This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.
entity | type | frequency |
---|---|---|
virus | TAXON | 582 |
china | GPE | 169 |
coronavirus | TAXON | 166 |
infection | DISEASE | 160 |
pigs | TAXON | 136 |
diarrhea | DISEASE | 134 |
viruses | TAXON | 132 |
pdcov | ORG | 118 |
piglets | TAXON | 113 |
sars | DISEASE | 113 |
cpv | ORG | 113 |
ibv | ORG | 110 |
swine | TAXON | 107 |
diarrhoea | DISEASE | 104 |
porcine | TAXON | 102 |
viral | TAXON | 100 |
animals | TAXON | 97 |
covid | ORG | 95 |
sars cov 2 | ORG | 90 |
mers | DISEASE | 82 |
rna | ORG | 79 |
animal | TAXON | 76 |
nucleotide | CHEMICAL | 69 |
human | TAXON | 68 |
cov | ORG | 68 |
sdpp | ORG | 62 |
covid 19 | ORG | 62 |
infections | DISEASE | 55 |
italy | GPE | 55 |
belgium | GPE | 53 |
canine parvovirus | TAXON | 51 |
mers cov | ORG | 50 |
bovine | TAXON | 50 |
cattle | TAXON | 46 |
infectious bronchitis | DISEASE | 46 |
outbreaks | TAXON | 45 |
amino acid | CHEMICAL | 44 |
europe | LOC | 43 |
respiratory disease | DISEASE | 41 |
pcr | ORG | 41 |
li | CHEMICAL | 41 |
us | GPE | 39 |
covs | TAXON | 39 |
dogs | TAXON | 38 |
south korea | GPE | 38 |
iirt | ORG | 36 |
animal | TAXON | 36 |
porcine deltacoronavirus | TAXON | 36 |
pig | TAXON | 36 |
transbound emerg dis doi | PERSON | 35 |
sads cov | ORG | 33 |
rt | PERSON | 33 |
pneumonia | DISEASE | 32 |
bacteria | TAXON | 32 |
gii | ORG | 32 |
coronavirus | TAXON | 31 |
fever | DISEASE | 30 |
farms | TAXON | 30 |
avian | TAXON | 30 |
porcine | PERSON | 30 |
mycoplasma | ORG | 29 |
rt pcr | ORG | 29 |
igg | ORG | 29 |
pbs | ORG | 29 |
calves | TAXON | 29 |
bacterial | TAXON | 29 |
infectious disease | DISEASE | 29 |
gastroenteritis | DISEASE | 29 |
birds | TAXON | 29 |
middle east | LOC | 28 |
brd | ORG | 28 |
viral rna | TAXON | 27 |
cats | TAXON | 27 |
virus | TAXON | 27 |
prdc | TAXON | 27 |
knu | ORG | 27 |
genbank | ORG | 27 |
korea | GPE | 26 |
csfv | TAXON | 26 |
bats | TAXON | 26 |
kobuvirus | TAXON | 25 |
uk | GPE | 25 |
japan | GPE | 25 |
nucleic acid | CHEMICAL | 23 |
chickens | TAXON | 23 |
usa | GPE | 23 |
eu | ORG | 23 |
brazil | GPE | 23 |
wuhan | GPE | 22 |
ihr | ORG | 22 |
the united states | GPE | 21 |
humans | TAXON | 21 |
sars cov 1 | ORG | 21 |
spf | ORG | 20 |
vibrio | PERSON | 20 |
infectious diseases | DISEASE | 20 |
pathogen disease | DISEASE | 20 |
infectious | DISEASE | 19 |
sars cov | ORG | 19 |
vero | ORG | 18 |
ontario | GPE | 18 |
n | ORG | 18 |
viral diarrhea | DISEASE | 17 |
turkey | TAXON | 17 |
respiratory syndrome | DISEASE | 17 |
deaths | DISEASE | 17 |
bovine viral | TAXON | 17 |
bovine coronavirus | TAXON | 17 |
na | ORG | 17 |
viral rna | TAXON | 16 |
lee | PERSON | 16 |
al 2014 | PERSON | 16 |
bovis | TAXON | 16 |
mouse | TAXON | 15 |
circovirus | TAXON | 15 |
al 2016 | PERSON | 15 |
mexico | GPE | 15 |
canada | GPE | 15 |
bronchitis | DISEASE | 14 |
avian coronaviruses | TAXON | 14 |
tgev | ORG | 14 |
gi | ORG | 14 |
g2b | PERSON | 14 |
saudi arabia | GPE | 13 |
human | TAXON | 13 |
idv | ORG | 13 |
amino acids | CHEMICAL | 13 |
death | DISEASE | 13 |
marine mammals | TAXON | 13 |
u r e | CHEMICAL | 12 |
bvdv | ORG | 12 |
coronaviridae | ORG | 12 |
france | GPE | 12 |
cdv | TAXON | 12 |
animal products | TAXON | 12 |
bronchopneumonia | GPE | 12 |
ncov | ORG | 12 |
nucleotides | CHEMICAL | 12 |
ped | DISEASE | 11 |
bovine | TAXON | 11 |
cpe | ORG | 11 |
germany | GPE | 11 |
hubei | GPE | 11 |
influenza | GPE | 11 |
jeju island | LOC | 11 |
newcastle | GPE | 11 |
newcastle disease | DISEASE | 11 |
canine | TAXON | 11 |
rh | PERSON | 11 |
shanghai | GPE | 11 |
dog | TAXON | 11 |
faeces | TAXON | 11 |
feedlot cattle | TAXON | 11 |
hosts | TAXON | 11 |
individuals | TAXON | 11 |
phosphate | CHEMICAL | 11 |
pulmonary disease | DISEASE | 11 |
portugal | GPE | 10 |
asia | LOC | 10 |
hong kong | GPE | 10 |
ihc | GPE | 10 |
iga | ORG | 10 |
non | ORG | 10 |
ns2 | TAXON | 10 |
al 2013 | PERSON | 10 |
schmallenberg | TAXON | 10 |
wildlife | TAXON | 10 |
coronavirus disease | DISEASE | 10 |
coronaviruses | TAXON | 10 |
foodborne | TAXON | 10 |
turkey coronavirus | TAXON | 10 |
viruses | TAXON | 10 |
bat coronaviruses | TAXON | 9 |
animals | TAXON | 9 |
fulton | GPE | 9 |
mouse | TAXON | 9 |
ns1 | ORG | 9 |
nigeria | GPE | 9 |
swine | TAXON | 9 |
viral | TAXON | 9 |
uvc | ORG | 9 |
bronchiolitis | DISEASE | 9 |
cows | TAXON | 9 |
domestic | TAXON | 9 |
horse | TAXON | 9 |
respiratory syndrome coronavirus | DISEASE | 9 |
respiratory syndrome coronavirus mers | DISEASE | 9 |
vomiting | DISEASE | 9 |
chicken | TAXON | 9 |
gram | PERSON | 8 |
ifa | ORG | 8 |
honduras | GPE | 8 |
guangdong province | GPE | 8 |
bat cov | PERSON | 8 |
fecv | TAXON | 8 |
dowgier | ORG | 8 |
csf | ORG | 8 |
molecular | GPE | 8 |
kobuvirus | ORG | 8 |
swine farms | TAXON | 8 |
united states | GPE | 8 |
canine parvovirus type | TAXON | 8 |
enteric disease | DISEASE | 8 |
feline | TAXON | 8 |
host | TAXON | 8 |
human coronavirus | TAXON | 8 |
pestiviruses | TAXON | 8 |
transmissible gastroenteritis virus | TAXON | 8 |
beef cattle | TAXON | 8 |
kor | PERSON | 7 |
prevalence | ORG | 7 |
pasteurella | PERSON | 7 |
oman | TAXON | 7 |
oie | ORG | 7 |
australia | GPE | 7 |
k | CHEMICAL | 7 |
iran | GPE | 7 |
iav | ORG | 7 |
salmonella | PERSON | 7 |
arabia | TAXON | 7 |
svm | ORG | 7 |
orf | ORG | 7 |
turkey | GPE | 7 |
dromedaries | TAXON | 7 |
uvb | ORG | 7 |
suis | TAXON | 7 |
porcine circovirus type 2 | TAXON | 7 |
pig farms | TAXON | 7 |
penicillin | CHEMICAL | 7 |
siga | ORG | 7 |
diarrhoeic cats | TAXON | 7 |
avian paramyxovirus | TAXON | 7 |
amino acid sequence identity | CHEMICAL | 7 |
acute respiratory syndrome | DISEASE | 7 |
who | ORG | 7 |
nipah | TAXON | 6 |
porcine deltacoronavirus | TAXON | 6 |
peru | GPE | 6 |
paris | GPE | 6 |
prrsv | TAXON | 6 |
pockit | ORG | 6 |
pec | ORG | 6 |
par | ORG | 6 |
ojkic | CHEMICAL | 6 |
epidemic diarrhea | DISEASE | 6 |
ncfad | ORG | 6 |
ncbi | ORG | 6 |
ii | ORG | 6 |
hpai | ORG | 6 |
guangdong | GPE | 6 |
gammacoronavirus | GPE | 6 |
bj | ORG | 6 |
aichi | ORG | 6 |
schmallenberg virus | TAXON | 6 |
rhinolophus | PERSON | 6 |
alpacas | TAXON | 6 |
sichuan | GPE | 6 |
dromedary camels | TAXON | 6 |
virulence | ORG | 6 |
porcine respiratory coronavirus | TAXON | 6 |
paramyxoviruses | TAXON | 6 |
pangolins | TAXON | 6 |
mice | TAXON | 6 |
encephalomyelitis | DISEASE | 6 |
encephalitis | DISEASE | 6 |
duck | TAXON | 6 |
infectious peritonitis | DISEASE | 6 |
domestic poultry | TAXON | 6 |
camels | TAXON | 6 |
bias | CHEMICAL | 6 |
bat | TAXON | 6 |
avian coronavirus | TAXON | 6 |
Ò | CHEMICAL | 6 |
wang | ORG | 6 |
vlasova | CHEMICAL | 6 |
canine parvoviruses | TAXON | 6 |
miniopterus | PERSON | 5 |
jee | ORG | 5 |
lfd | ORG | 5 |
mers cov infection | DISEASE | 5 |
marthaler | PERSON | 5 |
