alternatively | 50 |
exclusively | 50 |
experimentally | 50 |
substantially | 50 |
surprisingly | 50 |
twice | 49 |
second | 49 |
presumably | 49 |
actually | 49 |
otherwise | 48 |
next | 48 |
equally | 48 |
forward | 47 |
orally | 47 |
quite | 47 |
intranasally | 46 |
tightly | 45 |
independently | 45 |
apparently | 45 |
best | 44 |
never | 43 |
partly | 42 |
differently | 41 |
biologically | 41 |
collectively | 40 |
thereafter | 39 |
indirectly | 39 |
briefly | 39 |
locally | 39 |
virtually | 38 |
simply | 38 |
randomly | 38 |
originally | 38 |
considerably | 38 |
sufficiently | 37 |
n't | 36 |
remarkably | 36 |
soon | 35 |
carefully | 35 |
freshly | 34 |
commercially | 33 |
unfortunately | 32 |
apart | 32 |
ahead | 32 |
ago | 32 |
live | 31 |
firstly | 31 |
accurately | 31 |
properly | 31 |
slowly | 31 |
systemically | 30 |
spontaneously | 30 |
lastly | 30 |
ever | 29 |
altogether | 29 |
dependently | 29 |
enough | 29 |
essentially | 29 |
entirely | 29 |
necessarily | 29 |
rarely | 29 |
secondly | 29 |
solely | 29 |
transiently | 29 |
separately | 28 |
repeatedly | 28 |
intraperitoneally | 28 |
certainly | 28 |
structurally | 27 |
intravenously | 27 |
dsdna | 26 |
chemically | 26 |
correctly | 26 |
regularly | 26 |
either | 26 |
subcutaneously | 26 |
nt | 26 |
postoperatively | 25 |
passively | 25 |
globally | 25 |
irrespective | 24 |
chronically | 24 |
immunologically | 24 |
inherently | 24 |
inversely | 24 |
precisely | 24 |
occasionally | 24 |
quantitatively | 24 |
short | 24 |
shortly | 24 |
totally | 24 |
profoundly | 23 |
nonetheless | 23 |
online | 23 |
persistently | 23 |
prospectively | 23 |
temporally | 23 |
visually | 23 |
somewhat | 22 |
routinely | 22 |
downstream | 22 |
covalently | 22 |
adequately | 22 |
acutely | 22 |
historically | 21 |
around | 21 |
away | 21 |
ns3 | 21 |
obviously | 21 |
strictly | 21 |
strikingly | 21 |
upstream | 20 |
systematically | 20 |
physically | 20 |
faster | 20 |
intracellularly | 19 |
appropriately | 19 |
drastically | 19 |
endogenously | 19 |
physiologically | 19 |
sexually | 19 |
progressively | 19 |
stably | 19 |
versa | 19 |
uniquely | 18 |
traditionally | 18 |
potently | 18 |
individually | 18 |
heavily | 18 |
late | 17 |
dynamically | 17 |
fast | 17 |
freely | 17 |
single | 17 |
moderately | 17 |
presently | 17 |
unexpectedly | 17 |
constantly | 16 |
deeply | 16 |
higher | 16 |
concomitantly | 16 |
comprehensively | 16 |
elsewhere | 16 |
third | 16 |
rationally | 16 |
temporarily | 16 |
therapeutically | 16 |
seriously | 16 |
synergistically | 16 |
sequentially | 15 |
safely | 15 |
robustly | 15 |
principally | 15 |
pdna | 15 |
mucosally | 15 |
meanwhile | 15 |
interferon | 15 |
crucially | 15 |
virally | 15 |
externally | 14 |
adoptively | 14 |
continually | 14 |
encephalitis | 14 |
incompletely | 14 |
internally | 14 |
right | 14 |
theoretically | 14 |
transcriptionally | 14 |