porcine epidemic diarrhea ped | ORG | 5 |
new south wales australia | GPE | 5 |
pedv n | ORG | 5 |
pneumonia | DISEASE | 5 |
india | GPE | 5 |
infection | DISEASE | 5 |
buonavoglia | CHEMICAL | 5 |
houhai | GPE | 5 |
hvr ii | GPE | 5 |
gershwin | PERSON | 5 |
fr tcov | PERSON | 5 |
fk | CHEMICAL | 5 |
eagle | CHEMICAL | 5 |
elisa | ORG | 5 |
doremalen | CHEMICAL | 5 |
canine | GPE | 5 |
spain | GPE | 5 |
appendix | GPE | 5 |
sdg | ORG | 5 |
id | DISEASE | 5 |
taiwan | GPE | 5 |
ncbi | CHEMICAL | 5 |
tamura | GPE | 5 |
viral protein | TAXON | 5 |
viral genomic sequences | TAXON | 5 |
turkey poults | TAXON | 5 |
transferrin | CHEMICAL | 5 |
the united kingdom | GPE | 5 |
terrestrial wildlife | TAXON | 5 |
syncytial virus | TAXON | 5 |
streptomycin | CHEMICAL | 5 |
ruminants | TAXON | 5 |
reproductive failure | DISEASE | 5 |
viral genome | TAXON | 5 |
uvr | ORG | 5 |
mammals | TAXON | 5 |
mammalian | TAXON | 5 |
genus deltacoronavirus | TAXON | 5 |
ferret | TAXON | 5 |
coronavirus sars cov | DISEASE | 5 |
avian paramyxovirus type | TAXON | 5 |
al 2018 | PERSON | 5 |
world health organisation | ORG | 5 |
woo et al 2012 | PERSON | 5 |
whj | ORG | 5 |
lin | PERSON | 4 |
life technologies | ORG | 4 |
lee lee | PERSON | 4 |
kumar stecher | PERSON | 4 |
pérez | PERSON | 4 |
jhm | ORG | 4 |
humblet | LOC | 4 |
human coronavirus 229e | TAXON | 4 |
mcda | ORG | 4 |
hrp | ORG | 4 |
headley | PERSON | 4 |
north america | LOC | 4 |
mem | ORG | 4 |
mhv | TAXON | 4 |
ntc | ORG | 4 |
netherlands | GPE | 4 |
nucleic acid analyzer | ORG | 4 |
orthomyxoviridae | TAXON | 4 |
pcv3 | TAXON | 4 |
peru l8 2008 | ORG | 4 |
ferguson | PERSON | 4 |
ha | ORG | 4 |
cdc | ORG | 4 |
fbs | DISEASE | 4 |
betacoronavirus | PERSON | 4 |
riyadh | TAXON | 4 |
ave | ORG | 4 |
africa | LOC | 4 |
amino acid | CHEMICAL | 4 |
ascaris | TAXON | 4 |
austria | GPE | 4 |
brsv | PERSON | 4 |
belgium disease | GPE | 4 |
belgium moderate | ORG | 4 |
bovine coronavirus | TAXON | 4 |
duan et al 2003 | PERSON | 4 |
cfu | ORG | 4 |
cv777 | TAXON | 4 |
chin | PERSON | 4 |
cho | CHEMICAL | 4 |
chowdry | ORG | 4 |
culicoides | TAXON | 4 |
daejeon korea | PERSON | 4 |
deltacoronavirus | GPE | 4 |
di | CHEMICAL | 4 |
rbd | DISEASE | 4 |
orf1ab | ORG | 4 |
singapore | GPE | 4 |
ethidium bromide | CHEMICAL | 4 |
flocks | TAXON | 4 |
haematoxylin | GPE | 4 |
herds | TAXON | 4 |
humidity | DISEASE | 4 |
iron | CHEMICAL | 4 |
kobuviruses | TAXON | 4 |
organisms | TAXON | 4 |
panda | TAXON | 4 |
peribronchial lymphocytic cuffings | DISEASE | 4 |
pestivirus | TAXON | 4 |
pet dog | TAXON | 4 |
pheasants | TAXON | 4 |
porcine respiratory coronavirus prcv | TAXON | 4 |
septicaemia | DISEASE | 4 |
sheep | TAXON | 4 |
the united states clinical | GPE | 4 |
van doremalen et al 2020 | PERSON | 4 |
virus genetic | TAXON | 4 |
vulnificus | TAXON | 4 |
watery diarrhea vomiting dehydration | DISEASE | 4 |
song | PERSON | 4 |
europe | LOC | 4 |
viral sequences | TAXON | 4 |
diarrhea virus infection | DISEASE | 4 |
world health organization | ORG | 4 |
south | LOC | 4 |
dehydration | DISEASE | 4 |
southern china | LOC | 4 |
t41 | ORG | 4 |
table 1 | LOC | 4 |
taq | TAXON | 4 |
thailand | GPE | 4 |
vergara alert van den | PERSON | 4 |
veterinary clinics | ORG | 4 |
t34 | ORG | 4 |
xiao | GPE | 4 |
canine kobuvirus | TAXON | 4 |
al 2015 | PERSON | 4 |
canine parvovirus type 2 | TAXON | 4 |
copper | CHEMICAL | 4 |
cat | TAXON | 4 |
canine distemper virus cdv | TAXON | 4 |
bacterium | TAXON | 4 |
avian influenza | PERSON | 4 |
caves | TAXON | 4 |
mn | ORG | 3 |
lamp | ORG | 3 |
mf370205 bat | PERSON | 3 |
mf167434 | CHEMICAL | 3 |
mers cov ppnt | ORG | 3 |
mers cov infections | DISEASE | 3 |
lee 2015 lee | PERSON | 3 |
lara romero | PERSON | 3 |
kf452323 | CHEMICAL | 3 |
kim | PERSON | 3 |
kanagawa | PERSON | 3 |
kfksv | PERSON | 3 |
jiang et al | PERSON | 3 |
influenza d | PERSON | 3 |
ignjatovic | PERSON | 3 |
irta | ORG | 3 |
mathematical | ORG | 3 |
imi | ORG | 3 |
mammalian | TAXON | 3 |
opriessnig | ORG | 3 |
middle east respiratory syndrome | LOC | 3 |
myotis | TAXON | 3 |
histophilus | ORG | 3 |
qiagen | ORG | 3 |
pyankov | PERSON | 3 |
purpari lorusso | PERSON | 3 |
poonsuk | PERSON | 3 |
pensaert de bouck | PERSON | 3 |
pakistan | GPE | 3 |
pdcov infections | CHEMICAL | 3 |
pdb | ORG | 3 |
p4 | CHEMICAL | 3 |
ows | TAXON | 3 |
nucleotide | ORG | 3 |
nucleic | ORG | 3 |
nipah disease | DISEASE | 3 |
nidovirales | GPE | 3 |
nsw australia | ORG | 3 |
nc028752 | CHEMICAL | 3 |
idte | ORG | 3 |
c12 | GPE | 3 |
heterogeneity | ORG | 3 |
caswell archambault | PERSON | 3 |
bürgi | PERSON | 3 |
bovine viral | TAXON | 3 |
betacoronavirus gammacoronavirus | PERSON | 3 |
bats | TAXON | 3 |
bat covs | ORG | 3 |
bat cov sc2013 | PERSON | 3 |
bat cov b15 | PERSON | 3 |
bdv | TAXON | 3 |
bcov | CHEMICAL | 3 |
ascaris suum | TAXON | 3 |
analysis | GPE | 3 |
aic | ORG | 3 |
ahs | ORG | 3 |
ahl | CHEMICAL | 3 |
abi | ORG | 3 |
46 bat | PERSON | 3 |
respiratory syndrome | DISEASE | 3 |
camel | GPE | 3 |
changhee | DISEASE | 3 |
hansen | PERSON | 3 |
chen | PERSON | 3 |
hvr | ORG | 3 |
h1n1 | GPE | 3 |
group a | ORG | 3 |
gotaq g2 dna polymerase promega italia | ORG | 3 |
genomic | ORG | 3 |
g2b strains | PERSON | 3 |
faecal | ORG | 3 |
fabricius | ORG | 3 |
fam | CHEMICAL | 3 |
escherichia | PERSON | 3 |
epidemic | DISEASE | 3 |
england | GPE | 3 |
e2 | CHEMICAL | 3 |
dulbecco s | LOC | 3 |
cryo em | ORG | 3 |
coronavirus disease | DISEASE | 3 |
chicken | TAXON | 3 |
roc | GPE | 3 |
viral infection | DISEASE | 3 |
respiratory diseases | DISEASE | 3 |
respiratory diseases | DISEASE | 3 |
primary disease pathogen | DISEASE | 3 |
poult enteritis | DISEASE | 3 |
porcine kobuvirus | TAXON | 3 |
porcine enteric coronavirus | TAXON | 3 |
plaque | DISEASE | 3 |
piglets piglets | TAXON | 3 |
piglet | TAXON | 3 |
parvoviruses | TAXON | 3 |
nodes | CHEMICAL | 3 |
na | CHEMICAL | 3 |
mouth disease | DISEASE | 3 |
microarray assay | PERSON | 3 |
man | TAXON | 3 |
mallard | TAXON | 3 |
italy | GPE | 3 |
interstitial pneumonia | DISEASE | 3 |
infectious bronchitis coronavirus | DISEASE | 3 |
rabbits | TAXON | 3 |
respiratory syndrome coronavirus infection | DISEASE | 3 |
horseradish | TAXON | 3 |
sialic acid | CHEMICAL | 3 |
results | PERSON | 3 |
zoonotic diseases | DISEASE | 3 |
www ncbi nlm nih | PERSON | 3 |
watery diarrhea | DISEASE | 3 |
virus infection | DISEASE | 3 |
viral gene | TAXON | 3 |
viral disease | DISEASE | 3 |
viral diarrhoea | DISEASE | 3 |
transmissible gastroenteritis virus tgev | TAXON | 3 |
transboundary movements | DISEASE | 3 |
the southern hemisphere | LOC | 3 |
the harbin veterinary research institute | ORG | 3 |
the center of portugal | ORG | 3 |
swine virus | TAXON | 3 |
swine herd | TAXON | 3 |
swine enteric coronavirus | TAXON | 3 |
somni | TAXON | 3 |
human infections | DISEASE | 3 |
trypsin | CHEMICAL | 3 |
gentamicin | CHEMICAL | 3 |
stärk | PERSON | 3 |
vibrio vulnificus | TAXON | 3 |
vazyme biotech | PERSON | 3 |
vtm | ORG | 3 |
united states rapid | ORG | 3 |
thompson gibson plewniak | ORG | 3 |
tm | ORG | 3 |
t27 | CHEMICAL | 3 |
sizun | ORG | 3 |
zhai | GPE | 3 |
shereen | PERSON | 3 |
shang | PERSON | 3 |
salmonella enterica | PERSON | 3 |
sx | CHEMICAL | 3 |
snp | ORG | 3 |
s n | ORG | 3 |
rodríguez | GPE | 3 |
vibrio vulnificus infection | DISEASE | 3 |
tortorelli | ORG | 3 |
zhou et al 2018 | PERSON | 3 |
coronavirus covid | DISEASE | 3 |
ferrumequinum | TAXON | 3 |
feces | TAXON | 3 |
enteropathy | DISEASE | 3 |
enteritis | DISEASE | 3 |
al 2009 | PERSON | 3 |
endemic outbreaks | TAXON | 3 |
dry | DISEASE | 3 |
coronavirus porcine | TAXON | 3 |
enteric viruses | TAXON | 3 |
al 2012 | PERSON | 3 |
bovine respiratory syncytial virus | TAXON | 3 |
cave | TAXON | 3 |
animal covs | TAXON | 3 |
avian paramyxoviruses | TAXON | 3 |
formalin | GPE | 3 |
camel | TAXON | 3 |
canine coronavirus | TAXON | 3 |
mafft | PERSON | 2 |
lee | ORG | 2 |
le | GPE | 2 |
lee 2015 | PERSON | 2 |
lee park kim lee | PERSON | 2 |
lei kusov | PERSON | 2 |
lessons | PERSON | 2 |
lin chen 2017 | PERSON | 2 |
lin saif marthaler wang | PERSON | 2 |
lindholm denmark | PERSON | 2 |
logistic regression | PERSON | 2 |
loop | PERSON | 2 |
m41 italy | DISEASE | 2 |
lb | GPE | 2 |
manitoba | GPE | 2 |
mega | ORG | 2 |
mega x molecular | ORG | 2 |
mers cov s1 elisa | ORG | 2 |
mf370205 | CHEMICAL | 2 |
mf510157 | ORG | 2 |
mg rast | ORG | 2 |
mgb | ORG | 2 |
mhv a59 | TAXON | 2 |
moss | GPE | 2 |
ma et al 2015 | PERSON | 2 |
magmax | ORG | 2 |
mainland china | LOC | 2 |
malaysia | GPE | 2 |
l76 a s92 | PERSON | 2 |
mannheim germany | GPE | 2 |
la | GPE | 2 |
italy infection | DISEASE | 2 |
l e | CHEMICAL | 2 |
italy introduction | ORG | 2 |
mannheimia haemolytica | DISEASE | 2 |
hubei province | GPE | 2 |
human coronavirus | TAXON | 2 |
human norovirus | TAXON | 2 |
ib | ORG | 2 |
ictv | ORG | 2 |
ifn | ORG | 2 |
irr | ORG | 2 |
igm | ORG | 2 |
interstitial | ORG | 2 |
iowa state university | ORG | 2 |
italy 7239 | DISEASE | 2 |
italy cavanagh 2001 | ORG | 2 |
italy decaro desario | PERSON | 2 |
j48 | ORG | 2 |
koslov | PERSON | 2 |
janosi | ORG | 2 |
jeju | PERSON | 2 |
kc881005 | CHEMICAL | 2 |
kf272920 | CHEMICAL | 2 |
kf367457 | CHEMICAL | 2 |
km189367 | ORG | 2 |
kr131621 | CHEMICAL | 2 |
ku528584 ku528594 | PERSON | 2 |
ky073747 | CHEMICAL | 2 |
kerin hull mccaustland | PERSON | 2 |
kermack | PERSON | 2 |
kimura | PERSON | 2 |
kin | PERSON | 2 |
koch | PERSON | 2 |
mannheimia | ORG | 2 |
on canada | ORG | 2 |
martella | CHEMICAL | 2 |
phev | PERSON | 2 |
northwest china | LOC | 2 |
noten horzinek | PERSON | 2 |
nucleospin | ORG | 2 |
numbers | ORG | 2 |
hermeyer | PERSON | 2 |
ontindex | ORG | 2 |
opriessnig 2016 | ORG | 2 |
orthocoronavirinae | ORG | 2 |
oxoid uk | ORG | 2 |
pca | ORG | 2 |
pcv 2 | ORG | 2 |
pdr | DISEASE | 2 |
peds | ORG | 2 |
pei | ORG | 2 |
pi | ORG | 2 |
marthaler raymond et al 2014 | PERSON | 2 |
prnt | ORG | 2 |
pan et al | PERSON | 2 |
pangolins | CHEMICAL | 2 |
paramyxoviridae | TAXON | 2 |
park | PERSON | 2 |
paton | GPE | 2 |
paweska | GPE | 2 |
pensaert | CHEMICAL | 2 |
phacochoerus | ORG | 2 |
piglets | ORG | 2 |
pongpirul | GPE | 2 |
porcine deltacoronavirus | PERSON | 2 |
positive | ORG | 2 |
poumarat | GPE | 2 |
north east china | LOC | 2 |
norovirus | TAXON | 2 |
nonidet | ORG | 2 |
nicholas ayling 2003 | PERSON | 2 |
martin murrell golden khoosal | PERSON | 2 |
measles | PERSON | 2 |
megalign | ORG | 2 |
menachery | CHEMICAL | 2 |
mendoza elvira | PERSON | 2 |
miniopterus schreibersii | TAXON | 2 |
mira dowgier | PERSON | 2 |
mira purpari lorusso et al 2018 | PERSON | 2 |
morocco | TAXON | 2 |
murine | TAXON | 2 |
murrin | TAXON | 2 |
mycoplasma bovis | TAXON | 2 |
nc001846 | CHEMICAL | 2 |
nc001846 murine | ORG | 2 |
nc007732 | CHEMICAL | 2 |
nc010437 | CHEMICAL | 2 |
nc016990 | CHEMICAL | 2 |
nc019843 bat sars coronavirus | PERSON | 2 |
ncfad 2014 | CHEMICAL | 2 |
nh p10 | ORG | 2 |
np | ORG | 2 |
ns1 60v | PERSON | 2 |
nsw government | ORG | 2 |
na | CHEMICAL | 2 |
nacl alkaline peptone | CHEMICAL | 2 |
necrohemorrhagic | ORG | 2 |
negative | ORG | 2 |
new south wales | GPE | 2 |
new york | GPE | 2 |
hohdatsu | GPE | 2 |
exp 2 | GPE | 2 |
hendra | PERSON | 2 |
ccov | TAXON | 2 |
bat | PERSON | 2 |
bat cov b15 1 6 | ORG | 2 |
bat cov b15 21 | ORG | 2 |
bat sars coronavirus hku3 1 | TAXON | 2 |
battilani | PERSON | 2 |
bensaid | CHEMICAL | 2 |
bioedit | ORG | 2 |
bochkov | PERSON | 2 |
boniotti | GPE | 2 |
breiman 2001 | ORG | 2 |
bridgen | CHEMICAL | 2 |
bungowannah | GPE | 2 |
caggaaacagctatgaccatgacatcatgtgcggtgccattaac | ORG | 2 |
caggaaacagctatgaccatgacgtcttgtgcggtaccattaac | ORG | 2 |
cfia | ORG | 2 |
henan province | GPE | 2 |
crov freeman | PERSON | 2 |
cai | PERSON | 2 |
callison | PERSON | 2 |
candidatus | ORG | 2 |
canine parvovirus | TAXON | 2 |
cardoen | GPE | 2 |
casanova | ORG | 2 |
cats | TAXON | 2 |
central veterinary institute | ORG | 2 |
chan | PERSON | 2 |
chang | PERSON | 2 |
chen gauger et | PERSON | 2 |
chen liu lang | PERSON | 2 |
chen zhu et al | PERSON | 2 |
bande et al | PERSON | 2 |
bhib | ORG | 2 |
bd phoenix | ORG | 2 |
bcov s genes | CHEMICAL | 2 |
pretto et al 2001 | PERSON | 2 |
20573 | DISEASE | 2 |
229e | PERSON | 2 |
3jhka8wl | CHEMICAL | 2 |
4 amino acid | CHEMICAL | 2 |
ac000192 middle east | LOC | 2 |
af116 | CHEMICAL | 2 |
af139 | CHEMICAL | 2 |
ahl guelph | ORG | 2 |
apc | ORG | 2 |
apmv | ORG | 2 |
asfv | TAXON | 2 |
atp | ORG | 2 |
ay184287 | ORG | 2 |
adney | CHEMICAL | 2 |
aichivirus a | CHEMICAL | 2 |
al qassem | ORG | 2 |
alagoas | GPE | 2 |
altschul | ORG | 2 |
americas | LOC | 2 |
aphb | ORG | 2 |
arctic | LOC | 2 |
argentina | GPE | 2 |
austin tx usa | PERSON | 2 |
avian | TAXON | 2 |
avian infectious bronchitis | DISEASE | 2 |
b15 21 | ORG | 2 |
bbc | ORG | 2 |
bcov n | GPE | 2 |
chiang wu chiou chang lin | PERSON | 2 |
chikungunya | GPE | 2 |
china identification | ORG | 2 |
flake | ORG | 2 |
fujian | GPE | 2 |
g maxie | ORG | 2 |
g3 p11 p15 | ORG | 2 |
gam | PERSON | 2 |
gc | ORG | 2 |
gtaaaacgacggccagtggtctactactaccaaagtgc | ORG | 2 |
gagea et al 2006 | PERSON | 2 |
genbank | ORG | 2 |
genereach usa | ORG | 2 |
gong | PERSON | 2 |
gostin | PERSON | 2 |
gough | GPE | 2 |
great britain | GPE | 2 |
grecco | PERSON | 2 |
gyeongbuk province | GPE | 2 |
hcov 229e | DISEASE | 2 |
he | CHEMICAL | 2 |
hepes | CHEMICAL | 2 |
hallim | ORG | 2 |
han94 | DISEASE | 2 |
hanke | PERSON | 2 |
harapan | GPE | 2 |
harper 1961 | PERSON | 2 |
hasegawa | GPE | 2 |
havelaar | LOC | 2 |
hen 2 china | ORG | 2 |
heilongjiang province | GPE | 2 |