abnormally | 13 |
adversely | 13 |
evolutionarily | 13 |
exactly | 13 |
geographically | 13 |
histologically | 13 |
intrinsically | 13 |
merely | 13 |
phenotypically | 13 |
roughly | 13 |
suddenly | 13 |
annually | 12 |
bilaterally | 12 |
biochemically | 12 |
exogenously | 12 |
classically | 12 |
herein | 12 |
thoroughly | 12 |
truly | 12 |
universally | 12 |
outside | 12 |
promptly | 11 |
abundantly | 11 |
close | 11 |
explicitly | 11 |
fairly | 11 |
ideally | 11 |
intensively | 11 |
maternally | 11 |
antigenically | 11 |
reliably | 11 |
reversibly | 11 |
socially | 11 |
spatially | 11 |
terminally | 11 |
undoubtedly | 11 |
unilaterally | 11 |
urgently | 11 |
retrospectively | 11 |
formally | 10 |
aside | 10 |
basically | 10 |
concurrently | 10 |
dsrna | 10 |
exponentially | 10 |
intramuscularly | 10 |
paradoxically | 10 |
qualitatively | 10 |
really | 10 |
top | 10 |
whereas | 10 |
latently | 9 |
automatically | 9 |
comparatively | 9 |
cooperatively | 9 |
fine | 9 |
fortunately | 9 |
home | 9 |
intradermally | 9 |
hardly | 9 |
lower | 9 |
reportedly | 9 |
uniformly | 9 |
ubiquitously | 9 |
serially | 9 |
massively | 9 |
pharmacologically | 9 |
weakly | 9 |
morphologically | 9 |
extracellularly | 8 |
-synuclein | 8 |
absolutely | 8 |
afterwards | 8 |
artificially | 8 |
conditionally | 8 |
economically | 8 |
empirically | 8 |
enzymatically | 8 |
developmentally | 8 |
formerly | 8 |
overnight | 8 |
maximally | 8 |
stnfr | 8 |
retrogradely | 8 |
sharply | 8 |
optimally | 8 |
nowadays | 8 |
neonatally | 8 |
characteristically | 7 |
immunohistochemically | 7 |
horizontally | 7 |
hopefully | 7 |
course | 7 |
convincingly | 7 |
conventionally | 7 |
consecutively | 7 |
beforehand | 7 |
calmly | 7 |
ca | 7 |
besides | 7 |
barely | 7 |
bacterially | 7 |
anatomically | 7 |
inside | 7 |
inappropriately | 7 |
parenterally | 7 |
intensely | 7 |
reasonably | 7 |
mildly | 7 |
vastly | 7 |
topographically | 7 |
thirdly | 7 |
tentatively | 7 |
synaptically | 7 |
remotely | 7 |
vertically | 7 |
publicly | 7 |
prenatally | 7 |
pathologically | 7 |
overseas | 7 |
mutually | 7 |
molecularly | 7 |
proteolytically | 7 |
finely | 6 |
marginally | 6 |
low | 6 |
linearly | 6 |
irreversibly | 6 |
internationally | 6 |
inflamm | 6 |
fundamentally | 6 |
digitally | 6 |
dose | 6 |
dominantly | 6 |
diffusely | 6 |
densely | 6 |
definitely | 6 |
arguably | 6 |
objectively | 6 |
near | 6 |
magnetically | 6 |
oppositely | 6 |
seemingly | 6 |
permanently | 6 |
viral | 6 |
topically | 6 |
tangentially | 6 |
steadily | 6 |
specially | 6 |
slow | 6 |
strategically | 6 |
reproducibly | 6 |
preoperatively | 6 |
preferably | 6 |
predominately | 6 |
phylogenetically | 6 |
wide | 6 |
prophylactically | 6 |
financially | 5 |
electrophysiologically | 5 |
else | 5 |
evenly | 5 |
inevitably | 5 |
fluorescently | 5 |
foremost | 5 |
high | 5 |
contextually | 5 |
curiously | 5 |
anterogradely | 5 |
competitively | 5 |
closer | 5 |
clonally | 5 |
centrally | 5 |
cantly | 5 |
cally | 5 |
backward | 5 |
iteratively | 5 |
along | 5 |
alike | 5 |
aberrantly | 5 |
intimately | 5 |
instantly | 5 |
jointly | 5 |
productively | 5 |
kindly | 5 |
thereto | 5 |
thereof | 5 |
surely | 5 |
somehow | 5 |
scarcely | 5 |
reverse | 5 |
radially | 5 |
putatively | 5 |
ps3p | 5 |
weekly | 5 |
peripherally | 5 |
onwards | 5 |
nasally | 5 |
minimally | 5 |
mechanistically | 5 |
mechanically | 5 |
matter | 5 |
longitudinally | 5 |
laterally | 5 |
perfectly | 5 |
inconsistently | 4 |
hereby | 4 |
ill | 4 |
immunosenescence | 4 |
inward | 4 |
innately | 4 |
intentionally | 4 |
invariably | 4 |
grossly | 4 |
half | 4 |
eg | 4 |
forth | 4 |
fold | 4 |
exceptionally | 4 |
little | 4 |
deliberately | 4 |
cold | 4 |
c3h | 4 |
afterward | 4 |
abruptly | 4 |
lightly | 4 |
evidently | 4 |
loosely | 4 |
ribavirin | 4 |
mbsa | 4 |
unusually | 4 |
thermally | 4 |
therein | 4 |
swiftly | 4 |
sporadically | 4 |
smoothly | 4 |
singly | 4 |
schematically | 4 |
ventrally | 4 |
reciprocally | 4 |
practically | 4 |
pp65 | 4 |
politically | 4 |
overly | 4 |
outward | 4 |
nationally | 4 |
muscimol | 4 |
prematurely | 4 |
flexibly | 3 |
graphically | 3 |
fourth | 3 |
excessively | 3 |
firmly | 3 |
exquisitely | 3 |
impressively | 3 |
ethically | 3 |
identically | 3 |
intravaginally | 3 |
inadequately | 3 |
intermittently | 3 |
intracerebrally | 3 |
intriguingly | 3 |
invasively | 3 |
inwardly | 3 |
iontophoretically | 3 |
enormously | 3 |
environmentally | 3 |
conspicuously | 3 |
emotionally | 3 |
conceivably | 3 |
-were | 3 |
autonomously | 3 |
blindly | 3 |
broad | 3 |
catalytically | 3 |
clear | 3 |
computationally | 3 |
majorly | 3 |
ectopically | 3 |
correspondingly | 3 |
distinctly | 3 |
dorsally | 3 |
doubly | 3 |
doubt | 3 |
downhill | 3 |
dually | 3 |
last | 3 |
as605858 | 3 |
medically | 3 |
regionally | 3 |
seldom | 3 |
signifcantly | 3 |
sparsely | 3 |
sublingually | 3 |
substantively | 3 |
successively | 3 |
synthetically | 3 |
technically | 3 |
tonically | 3 |
translationally | 3 |
tremendously | 3 |
unequivocally | 3 |
vigorously | 3 |
wholly | 3 |
within | 3 |
wrongly | 3 |
monotonically | 3 |
round | 3 |
technologically | 3 |
recombinantly | 3 |
pfu)/ml | 3 |
mrnas | 3 |
psychologically | 3 |
natively | 3 |
neatly | 3 |
neuraminidase | 3 |
opposite | 3 |
outdoors | 3 |
perk | 3 |
officially | 3 |
popularly | 3 |
post | 3 |
postsynaptically | 3 |
presynaptically | 3 |
plausibly | 3 |
prominently | 3 |
proportionally | 3 |
free | 2 |
exceedingly | 2 |
etiologically | 2 |
everyday | 2 |
intuitively | 2 |
fluorochrome | 2 |
favorably | 2 |
focally | 2 |
equitably | 2 |
equivalently | 2 |
diversely | 2 |
epochs | 2 |
epigenetically | 2 |
epidermally | 2 |
eosinophil | 2 |
electrically | 2 |
ecologically | 2 |
downwards | 2 |
disulfide | 2 |