heilongjiang province | GPE | 2 |
henan | GPE | 2 |
flaviviridae wengler | ORG | 2 |
ferreira | ORG | 2 |
china korea | GPE | 2 |
feline | TAXON | 2 |
choi | PERSON | 2 |
chu et al 2014 | PERSON | 2 |
cima | GPE | 2 |
clustal omega | ORG | 2 |
clustal w | ORG | 2 |
colour | ORG | 2 |
confluent vero | PERSON | 2 |
cox | PERSON | 2 |
dnastar | GPE | 2 |
dq022305 | CHEMICAL | 2 |
de wit 2000 | PERSON | 2 |
decaro campolo et al 2007 | ORG | 2 |
dehydration | PERSON | 2 |
deregt | ORG | 2 |
desario billi | PERSON | 2 |
diagnosis | GPE | 2 |
diarrhea | PERSON | 2 |
diarrhoea | GPE | 2 |
driemeier et al | PERSON | 2 |
ef446615 | ORG | 2 |
ema | ORG | 2 |
evfekvhvq | ORG | 2 |
earth | LOC | 2 |
ebola virus | TAXON | 2 |
electron | ORG | 2 |
fi | GPE | 2 |
fj376620 | CHEMICAL | 2 |
fagbohun omobowale 2018 | ORG | 2 |
fang li | PERSON | 2 |
pretto et al | PERSON | 2 |
li knyaz | PERSON | 2 |
prince edward island | GPE | 2 |
house | TAXON | 2 |
gaps | CHEMICAL | 2 |
gastroenteritis virus infection | DISEASE | 2 |
gel electrophoresis | PERSON | 2 |
gentamycin | CHEMICAL | 2 |
glutamine | CHEMICAL | 2 |
goats | TAXON | 2 |
guinea | GPE | 2 |
guinea pig | TAXON | 2 |
halophilic marine bacterium | TAXON | 2 |
hepatitis | DISEASE | 2 |
hepatitis virus jhm | DISEASE | 2 |
hepatitis virus strain jhm | DISEASE | 2 |
hepatitis virus strain mhv | DISEASE | 2 |
horses | TAXON | 2 |
human animal | TAXON | 2 |
ferrets | TAXON | 2 |
human bat | TAXON | 2 |
human beings | TAXON | 2 |
human body | TAXON | 2 |
human coronavirus 229e | TAXON | 2 |
human coronaviruses | TAXON | 2 |
human immunodeficiency virus type 1 | DISEASE | 2 |
human viruses | TAXON | 2 |
humans animals | TAXON | 2 |
hyperplasia | DISEASE | 2 |
inflammation | DISEASE | 2 |
isoflurane | CHEMICAL | 2 |
kobuvirus rna | TAXON | 2 |
lethargy | DISEASE | 2 |
levofloxacin tetracycline piperacillin | CHEMICAL | 2 |
flaccid | DISEASE | 2 |
ferret coronaviruses | TAXON | 2 |
circoviruses | TAXON | 2 |
diarrhoeic | TAXON | 2 |
conflict | DISEASE | 2 |
coronavirus wiv1 | TAXON | 2 |
coronavirus infection | DISEASE | 2 |
coronavirus infections | DISEASE | 2 |
coronavirus infectious bronchitis | DISEASE | 2 |
deduced amino acid | CHEMICAL | 2 |
dengue | DISEASE | 2 |
depressed | DISEASE | 2 |
dermatitis nephropathy syndrome | DISEASE | 2 |
diarrheal | DISEASE | 2 |
diarrheal disease | DISEASE | 2 |
diarrhoea syndrome | DISEASE | 2 |
diarrhoea vomiting | DISEASE | 2 |
diarrhoeal | DISEASE | 2 |
diarrhoeic animals | TAXON | 2 |
feline coronavirus type i and canine coronavirus | TAXON | 2 |
domestic duck | TAXON | 2 |
dromedary | TAXON | 2 |
dromedary camel coronavirus | TAXON | 2 |
dry milk | DISEASE | 2 |
dysentery | DISEASE | 2 |
embryonated | TAXON | 2 |
embryonated fowls eggs | TAXON | 2 |
emerg | PERSON | 2 |
enteric and respiratory diseases | DISEASE | 2 |
enteric coronavirus | TAXON | 2 |
equine coronavirus | PERSON | 2 |
ethanol | CHEMICAL | 2 |
fed | ORG | 2 |
feline coronavirus | TAXON | 2 |
m8miwtha | CHEMICAL | 2 |
mammalian viral sequences | TAXON | 2 |
mammalian viruses | TAXON | 2 |
van nieuwstadt | PERSON | 2 |
supermix | CHEMICAL | 2 |
swine fever | DISEASE | 2 |
template | CHEMICAL | 2 |
the institute of zoology chinese academy of sciences | ORG | 2 |
the institutional animal care and use committee | ORG | 2 |
the international committee on taxonomy of viruses | ORG | 2 |
the national centre for foreign animal disease ncfad | ORG | 2 |
the northern hemisphere | LOC | 2 |
the sars cov | ORG | 2 |
the united states europe | GPE | 2 |
the united states experimental | GPE | 2 |
thrombosis | DISEASE | 2 |
toxigenic | TAXON | 2 |
tracheitis | DISEASE | 2 |
villous atrophy | DISEASE | 2 |
marine animals | TAXON | 2 |
viral nucleocapsids | TAXON | 2 |
virus disease | DISEASE | 2 |
virus genome | TAXON | 2 |
virus genotypes | TAXON | 2 |
virus isolates | TAXON | 2 |
virus porcine | TAXON | 2 |
virus porcine circovirus type 2 | TAXON | 2 |
virus type 1 genomes | TAXON | 2 |
weight loss | DISEASE | 2 |
wolves | TAXON | 2 |
www cbs dtu | ORG | 2 |
zoonotic coronavirus | TAXON | 2 |
protean | ORG | 2 |
zoos | TAXON | 2 |
strand | GPE | 2 |
septicemia | DISEASE | 2 |
roundworm | TAXON | 2 |
rhesus | TAXON | 2 |
marine mammal | TAXON | 2 |
marten weasel red pandas | TAXON | 2 |
milk | DISEASE | 2 |
ml | PERSON | 2 |
mouse coronavirus | TAXON | 2 |
mtfrbn87 | DISEASE | 2 |
natural bat habitats | TAXON | 2 |
necrosis | DISEASE | 2 |
newcastle disease | DISEASE | 2 |
nystatin | CHEMICAL | 2 |
organism | TAXON | 2 |
oysters | TAXON | 2 |
pandemic diseases | DISEASE | 2 |
parvovirus | TAXON | 2 |
pathogen | ORG | 2 |
pet dogs | TAXON | 2 |
pheasant coronavirus | TAXON | 2 |
pig virus | TAXON | 2 |
piglet diarrhea | DISEASE | 2 |
piglets porcine deltacoronavirus | TAXON | 2 |
porcine respiratory disease complex | TAXON | 2 |
porcine respiratory viruses | TAXON | 2 |
pulmonary mycoplasmosis | DISEASE | 2 |
respiratory disease brd | DISEASE | 2 |
respiratory distress | DISEASE | 2 |
respiratory syndrome mers coronavirus | DISEASE | 2 |
respiratory syndrome coronavirus 2 sars | DISEASE | 2 |
respiratory syndrome coronavirus nc019843 | DISEASE | 2 |
respiratory syndrome virus prrsv | DISEASE | 2 |
civet porcupine | TAXON | 2 |
pyrimidine | CHEMICAL | 2 |
circovirus type | TAXON | 2 |
supporting information | ORG | 2 |
sialic | ORG | 2 |
sialic acid | CHEMICAL | 2 |
sicily italy | LOC | 2 |
south africa | GPE | 2 |
south america | LOC | 2 |
south america grecco | LOC | 2 |
south korea genetic | ORG | 2 |
southern brazil | LOC | 2 |
spike | ORG | 2 |
states parties | ORG | 2 |
stoffel | PERSON | 2 |
streptococcus | GPE | 2 |
strom paranjpye 2000 | PERSON | 2 |
sunnyvale ca usa | ORG | 2 |
swine fever | DISEASE | 2 |
tosepu | PERSON | 2 |
t13 t21 | PERSON | 2 |
t27 t34 | CHEMICAL | 2 |
t92 | ORG | 2 |
ta b l | PERSON | 2 |
taa | ORG | 2 |
tac | GPE | 2 |
tas | ORG | 2 |
tcovs | CHEMICAL | 2 |
takara bio inc | PERSON | 2 |
takara kusatsu | PERSON | 2 |
taq dna | TAXON | 2 |
taqman | ORG | 2 |
thachil gerber | PERSON | 2 |
tobler 2001 | DISEASE | 2 |
shutting everything down | DISEASE | 2 |
shittu joannis odaibo | ORG | 2 |
sheng | PERSON | 2 |
shanxi | GPE | 2 |
qx | GPE | 2 |
chronic diseases | DISEASE | 2 |
qiaxcel | ORG | 2 |
qi | DISEASE | 2 |
qiagen france | PERSON | 2 |
rdrp | ORG | 2 |
rpv | ORG | 2 |
rabbit | TAXON | 2 |
rabenau | ORG | 2 |
random forest | ORG | 2 |
reed muench | PERSON | 2 |
respiratory syndrome mers | DISEASE | 2 |
rhinolophus bat coronavirus | TAXON | 2 |
rio grande | PERSON | 2 |
riyadh ry141 | ORG | 2 |
rodrigues whitney lang | PERSON | 2 |
rousettus aegyptiacus | TAXON | 2 |
russia | GPE | 2 |
s e choleraesuis | PERSON | 2 |
sc2013 | CHEMICAL | 2 |
sc2481 | CHEMICAL | 2 |
smg | ORG | 2 |
sybr green | ORG | 2 |
sagong lee | PERSON | 2 |