desperately | 2 |
gadd45b | 2 |
furthest | 2 |
inos | 2 |
gene(s | 2 |
generically | 2 |
interfere | 2 |
insufficiently | 2 |
institutionally | 2 |
insignificantly | 2 |
definitively | 2 |
infrequently | 2 |
infectiously | 2 |
indiscriminately | 2 |
incredibly | 2 |
incorrectly | 2 |
imo | 2 |
immunohistologically | 2 |
il)-8 | 2 |
il)-2 | 2 |
hormonally | 2 |
hkely | 2 |
histochemically | 2 |
hirudin | 2 |
hierarchically | 2 |
heroically | 2 |
hemodynamically | 2 |
demonstrably | 2 |
chiefly | 2 |
deeper | 2 |
deep | 2 |
badly | 2 |
backwards | 2 |
avidly | 2 |
asymptomatically | 2 |
aseptically | 2 |
artinm | 2 |
arterially | 2 |
aloud | 2 |
algorithmically | 2 |
alarmingly | 2 |
aeragmosa | 2 |
admittedly | 2 |
additively | 2 |
acsf | 2 |
aapcs | 2 |
6-ohda | 2 |
-that | 2 |
-r | 2 |
-mainly | 2 |
-especially | 2 |
-ar | 2 |
basolaterally | 2 |
behaviorally | 2 |
behind | 2 |
competently | 2 |
dec | 2 |
culturally | 2 |
covid+ | 2 |
controversially | 2 |
contralaterally | 2 |
conservatively | 2 |
consequentely | 2 |
conclusively | 2 |
conceptually | 2 |
comparably | 2 |
beneficially | 2 |
comfortably | 2 |
colloidally | 2 |
coincidently | 2 |
cohesively | 2 |
cnkr | 2 |
ciently | 2 |
causally | 2 |
bmal1 | 2 |
biosynthetically | 2 |
intrathecally | 2 |
everywhere | 2 |
ipl | 2 |
spinally | 2 |
sort | 2 |
sorely | 2 |
somewhere | 2 |
somatosensory | 2 |
somatically | 2 |
slower | 2 |
signicantly | 2 |
shrna | 2 |
severly | 2 |
serologically | 2 |
scientifically | 2 |
rvrg | 2 |
rll | 2 |
rigorously | 2 |
rightly | 2 |
richly | 2 |
reversely | 2 |
relatedly | 2 |
recursively | 2 |
radically | 2 |
r91a | 2 |
spectrophotometrically | 2 |
stereotaxically | 2 |
quadrivalent | 2 |
surgically | 2 |
ipsilaterally | 2 |
~2.3-fold | 2 |
voluntarily | 2 |
vere | 2 |
variously | 2 |
variably | 2 |
usefully | 2 |
upward | 2 |
unidirectionally | 2 |
unexceptionally | 2 |
unambiguously | 2 |
unabated | 2 |
transneuronally | 2 |
tnf~ | 2 |
tnfrsf17 | 2 |
tnfab | 2 |
timely | 2 |
throughout | 2 |
though | 2 |
tenfold | 2 |
syngeneically | 2 |
quicker | 2 |
upwards | 2 |
purposefully | 2 |
noncovalently | 2 |
nicely | 2 |
neurosphere | 2 |
naï | 2 |
nap | 2 |
n=95 | 2 |
n=5 | 2 |
n=41 | 2 |
n=26 | 2 |
n=18 | 2 |
monotonously | 2 |
modestly | 2 |
mistakenly | 2 |
metabolically | 2 |
meaningfully | 2 |
mean_+sd | 2 |
maybe | 2 |
mathematically | 2 |
logically | 2 |
literally | 2 |
publically | 2 |
light | 2 |
niosomes | 2 |
macroscopically | 2 |
nonlethally | 2 |
phasically | 2 |
notoriously | 2 |
psychophysically | 2 |
protectively | 2 |
pretty | 2 |
preliminarily | 2 |
postnatally | 2 |
posteriorly | 2 |
polyclonally | 2 |
photometrically | 2 |
proactively | 2 |
personally | 2 |
orthographically | 2 |
oligonucleotide | 2 |
periodically | 2 |
oniy | 2 |
organizationally | 2 |
proximally | 2 |
perinatally | 2 |
osmotically | 2 |
parallel | 2 |
exu'emely | 1 |
full | 1 |
frcm | 1 |
fos).currently | 1 |
forwards | 1 |
fortuitously | 1 |
forcibly | 1 |
forcedly | 1 |
fondly | 1 |
fnst | 1 |
generaily | 1 |
fmlp | 1 |
fluently | 1 |
fifth | 1 |
extremly | 1 |
fatally | 1 |
farther | 1 |
factor-~j3 | 1 |
ficoli | 1 |
h-2d. | 1 |
generously | 1 |
ha-~e | 1 |
hastily | 1 |
expeditiously | 1 |
harmlessly | 1 |
hardest | 1 |
harder | 1 |
hard | 1 |
hadv | 1 |
habitually | 1 |
h137 | 1 |
genetlcally | 1 |
h-2kb | 1 |
h-2-and | 1 |
grammatically | 1 |
graciously | 1 |
gpotently | 1 |
governmentally | 1 |
gonadally | 1 |
gnificantly | 1 |
extra | 1 |
electrophoretically | 1 |
evolutionally | 1 |
downstairs | 1 |
eif2α | 1 |
egfp | 1 |
effcctively | 1 |
eady | 1 |
durably | 1 |
dubmut | 1 |
dual | 1 |
downward | 1 |
downregu | 1 |
ethologically | 1 |
doubtless | 1 |
donally | 1 |
domestically | 1 |
dnr | 1 |
divergently | 1 |
disulphide | 1 |
distantly | 1 |
hereafter | 1 |
electronically | 1 |
electrostatically | 1 |
eletrophysiologically | 1 |
eloquently | 1 |
ethnically | 1 |
especifically | 1 |
erthroid | 1 |
epizootifally | 1 |
epidemiologically | 1 |
ephrinb1 | 1 |
eovalently | 1 |
enzymatitally | 1 |
enzymatieally | 1 |
enthusimastlcally | 1 |
enterally | 1 |
energetically | 1 |
endogenous | 1 |
endemically | 1 |
encouragingly | 1 |
empiric | 1 |
eminently | 1 |
henceforth | 1 |
inflammation.-moreover | 1 |
heterologously | 1 |
interbilayer | 1 |
intramolecularly | 1 |
intracellular | 1 |
interstingly | 1 |
interleukin-6 | 1 |
interleukin-2 | 1 |
interesiingly | 1 |
interdependently | 1 |
interchangeably | 1 |
intensitydependently | 1 |
inductively | 1 |
instantaneously | 1 |
inseparably | 1 |
initally | 1 |
informatively | 1 |
informally | 1 |
discernibly | 1 |
inextricably | 1 |
inexpensively | 1 |
intraoperatively | 1 |
intrapentoneally | 1 |
intrarectally | 1 |
intrarnustularly | 1 |
knowingly | 1 |
kind | 1 |
junctionally | 1 |
jrmt12 | 1 |
joint | 1 |
isotopically | 1 |
irst | 1 |
irrespectively | 1 |
ironically | 1 |
irf3-potentially | 1 |
ionophore | 1 |
invasionally | 1 |
introductorily | 1 |
intricately | 1 |
intravitatly | 1 |
intratracheally | 1 |
intrathymically | 1 |
inevitablely | 1 |
inducibly | 1 |
heterotopia | 1 |
hsv-1 | 1 |
icularly | 1 |
icss | 1 |
ics-200 | 1 |
i,~ | 1 |
hysterically | 1 |
hyper | 1 |
hydrodynamically | 1 |
hugely | 1 |
hsp90b1 | 1 |
indoors | 1 |
hourly | 1 |
homogeneously | 1 |
homodimer | 1 |
hlly | 1 |
histopathologlcally | 1 |
hiper | 1 |
highest | 1 |
hif-1alpha | 1 |
ie | 1 |
ifn)-gamma | 1 |
iikely | 1 |
ikkbeta | 1 |
indistinguishably | 1 |
inderectly | 1 |
indefinitely | 1 |
incrementally | 1 |
inadvertently | 1 |
imv~ | 1 |
imrffe?diately | 1 |
improperly | 1 |
implicitly | 1 |
immunomagnetically | 1 |
immunoh[stochemloally | 1 |
immunochemically | 1 |
immunhistochemically | 1 |
immensely | 1 |
immediatley | 1 |
il6 | 1 |
il,1 | 1 |