saif barnes | PERSON | 2 |
san diego ca | GPE | 2 |
score 2 low | ORG | 2 |
sera | PERSON | 2 |
shahwan | GPE | 2 |
torok | GPE | 2 |
sc4353 | ORG | 2 |
transboundary | GPE | 2 |
canine adenovirus | TAXON | 2 |
acute respiratory syndrome coronavirus 2 sars cov | DISEASE | 2 |
africanus | TAXON | 2 |
al 2006 | LOC | 2 |
al 2017 | PERSON | 2 |
al 2020 | PERSON | 2 |
amino acid identity | CHEMICAL | 2 |
animal coronaviruses | TAXON | 2 |
avian disease | DISEASE | 2 |
avian paramyxovirus serotype | TAXON | 2 |
azithromycin | CHEMICAL | 2 |
bacterial infections | DISEASE | 2 |
bovines | TAXON | 2 |
calves mycoplasma | TAXON | 2 |
camel coronavirus uae | ORG | 2 |
canine coronavirus rna | TAXON | 2 |
acrylamide | CHEMICAL | 2 |
canine distemper virus | TAXON | 2 |
canine distemper virus cdv canine adenovirus | TAXON | 2 |
canine parvovirus 2 | TAXON | 2 |
canine parvovirus sequences | TAXON | 2 |
canine parvovirus type 2 variants | TAXON | 2 |
canine parvovirus type 2a | TAXON | 2 |
canine viruses | TAXON | 2 |
carnivore | TAXON | 2 |
carnivore parvovirus | TAXON | 2 |
cattle pigs | TAXON | 2 |
cattle sheep goats swine | TAXON | 2 |
transmission kinetics | ORG | 2 |
chikungunya | DISEASE | 2 |
china | GPE | 2 |
acute respiratory diseases | DISEASE | 2 |
chicken meat | TAXON | 2 |
acids | CHEMICAL | 2 |
uva | ORG | 2 |
viral dna rna | TAXON | 2 |
vienna austria | PERSON | 2 |
vergara alert | PERSON | 2 |
valastro | PERSON | 2 |
vp2 | ORG | 2 |
vp | ORG | 2 |
utr | ORG | 2 |
wagner miller | PERSON | 2 |
usb | ORG | 2 |
univ | ORG | 2 |
tsai | PERSON | 2 |
zoonotic diseases | PERSON | 2 |
tucciarone | CHEMICAL | 2 |
turkey coronavirus | PERSON | 2 |
viremia | LOC | 2 |
vnt | ORG | 2 |
wang et al 2014 | PERSON | 2 |
yankuo | CHEMICAL | 2 |
yano hky | PERSON | 2 |
ward michael | PERSON | 2 |
zetstra 1991 | PERSON | 2 |
zhang schwartz | PERSON | 2 |
xiaoli x | PERSON | 2 |
wu | PERSON | 2 |
world organisation for animal health | ORG | 2 |
wolicki | PERSON | 2 |
western europe | LOC | 2 |
yi tong | PERSON | 2 |
larsen pomeroy | PERSON | 1 |
laos pdcov | GPE | 1 |
langel paim lager vlasova saif | PERSON | 1 |
lai shih | PERSON | 1 |
latvia lithuania | ORG | 1 |
landman | PERSON | 1 |
lamarre talbot | ORG | 1 |
lai et al 2005 | PERSON | 1 |
lafia | GPE | 1 |
lai perlman anderson | PERSON | 1 |
lai cavanagh | PERSON | 1 |
lactogenic | ORG | 1 |
laconi et al | PERSON | 1 |
laborde et al 2020 | PERSON | 1 |
laborde | CHEMICAL | 1 |
lna | ORG | 1 |
lps | ORG | 1 |
lawrence 2002 | PERSON | 1 |
laboratories | PERSON | 1 |
laude 1981 | PERSON | 1 |
lee sunhee lee dong | PERSON | 1 |
lee 1992 | PERSON | 1 |
lee 2014 | PERSON | 1 |
li 2020 | PERSON | 1 |
leydig | GPE | 1 |
leung | PERSON | 1 |
letunic bork | PERSON | 1 |
lelystad netherlands | GPE | 1 |
lelie | CHEMICAL | 1 |
leica dm il | ORG | 1 |
leica | GPE | 1 |
legionnaires disease | DISEASE | 1 |
lee et al 2015 | PERSON | 1 |
lm645057 | CHEMICAL | 1 |
lee sunhee lee changhee | PERSON | 1 |
lee seung chul | PERSON | 1 |
lee s lee c genomic | ORG | 1 |
lee park | PERSON | 1 |
lee lee 2014 | PERSON | 1 |
lee kim lee 2015 | PERSON | 1 |
lee j | PERSON | 1 |
lee choi | PERSON | 1 |
lee changhee | PERSON | 1 |
lee 2015 lin | PERSON | 1 |
lm645058 | CHEMICAL | 1 |
korea proactively | ORG | 1 |
llc pk | ORG | 1 |
kim king suarez wong afonso | PERSON | 1 |
kluyvera | GPE | 1 |
kleczkowski | PERSON | 1 |
kissler tedijanto goldstein | PERSON | 1 |
kirkland et al 2007 | PERSON | 1 |
kipar et al 2010 | PERSON | 1 |
kingham | PERSON | 1 |
kingfisher | ORG | 1 |
kim et al 2007 | PERSON | 1 |
kim lee | PERSON | 1 |
kim hwang kim choi | PERSON | 1 |
koenen frank de clercq | PERSON | 1 |
kim h k | PERSON | 1 |
kienzle abraham hogue brian | PERSON | 1 |
khodakaram tafti lópez 2004 | PERSON | 1 |
ken lemon | PERSON | 1 |
kegong tian | PERSON | 1 |
keevil | CHEMICAL | 1 |
li li | CHEMICAL | 1 |
kedah | GPE | 1 |
keeling | GPE | 1 |
ko tang hsueh | PERSON | 1 |
kolakofsky roux | PERSON | 1 |
llc | CHEMICAL | 1 |
ku x chen | PERSON | 1 |
ll28 2008 rna | ORG | 1 |
ll28 2008 | ORG | 1 |
lfa | ORG | 1 |
lbm | ORG | 1 |
l 1449t 04 2 s1fs31 oropharyngeal | CHEMICAL | 1 |
kühnert wu drummond | PERSON | 1 |
kweon | PERSON | 1 |
kuzyakin | ORG | 1 |
kumasi | GPE | 1 |
krishnan et al | PERSON | 1 |
kondofersky | PERSON | 1 |
krishnan | PERSON | 1 |
korea outbreak | ORG | 1 |
korea nsp3 | ORG | 1 |
korea national institute of biological resources press bats | ORG | 1 |
korea isolation | ORG | 1 |
korea group h | ORG | 1 |
korea coronaviridae lactogenic | ORG | 1 |
kooijman mapes pusterla | PERSON | 1 |
kong dechuan wang | PERSON | 1 |
li d | CHEMICAL | 1 |
mers cov ecov | ORG | 1 |
li li yan chen | PERSON | 1 |
memh | ORG | 1 |
mers cov middle east | ORG | 1 |
mers cov mn | ORG | 1 |
mers cov isolation | ORG | 1 |
mers cov hemida et al 2014 | ORG | 1 |
mers cov guy et al 2000 | ORG | 1 |
mers cov gardner et al 2019 | PERSON | 1 |
mers cov emc | ORG | 1 |
mers cov chan et al 2015 | ORG | 1 |
mers cov animal | ORG | 1 |
mega x | PERSON | 1 |
mers cov spike | ORG | 1 |
mcov mhv | PERSON | 1 |
mafri | ORG | 1 |
m45 methods | ORG | 1 |
m41 | ORG | 1 |
m abad f x | PERSON | 1 |
m | ORG | 1 |
lytle | PERSON | 1 |
lyssavirus genus comparative | ORG | 1 |
lyon france iarc | ORG | 1 |
mers cov sabir | ORG | 1 |
mers cov woo et al 2007 | ORG | 1 |
luxembourg | GPE | 1 |
mk095177 | CHEMICAL | 1 |
ms | ORG | 1 |
katoh | PERSON | 1 |
mos | ORG | 1 |
moh pandemic readiness and response plan | ORG | 1 |
mn635798 | CHEMICAL | 1 |
mn055627 mn055628 | CHEMICAL | 1 |
mk895483 | CHEMICAL | 1 |
mk802679 | CHEMICAL | 1 |
mk095178 | CHEMICAL | 1 |
mid | ORG | 1 |
mers cov infected | DISEASE | 1 |
mh810151 mh810162 | CHEMICAL | 1 |
mh043955 | CHEMICAL | 1 |
mh043952 | CHEMICAL | 1 |
mfold | ORG | 1 |
mf094684 | CHEMICAL | 1 |
mers coronavirus infection | DISEASE | 1 |
mers covs | ORG | 1 |
mers covlike bat covs bat cov | ORG | 1 |
mers cov upe | ORG | 1 |
luytjes | PERSON | 1 |
luxr | GPE | 1 |
li meng zhao lin ma | PERSON | 1 |
lievaart peterson et al | PERSON | 1 |
liu helmersson sewe | PERSON | 1 |
liu | PERSON | 1 |
litopenaeus vannamei detection of salmonella | ORG | 1 |
litopenaeus vannamei | TAXON | 1 |
lisowska tomczyk | PERSON | 1 |
lisbon | GPE | 1 |
lipman 1990 basic | ORG | 1 |
lin chen | PERSON | 1 |
lima villa el salvador | GPE | 1 |
lierz et al | PERSON | 1 |
liu zhu liao xu zhou | PERSON | 1 |
libya analyzing the epidemiological outbreak | ORG | 1 |
liaoning five | LOC | 1 |
liaoning shenyang | PERSON | 1 |
liaoning province | GPE | 1 |
liaoning | GPE | 1 |
li et al 2020 | PERSON | 1 |
li et al 2018 | GPE | 1 |
li et al 2012 | PERSON | 1 |
li et al 2005 | PERSON | 1 |
liu liao chang chou lin | PERSON | 1 |
location | PERSON | 1 |
lutgehetmann | DISEASE | 1 |