disproportionately | 1 |
cognitively | 1 |
diregtly | 1 |
amfrinsulin | 1 |
anterior | 1 |
anfigenically | 1 |
anecdotally | 1 |
andrographolide | 1 |
andmarkedly | 1 |
analogously | 1 |
anaerobically | 1 |
amperometrically | 1 |
ambiguously | 1 |
antidromically | 1 |
alternately | 1 |
allogeneically | 1 |
allelically | 1 |
aiter | 1 |
aignificantly | 1 |
ahove | 1 |
aggressively | 1 |
aggrega- | 1 |
antibacterially | 1 |
antimicrobially | 1 |
directionally | 1 |
asleep | 1 |
autologously | 1 |
atso | 1 |
asynchronously | 1 |
asymmetrically | 1 |
astrocyte | 1 |
assumably | 1 |
associatively | 1 |
assays | 1 |
asana | 1 |
antiretroviral | 1 |
arrhythmias | 1 |
arabinogalactan | 1 |
appreciably | 1 |
appose | 1 |
apparantly | 1 |
apically | 1 |
anywhere | 1 |
anyway | 1 |
ag1487 | 1 |
afloat | 1 |
afgf | 1 |
-namely | 1 |
0-strongly | 1 |
-will | 1 |
-well | 1 |
-tg;fcgriib | 1 |
-task | 1 |
-only | 1 |
-notably | 1 |
-nkg2a | 1 |
-methods | 1 |
affectively | 1 |
-likely | 1 |
-li | 1 |
-just | 1 |
-ep | 1 |
-despite | 1 |
-b13 | 1 |
-agatoxin | 1 |
-178 | 1 |
100-fold | 1 |
15-fold | 1 |
19k | 1 |
24hr | 1 |
aerwgmosa | 1 |
aerially | 1 |
adversly | 1 |
adjunctly | 1 |
across | 1 |
accutely | 1 |
accidentally | 1 |
ac- | 1 |
ac(dose | 1 |
ably | 1 |
abarrently | 1 |
ab | 1 |
a3g | 1 |
a(mino | 1 |
5-extremely | 1 |
4-fold | 1 |
30-fold | 1 |
availableprobably | 1 |
b220 | 1 |
b2r | 1 |
cord-273479-kira7mz6 | 1 |
crossly | 1 |
crldcally | 1 |
criffcally | 1 |
creatively | 1 |
covertly | 1 |
counter | 1 |
cos-7 | 1 |
correlatively | 1 |
coordinately | 1 |
communally | 1 |
conslstently | 1 |
conslanlly | 1 |
conseguently | 1 |
congenitally | 1 |
congenially | 1 |
conformationally | 1 |
confidently | 1 |
complete | 1 |
cttccttccggatcacgtgttcat3 | 1 |
cumulatively | 1 |
currenly | 1 |
cyclically | 1 |
direct | 1 |
dimensionally | 1 |
diga | 1 |
diagnostically | 1 |
devastatingly | 1 |
detrimentally | 1 |
detectably | 1 |
desirably | 1 |
dendritically | 1 |
demographically | 1 |
defintely | 1 |
dearly | 1 |
dark | 1 |
dally | 1 |
dag)dependent | 1 |
cytoplasmatically | 1 |
cyclooxygenase | 1 |
complelely | 1 |
commefieally | 1 |
bad | 1 |
biphasically | 1 |
casually | 1 |
caseosa | 1 |
canpletely | 1 |
calcein | 1 |
bzlf-1 | 1 |
briskly | 1 |
bravely | 1 |
botanically | 1 |
biolistically | 1 |
combinatorially | 1 |
bioinformatically | 1 |
bilayer | 1 |
bidirectionally | 1 |
bicistronically | 1 |
bhk-21 | 1 |
beyond | 1 |
bay117082 | 1 |
basally | 1 |
cbronically | 1 |
ccd1a | 1 |
ccl22 | 1 |
cdcs | 1 |
collaboratively | 1 |
coincidentally | 1 |
latter | 1 |
clinicelly | 1 |
clinicat | 1 |
cleanly | 1 |
ckmically | 1 |
ciinmonly | 1 |
ciearly | 1 |
chronologically | 1 |
chromosomally | 1 |
chop10 | 1 |
chillingly | 1 |
chaotically | 1 |
cflip | 1 |
cfa01 | 1 |
centrifugally | 1 |
lately | 1 |
naturalistically | 1 |
lb | 1 |
situationally | 1 |