lu shi | PERSON | 1 |
luoyang putai biotechnology co ltd | ORG | 1 |
luoyang heluo | ORG | 1 |
luo weiss | PERSON | 1 |
luo jing | PERSON | 1 |
lung et al 2012 | PERSON | 1 |
lung et al 2011 | ORG | 1 |
lung | PERSON | 1 |
lucas | GPE | 1 |
luan et al | PERSON | 1 |
lu lu | PERSON | 1 |
logistic | PERSON | 1 |
lu jianzhou zhao | PERSON | 1 |
lu gang zhang | PERSON | 1 |
lu | PERSON | 1 |
lowings | ORG | 1 |
lowen | PERSON | 1 |
lowe | DISEASE | 1 |
loughborough leicestershire | PERSON | 1 |
lorenzetti alfieri lisbôa | PERSON | 1 |
lomonaco | GPE | 1 |
kazakhstan | GPE | 1 |
ibuprofen | CHEMICAL | 1 |
kath webster | PERSON | 1 |
kath | CHEMICAL | 1 |
ind 1 | PERSON | 1 |
immunoperoxidase | ORG | 1 |
immune | LOC | 1 |
illustra gfx pcr | PERSON | 1 |
illinois | GPE | 1 |
ile | ORG | 1 |
ihr 2005 | PERSON | 1 |
igg siga | ORG | 1 |
iceland review | ORG | 1 |
ma https orcid org 0000 0001 6285 | CHEMICAL | 1 |
ib n | LOC | 1 |
il 6 | ORG | 1 |
ihc brasil | ORG | 1 |
idcases | ORG | 1 |
ibv ndv | ORG | 1 |
ibv massachusetts | ORG | 1 |
ibv aiv ndv | ORG | 1 |
hydroxychloroquine | CHEMICAL | 1 |
hyclone | CHEMICAL | 1 |
hurst ye | PERSON | 1 |
hungary immunogenicity | ORG | 1 |
indiana | GPE | 1 |
indiana kf452323 | GPE | 1 |
indonesia | GPE | 1 |
interactions | ORG | 1 |
iqbal | PERSON | 1 |
iowa the journal of infectious | ORG | 1 |
iowa | GPE | 1 |
ion torrent thermo fisher scientific | ORG | 1 |
invitrogen paisley renfrewshire uk | PERSON | 1 |
invitrogen | ORG | 1 |
intraspecies | ORG | 1 |
intragenogroup | PERSON | 1 |
interstitial pneumonia | DISEASE | 1 |
institutional animal care and use committee | ORG | 1 |
infection identification | ORG | 1 |
institut pasteur | ORG | 1 |
influenzavirus a family orthomyxoviridae | ORG | 1 |
influenza d viruses | PERSON | 1 |
infectious bronchitis | ORG | 1 |
infectious disease | DISEASE | 1 |
infectious bronchitis virus and other closely related gammacoronaviruses within clinical samples | ORG | 1 |
infectious bronchitis sites | PERSON | 1 |
infectious bronchitis | DISEASE | 1 |
infection of farmed | DISEASE | 1 |
humans international agency for research on cancer sars cov 2 | ORG | 1 |
humans | TAXON | 1 |
human infection | DISEASE | 1 |
hobi | PERSON | 1 |
homwong et | PERSON | 1 |
holyoake | GPE | 1 |
holstein | GPE | 1 |
holmes 1990 | PERSON | 1 |
hokkaido japan | PERSON | 1 |
hofmann | ORG | 1 |
hoffman | PERSON | 1 |
hoelzer shackelton | PERSON | 1 |
hoelzer | GPE | 1 |
histophilus somni headley alfieri | ORG | 1 |
hong kong of china | GPE | 1 |
histophilus somni | DISEASE | 1 |
histological | ORG | 1 |
hiseq 2000 | CHEMICAL | 1 |
hill | PERSON | 1 |
higgins | PERSON | 1 |
hiscript | PERSON | 1 |
hertig masuda | PERSON | 1 |
herrler 2001 | CHEMICAL | 1 |
herrler | PERSON | 1 |
honduras 1997 diepholz | CHEMICAL | 1 |
hongkong | GPE | 1 |
human coronaviruses oc43 | TAXON | 1 |
huang et al 2013 | PERSON | 1 |
human nc_021541 | ORG | 1 |
human kidney | PERSON | 1 |
human coronavirus oc43 receptors | TAXON | 1 |
human coronavirus nl63 | TAXON | 1 |
human coronavirus | TAXON | 1 |
hubei province coronavirus disease covid | DISEASE | 1 |
hubei province coronavirus | TAXON | 1 |
hubei province | GPE | 1 |
huazhong agricultural university | ORG | 1 |
huang tian | PERSON | 1 |
honing r almeida a | CHEMICAL | 1 |
huang ji ou jiajun li shoujun | PERSON | 1 |
huang 2000 | PERSON | 1 |
huang | PERSON | 1 |
huanan seafood wholesale market | ORG | 1 |
huan changchao | PERSON | 1 |
houwelingen | DISEASE | 1 |
host virus | TAXON | 1 |
horzinek | CHEMICAL | 1 |
horse | TAXON | 1 |
iranian holstein dairy herds betacoronavirus | DISEASE | 1 |
ireland | GPE | 1 |
irene greiser | PERSON | 1 |
jos n 8 | ORG | 1 |
kfksv palya et al 2019 | ORG | 1 |
kc881005 bat | PERSON | 1 |
jung et al 2015 | PERSON | 1 |
jung kim | PERSON | 1 |
jung hu saif 2016 | PERSON | 1 |
jung | PERSON | 1 |
jun ho | PERSON | 1 |
josé ivan | PERSON | 1 |
joseph t king r | PERSON | 1 |
jos ictv | ORG | 1 |
kka | PERSON | 1 |
jordan | PERSON | 1 |
joon yee chung et al | PERSON | 1 |
jones wright | PERSON | 1 |
jones r m ellis | PERSON | 1 |
jones oliver 2009 marine | PERSON | 1 |
jones oliver 2009 | PERSON | 1 |
jonassen | PERSON | 1 |
johnson ridpath 2005 | PERSON | 1 |
johnson pendell | PERSON | 1 |
kj399978 | CHEMICAL | 1 |
km089829 | CHEMICAL | 1 |
jo mayers vaneesa ceeraz | ORG | 1 |
ky078891 ky078903 | CHEMICAL | 1 |
kate mayberry 2020 | PERSON | 1 |
kasilingam | PERSON | 1 |
kariwa fujii | ORG | 1 |
kariwa | CHEMICAL | 1 |
kapusinszky delwart | CHEMICAL | 1 |
kangpeng xiao 2020 | PERSON | 1 |
kalliolinna häkkinen | PERSON | 1 |
kaja kaasik | PERSON | 1 |
ky078904 ky078916 | CHEMICAL | 1 |
kx883635 | CHEMICAL | 1 |
km189368 | CHEMICAL | 1 |
kvhvq | PERSON | 1 |
ku886291 | CHEMICAL | 1 |
kt323979 porcine | LOC | 1 |
kt323979 | CHEMICAL | 1 |
kr822424 bulbul coronavirus | PERSON | 1 |
kr822424 | GPE | 1 |
kr060082 kr060085 | CHEMICAL | 1 |
kp403802 | CHEMICAL | 1 |
knu 141112 | CHEMICAL | 1 |
john copps | PERSON | 1 |
jiyao | DISEASE | 1 |
isolation | ORG | 1 |
ito et al | PERSON | 1 |
jakarta | GPE | 1 |
jackwood wit | PERSON | 1 |
jr | ORG | 1 |
jl | ORG | 1 |
jev | PERSON | 1 |
jcs | ORG | 1 |
j saif feline | PERSON | 1 |
ivo oliveira | ORG | 1 |
ivan sánchez betancourt | PERSON | 1 |
ito tomioka ito 2015 | PERSON | 1 |
james jiménez | PERSON | 1 |
italy swabs | GPE | 1 |
italy sicily | GPE | 1 |
italy porcine | LOC | 1 |
italy phylodynamics | GPE | 1 |
italy molecular | GPE | 1 |
italy di | DISEASE | 1 |
italy cho | GPE | 1 |
israel | GPE | 1 |
isolation of avian | ORG | 1 |
james allen | PERSON | 1 |
jan c semenza | ORG | 1 |
jimbo | ORG | 1 |
jeong | GPE | 1 |
jilin | PERSON | 1 |
jianjun li junjiao fei yidong liu zhe stoeger | PERSON | 1 |
jianjun li | DISEASE | 1 |
jialin chen | CHEMICAL | 1 |
jia yaxiong | PERSON | 1 |
ji wang zhao zai li | PERSON | 1 |
jesudoss chelladurai et | PERSON | 1 |
jeoung et al 2008 | PERSON | 1 |
jeoung ahn kim 2008 nakamura et al 2004 | PERSON | 1 |
jeju province small | GPE | 1 |
janetanakit et al | PERSON | 1 |
jeju island outbreak | LOC | 1 |
jeju island complete | LOC | 1 |
jason sawyer | PERSON | 1 |
japan rapid | ORG | 1 |
japan korea | GPE | 1 |
japan inoculation | ORG | 1 |
japan europe | LOC | 1 |
janzen | GPE | 1 |
janice koziuk tara | PERSON | 1 |
msan | ORG | 1 |
nc009988 | CHEMICAL | 1 |
mab | PERSON | 1 |
pcvad | ORG | 1 |
ped disease | DISEASE | 1 |
pdd | DISEASE | 1 |
pdcov monoinfection | CHEMICAL | 1 |
pdcov challenge | ORG | 1 |
pdcov phylogenetic | ORG | 1 |
pdcov n f cgcttaactccgccatcaa pdcov n r tctggtgtaacgcagccagta pdcov n probe fam cccgttgaaaacc | CHEMICAL | 1 |
pdcov n 5 0 atggccgcaccagtagtc 3 0 and 5 0 ctacgctgctgattcctg 3 0 based | CHEMICAL | 1 |
pdcov n | CHEMICAL | 1 |
pdcov iga | CHEMICAL | 1 |