sometime | 1 |
someplace | 1 |
somatotopy | 1 |
solidly | 1 |
smartly | 1 |
smallest | 1 |
slowest | 1 |
skimpily | 1 |
site(s | 1 |
sophistically | 1 |
sisni.ficantly | 1 |
simultaneensly | 1 |
simplistically | 1 |
siloed | 1 |
signlflcantly | 1 |
significaptly | 1 |
sigmficantly | 1 |
siglfificantly | 1 |
sooner | 1 |
speciflcally | 1 |
left | 1 |
straight | 1 |
supposedly | 1 |
sucessfully | 1 |
subsequentially | 1 |
suboptimally | 1 |
subjectively | 1 |
subendothelially | 1 |
subcortically | 1 |
subclinically | 1 |
sterily | 1 |
spectrofluorometrically | 1 |
sterically | 1 |
stereotypically | 1 |
stereotactically | 1 |
stationary | 1 |
stationally | 1 |
spontanuously | 1 |
spla | 1 |
sphere | 1 |
sigalfkzntly | 1 |
sig | 1 |
sideways | 1 |
rightward | 1 |
rs)-{4-[5-(4-fluorophenyl)-2-methylsulfanyl-3h | 1 |
rrcently | 1 |
rostroventrally | 1 |
rostrally | 1 |
rnf185 | 1 |
rnd2-bound | 1 |
rituximab | 1 |
rigidly | 1 |
riately | 1 |
shghtly | 1 |
rhythmically | 1 |
retinotopy | 1 |
resoundingly | 1 |
repetitively | 1 |
reperto4!6~.~espectively | 1 |
remote | 1 |
religiously | 1 |
reiteratively | 1 |
rtms | 1 |
sad-1 | 1 |
sadly | 1 |
safety | 1 |
sgsequently | 1 |
severe | 1 |
serotypically | 1 |
serendipitously | 1 |
sepsc | 1 |
seperately | 1 |
semiquanfitatively | 1 |
semi | 1 |
selfassembly | 1 |
selectin,-pselectin | 1 |
sectionally | 1 |
secrete | 1 |
secondarily | 1 |
scan1 | 1 |
sc19220 | 1 |
satisfactorily | 1 |
samples.were | 1 |
suppressively | 1 |
suprisingly | 1 |
sure | 1 |
upto | 1 |
visibly | 1 |
viscerally | 1 |
vice | 1 |
ventrocaudally | 1 |
vehemently | 1 |
utterly | 1 |
uspccially | 1 |
usp13 | 1 |
unwittingly | 1 |
unequally | 1 |
unsurprisingly | 1 |
unspeeifically | 1 |
unspecifically | 1 |
unquestionably | 1 |
unpleasantly | 1 |
unknowingly | 1 |
unfavorably | 1 |
unfairly | 1 |
visuospatially | 1 |
vitally | 1 |
vlnst | 1 |
voraciously | 1 |
≤200 | 1 |
® | 1 |
~-melanocyte | 1 |
~'ere | 1 |
zm241385 | 1 |
zealously | 1 |
yopb | 1 |
ymrna | 1 |
www.cdc.gov/nip/recs/adult-schedule.htm | 1 |
www.cdc | 1 |
wouid | 1 |
worse | 1 |
worryingly | 1 |
wldely | 1 |
wi~ | 1 |
westward | 1 |
w^here | 1 |
unevenly | 1 |
underground | 1 |
surl~:emts | 1 |
tgf-[31 | 1 |
thirly | 1 |
thioglycollate | 1 |
thinly | 1 |
thereupon | 1 |
thence | 1 |
thapsigargin | 1 |
th | 1 |
tgif2lx | 1 |
tetop- | 1 |
und | 1 |
tendentiously | 1 |
temporarely | 1 |
tellingly | 1 |
tcr)/nkr | 1 |
symptomatically | 1 |
symmetrically | 1 |
syeergistically | 1 |
sustainably | 1 |
thoughtfully | 1 |
thoughtlessly | 1 |
thoughtout | 1 |
thy-1 | 1 |
unconventionally | 1 |
unconsciously | 1 |
unavoidably | 1 |
unacceptably | 1 |
txmol | 1 |
trim32 | 1 |
transparently | 1 |
transgenically | 1 |
transcrlptionally | 1 |
transcellularly | 1 |
traf-6 | 1 |
tp-/-significantly | 1 |
topologically | 1 |
tmem16a | 1 |
tly | 1 |
tlssue | 1 |
tighlly | 1 |