pcv1 | TAXON | 1 |
pedv nucleic acid | CHEMICAL | 1 |
pcv | ORG | 1 |
pcrpositive | ORG | 1 |
pcr iirt pcr | ORG | 1 |
pcr rapid | ORG | 1 |
pcr maurel et al 2011 | ORG | 1 |
pcr homology | ORG | 1 |
pc177 | CHEMICAL | 1 |
pbst | ORG | 1 |
paml 4 8 yang 2007 | CHEMICAL | 1 |
ped virus | TAXON | 1 |
pems | ORG | 1 |
p87l | LOC | 1 |
prrsv genus arterivirus | TAXON | 1 |
palya | CHEMICAL | 1 |
palo alto ca usa | GPE | 1 |
pallansch | GPE | 1 |
palinski et al 2016 | PERSON | 1 |
palinski | PERSON | 1 |
paim lager | PERSON | 1 |
pvc | ORG | 1 |
prv | ORG | 1 |
prrsv porcine parvovirus | TAXON | 1 |
prrsv rammohan | PERSON | 1 |
pi nasal | PERSON | 1 |
prdc porcine | ORG | 1 |
prdc opriessnig | ORG | 1 |
prdc atashpaz | ORG | 1 |
prcv | CHEMICAL | 1 |
pr | ORG | 1 |
pockit tm | ORG | 1 |
pockit nucleic acid analyzer | ORG | 1 |
pnp | CHEMICAL | 1 |
pmd | CHEMICAL | 1 |
paml | GPE | 1 |
p16 p18 | PERSON | 1 |
pan hao | PERSON | 1 |
north and south america europe | GPE | 1 |
nsp3 | ORG | 1 |
notomi | GPE | 1 |
norway travel | ORG | 1 |
norway panorama 2020 | ORG | 1 |
northwestern germany | GPE | 1 |
northern ireland | GPE | 1 |
northern europe | LOC | 1 |
northern | LOC | 1 |
northeastern china | LOC | 1 |
north carolina | GPE | 1 |
nucleocapsid | ORG | 1 |
north america food animal practice spontaneous brsv | ORG | 1 |
north america food animal practice characterization | ORG | 1 |
north america food animal practice bovine | ORG | 1 |
north america food animal practice | ORG | 1 |
north america australasia | LOC | 1 |
noriko goji | PERSON | 1 |
niskanen ihalainen | GPE | 1 |
nishiura | PERSON | 1 |
nipah viruses | TAXON | 1 |
nucleic acid | CHEMICAL | 1 |
oc43 receptors and attachment factors | ORG | 1 |
p n | ORG | 1 |
online available | PERSON | 1 |
oxoid uk macconkey | ORG | 1 |
oxoid | ORG | 1 |
ottawa laboratory | ORG | 1 |
otonel | CHEMICAL | 1 |
other respiratory viruses inactivation | ORG | 1 |
otagiri | PERSON | 1 |
oryctolagus | GPE | 1 |
orla flynn department of agriculture food | ORG | 1 |
organtini allison lukk | ORG | 1 |
oldham | PERSON | 1 |
oh 851 | CHEMICAL | 1 |
oklahoma | GPE | 1 |
oka et al 2014 | PERSON | 1 |
ohio | GPE | 1 |
ogbu kenneth | PERSON | 1 |
occurrence | PERSON | 1 |
occupational health safety s | ORG | 1 |
onpg | CHEMICAL | 1 |
oie reference laboratory | ORG | 1 |
oh851 | PERSON | 1 |
pam dachung luka | PERSON | 1 |
panciera confer | PERSON | 1 |
nipah virus | TAXON | 1 |
poe | ORG | 1 |
porcine ab576629 j19 human | PERSON | 1 |
poon | PERSON | 1 |
polymicrobial respiratory disease | DISEASE | 1 |
polyl lysine | CHEMICAL | 1 |
pololitico portugal | PERSON | 1 |
poland great britain | GPE | 1 |
poland | GPE | 1 |
poisson | GPE | 1 |
pocock et al 1975 pratelli 2008 | ORG | 1 |
plowright et al 2015 | PERSON | 1 |
porcine epidemic diarrhea ped new | ORG | 1 |
ploufragan france | PERSON | 1 |
plates | GPE | 1 |
plasmids | PERSON | 1 |
plasma | ORG | 1 |
pituco | CHEMICAL | 1 |
pijpers | CHEMICAL | 1 |
pig farms | TAXON | 1 |
picornaviridae | ORG | 1 |
pi | CHEMICAL | 1 |
porcine epidemic diarrhea | ORG | 1 |
porcine epidemic diarrhea ped suppression | ORG | 1 |
phylogenetics | GPE | 1 |
poult | ORG | 1 |
hendra virus | TAXON | 1 |
primary pulmonary infections | DISEASE | 1 |
preventive veterinary medicine | ORG | 1 |
pretto giordano lucienne garcia alfieri amauri | PERSON | 1 |
preparedness initiative | ORG | 1 |
preliminary epidemiological | ORG | 1 |
prasithsirikul | PERSON | 1 |
prairie swine centre saskatoon | PERSON | 1 |
prabakaran | CHEMICAL | 1 |
post | ORG | 1 |
porcine epidemic diarrhea virus different | ORG | 1 |
portuguese veterinária notícias | LOC | 1 |
portuguese monoclonal | ORG | 1 |
portugal germany | GPE | 1 |
porcine respiratory disease complex prdc | TAXON | 1 |
porcine kobuvirus | PERSON | 1 |
porcine epidemic diarrhoea ped | ORG | 1 |
porcine coronavirus | PERSON | 1 |
porcine circovirus 2 pcv 2 | TAXON | 1 |
porcine bocavirus | TAXON | 1 |
phylogram | ORG | 1 |
phylogenetic | ORG | 1 |
pandeng chen lulu qian | PERSON | 1 |
parvoviridae canine | ORG | 1 |
paton 1995 | ORG | 1 |
pathways | PERSON | 1 |
pathological damage | DISEASE | 1 |
pathogenicity | PERSON | 1 |
pathogenic | ORG | 1 |
pasick j berhane | PERSON | 1 |
parvovirus detection | ORG | 1 |
parvovirus | TAXON | 1 |
parvoviridae canine parvovirus | DISEASE | 1 |
park et al 2015 | ORG | 1 |
peiris | PERSON | 1 |
paris rome | ORG | 1 |
paratyphi c | ORG | 1 |
paratyphi | CHEMICAL | 1 |
paraskevis | PERSON | 1 |
parana brazil | PERSON | 1 |
paramyxoviruses mega x molecular | CHEMICAL | 1 |
panigrahy naqi hall | ORG | 1 |
panigrahy naqi | CHEMICAL | 1 |
pangolin | CHEMICAL | 1 |
patterson | PERSON | 1 |
peixoto | PERSON | 1 |
photomedicine | CHEMICAL | 1 |
peru rapid | ORG | 1 |
photoimmunology | CHEMICAL | 1 |
photodermatology photoimmunology and photomedicine comparative | ORG | 1 |
phosphate vibrio | LOC | 1 |
phosphate | CHEMICAL | 1 |
phocine | CHEMICAL | 1 |
phi coefficient | TAXON | 1 |
phan et al | PERSON | 1 |
phan | GPE | 1 |
pesquisa veterinária brasileira efficacy | LOC | 1 |
peru l8 | ORG | 1 |
peng | PERSON | 1 |
perlman 2013 | PERSON | 1 |
peritonitis | DISEASE | 1 |
perdiz et al 2000 | PERSON | 1 |
percentages | PERSON | 1 |
pensaert et al 1986 | PERSON | 1 |
pensaert de bouck 1978 | ORG | 1 |
pensaert 1980 | PERSON | 1 |
peng et | PERSON | 1 |
peng fang | PERSON | 1 |
nipah virus hendra virus | TAXON | 1 |
nihon | GPE | 1 |
macherey nagel germany | PERSON | 1 |
mgcl 2 1 ll 10 mm dntp mix 0 4 lm of primer s1for2 0 4 lm of primer s1rev3 0 04 lm of each of the remaining primers 0 25 ll rnasin | CHEMICAL | 1 |
miguel et al 2016 | PERSON | 1 |
migrants | PERSON | 1 |
microsoft | ORG | 1 |
microscopic | GPE | 1 |
microbes | TAXON | 1 |
microarray | PERSON | 1 |
mickaël van | PERSON | 1 |
michael j lemon ken | PERSON | 1 |
mgcl 2 1 ll 10 mm dntp mix 0 8 lm ibvrt1 primer 0 8 lm ibvrt2 primer 0 2 lm ibvrt3 taqman probe 0 25 ll rnasin | CHEMICAL | 1 |
meyer et al 2008 | PERSON | 1 |
miller | ORG | 1 |
mexico heterogeneity | GPE | 1 |
metadata | GPE | 1 |
mesquita j r hakze | PERSON | 1 |
merial beijing | ORG | 1 |
mendoza humberto | PERSON | 1 |
megalign | ORG | 1 |
mega x | PERSON | 1 |
meehan | GPE | 1 |
mebus s | GPE | 1 |
mike collins | PERSON | 1 |
millipore | ORG | 1 |
measurably | ORG | 1 |
mirri palermo italy | DISEASE | 1 |
monne | PERSON | 1 |
molinari et al 2015 | PERSON | 1 |
molecular evolutionary genetics analysis mega | ORG | 1 |
molecular evolutionary genetics | ORG | 1 |
molecular evolutionary | PERSON | 1 |
molecular epidemiology and evolutionary genetics | ORG | 1 |
mokizuki | PERSON | 1 |
mo et al 2013 | PERSON | 1 |
mississippi beef cattle | LOC | 1 |
miranda thompson | PERSON | 1 |
millipore billerica ma | ORG | 1 |