regulary | 1 |
regrettably | 1 |
redundantly | 1 |
neurally | 1 |
ngld | 1 |
nfat5 | 1 |
nf48 | 1 |
nextly | 1 |
new | 1 |
neutrophi | 1 |
neurotrophically | 1 |
neuroendocrinologically | 1 |
nely | 1 |
nanocarrier | 1 |
neither | 1 |
nearby | 1 |
nc5 | 1 |
nb | 1 |
naturallythat | 1 |
nationwide | 1 |
narrowly | 1 |
nanowell | 1 |
nimbly | 1 |
nitroprusside | 1 |
nltimately | 1 |
no.2016 | 1 |
o.o01 | 1 |
o)~mately | 1 |
nutritionally | 1 |
numerically | 1 |
nucleotide | 1 |
nuclearly | 1 |
ntrimethyl | 1 |
nsps | 1 |
ns3-ns4a | 1 |
nr8383 | 1 |
notebly | 1 |
nonspecifically | 1 |
nonseparable | 1 |
nonoperatively | 1 |
nonfederally | 1 |
noncompetitively | 1 |
nomally | 1 |
nanomaterial | 1 |
naively | 1 |
observation).hiv | 1 |
luckily | 1 |
mass | 1 |
manually | 1 |
major | 1 |
mab | 1 |
m'e | 1 |
ly367385 | 1 |
lvemally | 1 |
luminally | 1 |
ltiib | 1 |
n=6).to | 1 |
lrrfip1 | 1 |
lmp-1 | 1 |
lipopeptide | 1 |
linkage"-were | 1 |
leukemias | 1 |
leucocyte | 1 |
lethally | 1 |
legally | 1 |
materially | 1 |
mavs | 1 |
mbmf1r5 | 1 |
medially | 1 |
n=46 | 1 |
n=28 | 1 |
multi | 1 |
mucb | 1 |
msteap | 1 |
morever | 1 |
monosynaptically | 1 |
monocularly | 1 |
mnccanitantly | 1 |
mitotically | 1 |
mindlessly | 1 |
microscopically | 1 |
microparticles | 1 |
meticulously | 1 |
methodologically | 1 |
mentally | 1 |
mediolaterally | 1 |
obliquely | 1 |
obsessively | 1 |
recurrently | 1 |
predictably | 1 |
professionally | 1 |
procedurally | 1 |
problably | 1 |
probabely | 1 |
presumingly | 1 |
preranably | 1 |
preferenhally | 1 |
predominantely | 1 |
poxviral | 1 |
pivotally | 1 |
powerfully | 1 |
potent | 1 |
posttranslationally | 1 |
postnasally | 1 |
polysaccharidic | 1 |
poloxamer | 1 |
pmfouedly | 1 |
pmdominately | 1 |
prohably | 1 |
proieflaam | 1 |
promiscuously | 1 |
promisingly | 1 |
rectally | 1 |
reassuringly | 1 |
rapldly | 1 |
rapid | 1 |
r6spectively | 1 |
r01ai033144 | 1 |
quick | 1 |
quantjtatively | 1 |
quantatively | 1 |
quadrupedally | 1 |
purely | 1 |
psychosomatically | 1 |
proximately | 1 |
provocatively | 1 |
provisionally | 1 |
provably | 1 |
proteolytieally | 1 |
plus | 1 |
pinocytotically | 1 |
ofendotoxin | 1 |
open | 1 |
outright | 1 |
orthotopically | 1 |
orthogonally | 1 |
orm1-like | 1 |
organically | 1 |
ordinately | 1 |
optically | 1 |
operatively | 1 |
onward | 1 |
pictorially | 1 |
omega-6 | 1 |
older | 1 |
ol | 1 |
ohemiluminescense= | 1 |
oftentimes | 1 |
oft | 1 |
ofneisseriagonorrhoeae | 1 |
offline | 1 |
outwards | 1 |
oxidatively | 1 |
p,2 | 1 |
p38mapk | 1 |
pharmacogenetically | 1 |
pgpa | 1 |
persuasively | 1 |
perspectively | 1 |
perpendicularly | 1 |
perorally | 1 |
peritoneally | 1 |
periopuratively | 1 |
perioperatively | 1 |
pdwt~ | 1 |
pcmvcore | 1 |
pathophysiologically | 1 |
pathogenetically | 1 |
particulary | 1 |
parasagittally | 1 |
paracellularly | 1 |
par-3 | 1 |
-1117 | 1 |