mira purpari lorusso | PERSON | 1 |
mira canuti et al | ORG | 1 |
mira canuti | PERSON | 1 |
minta | GPE | 1 |
miniopterus spp | TAXON | 1 |
miniopterus schreibersii consensus primer | TAXON | 1 |
miniopterus bats | TAXON | 1 |
mini kit qiagen | PERSON | 1 |
millipore watford | PERSON | 1 |
mebus | GPE | 1 |
mcmenamy | CHEMICAL | 1 |
monopterus | CHEMICAL | 1 |
mahmood | GPE | 1 |
mannheimia hemolytica | PERSON | 1 |
manitoba colorado | GPE | 1 |
manitoba agriculture food | ORG | 1 |
makurdi n 11 | ORG | 1 |
maio cape verde identification | ORG | 1 |
mainland china discovery | ORG | 1 |
mai k feng | PERSON | 1 |
mai k | PERSON | 1 |
mai | PERSON | 1 |
maharaj | PERSON | 1 |
mao shenghua | PERSON | 1 |
magna pure lc | ORG | 1 |
magna lyser roche | ORG | 1 |
magna lyser instrument roche | ORG | 1 |
mag | ORG | 1 |
maes et al 2013 | PERSON | 1 |
maes | PERSON | 1 |
maduka guercio annalisa | PERSON | 1 |
madison wi | PERSON | 1 |
macrogen inc | GPE | 1 |
manuguerra | CHEMICAL | 1 |
mapes kass | PERSON | 1 |
mboii new england biolabs inc | ORG | 1 |
martínez et al | PERSON | 1 |
maurel | PERSON | 1 |
matthijnssens et al 2012 | PERSON | 1 |
maths kortrijk | PERSON | 1 |
maternally | ORG | 1 |
massin jestin 2012 | CHEMICAL | 1 |
massi rodrigo pelisson | GPE | 1 |
massachusetts | GPE | 1 |
masoudi pishraft 188 | PERSON | 1 |
martínez et al 2012 | PERSON | 1 |
martin vinco | ORG | 1 |
maputo | TAXON | 1 |
martin murrell | PERSON | 1 |
martin clark | PERSON | 1 |
martin | PERSON | 1 |
marthaler wang 2016 wesley woods cheung | DISEASE | 1 |
marine | ORG | 1 |
marie france | ORG | 1 |
maria loredana schirò giorgia chiaramonte gabriele gucciardi | PERSON | 1 |
margineda | GPE | 1 |
maputo detection | ORG | 1 |
mononegavirales | TAXON | 1 |
moore jackwood hilt 1997 valastro | PERSON | 1 |
nigeria genetic | ORG | 1 |
nsw data | ORG | 1 |
nair | PERSON | 1 |
nagel haerdt france nucleic | PERSON | 1 |
nacl ornithine | CHEMICAL | 1 |
nvsl ames isu | ORG | 1 |
ntd | ORG | 1 |
nt phylogenetic | ORG | 1 |
nt nucleotide | ORG | 1 |
nt fulllength | ORG | 1 |
nsw ministry of health | ORG | 1 |
nsw | ORG | 1 |
nanodrop | PERSON | 1 |
ns1 protein phylogenetic | ORG | 1 |
ns1 rapid | ORG | 1 |
nrc774antisera | ORG | 1 |
nrc772 rabbit | ORG | 1 |
nr460pig | GPE | 1 |
nr456 | CHEMICAL | 1 |
nr2518 guina | PERSON | 1 |
nr2518 | CHEMICAL | 1 |
npr 2020 singapore | ORG | 1 |
namibia | GPE | 1 |
national research council | ORG | 1 |
nl63 related bat coronavirus | TAXON | 1 |
ng | CHEMICAL | 1 |
nigeria africa rectal | GPE | 1 |
nicola guercio annalisa | PERSON | 1 |
nicholson et al | PERSON | 1 |
nicholas 2011 | PERSON | 1 |
ni | CHEMICAL | 1 |
nguyen et al 2013 | PERSON | 1 |
nguyen v g moon | PERSON | 1 |
nguyen schmidt von haeseler | PERSON | 1 |
ng b c y chan s m s chu s alnaeem a a alhammadi | CHEMICAL | 1 |
next | ORG | 1 |
necrohemorrhagic bronchitis | DISEASE | 1 |
newcastle disease | DISEASE | 1 |
new area huangpu | ORG | 1 |
neumann | PERSON | 1 |
netherlands travellers | ORG | 1 |
netherlands ministerie van landbouw | PERSON | 1 |
nelson palermo hafenstein | DISEASE | 1 |
nederlandse voedsel | PERSON | 1 |
necrotizing bronchitis | DISEASE | 1 |
necrosuppurative bronchopneumonia | LOC | 1 |
nl63 related bat coronavirus strain | DISEASE | 1 |
nl l | ORG | 1 |
moreno et al | PERSON | 1 |
munkyung | GPE | 1 |
n 9 | CHEMICAL | 1 |
n 3 kocherhans | CHEMICAL | 1 |
n 29 | ORG | 1 |
n 14 | ORG | 1 |
mycoplasma hyopneumoniae | CHEMICAL | 1 |
mutational | ORG | 1 |
mustela | GPE | 1 |
murrin 2018 | ORG | 1 |
murine dendritic cells | TAXON | 1 |
mun seong hwan kang won myoung yoo | PERSON | 1 |
n d i x a | CHEMICAL | 1 |
multivariate | ORG | 1 |
muhire | PERSON | 1 |
muench reed muench 1938 | PERSON | 1 |
mozambique figuiredo | PERSON | 1 |
morton | DISEASE | 1 |
mortlock | PERSON | 1 |
morrison | ORG | 1 |
morocco infection canine parvovirus cpv 2 | TAXON | 1 |
morocco amrani | PERSON | 1 |
n carmona | ORG | 1 |
n d i x b | CHEMICAL | 1 |
nh p15 | ORG | 1 |
nc01887 | CHEMICAL | 1 |
nemo | ORG | 1 |
nebuffer | ORG | 1 |
ndv lasota | GPE | 1 |
ndv | ORG | 1 |
nd | GPE | 1 |
nc_021541 | DISEASE | 1 |
nc_014511 | CHEMICAL | 1 |
ncbi s nucleotide | ORG | 1 |
nc032107 | CHEMICAL | 1 |
nc010437 bat coronavirus hku8 | TAXON | 1 |
n figure | ORG | 1 |
nc007732 mouse | PERSON | 1 |
nc004718 | CHEMICAL | 1 |
nc003436 human coronavirus | PERSON | 1 |
n protein choogang vaccine | CHEMICAL | 1 |
n gene rrt pcr | ORG | 1 |
n gene of the virus virus rna was reverse transcribed | CHEMICAL | 1 |
n gene b | CHEMICAL | 1 |
n ns7 | PERSON | 1 |
n figure 2g the nucleotide sequence identity of 3 utr | CHEMICAL | 1 |
herrewegh | CHEMICAL | 1 |
benard | PERSON | 1 |
hence zoos | PERSON | 1 |
brookes | PERSON | 1 |
buffer | ORG | 1 |
buchmeier fleming | PERSON | 1 |
bryson ball forster 1996 | ORG | 1 |
bryson | GPE | 1 |
brusin | CHEMICAL | 1 |
brown paul | PERSON | 1 |
brown brenn | PERSON | 1 |
brookes hernandez jover | PERSON | 1 |
brookes hernandez | PERSON | 1 |
bronchitis | DISEASE | 1 |
bürki frey pilo 2015 | ORG | 1 |
broad cross species infection of cultured cells | ORG | 1 |
brittany potential impact of pandemic influenza | ORG | 1 |
brittain long | PERSON | 1 |
briand henry massin jestin 2012 | PERSON | 1 |
breslin breuhaus vivrette smith | PERSON | 1 |
breiman et al 1984 | ORG | 1 |
brazil seroprevalence | LOC | 1 |
brazil pathogenesis | ORG | 1 |
brasil | PERSON | 1 |
bui et al 2014 | PERSON | 1 |
c hu | PERSON | 1 |
bovine kobuvirus | TAXON | 1 |
cart | CHEMICAL | 1 |
cerca programme generalitat de catalunya | ORG | 1 |
cdcp travel health notices | ORG | 1 |
cdcp | ORG | 1 |
cd147 ibrahim et | PERSON | 1 |
ccc | ORG | 1 |
cca | CHEMICAL | 1 |
cbpp | DISEASE | 1 |
cadvs | DISEASE | 1 |
cats pickett et | PERSON | 1 |
cal 1 | TAXON | 1 |
cagccacattaccaccaaag | ORG | 1 |
caggaaacagctatgaccatgcttgtgcggtaccattaataaag | ORG | 1 |
caggaaacagctatgaccatgagaataacatcttgcgcagtacc | DISEASE | 1 |
caggaaacagctatgaccatgacgtcttgtgcagtaccattacc | ORG | 1 |
caggaaacagctatgaccatgacgtcttgtgcagtaccattaac | ORG | 1 |
caggaaacagctatgaccatgacatcttgtgctgtaccattaac | CHEMICAL | 1 |
caggaaacagctatgaccatgacatcttgtgcggtgccattaac | ORG | 1 |
caggaaacagctatgaccatgacatcttgtgcggtaccattaac | ORG | 1 |
caggaaacagctatgaccatgacatcttgtgcagtaccattaac | DISEASE | 1 |
caggaaacagctatgaccatgaaaataatatcctgtgcagtacc | ORG | 1 |
bovine respiratory syncytial virus | TAXON | 1 |
bovine herpesvirus type | TAXON | 1 |
ch sichuan s27 | ORG | 1 |
belgium number | ORG | 1 |
bi zeng xiao chen fang 2012 | PERSON | 1 |
bensaid segal | PERSON | 1 |
primer | PERSON | 1 |
ben jebara 2004 | PERSON | 1 |
ben fee | PERSON | 1 |
beltacov | CHEMICAL | 1 |
belouzard millet | PERSON | 1 |
belgium world organisation for animal health | ORG | 1 |
belgium west nile | GPE | 1 |
belgium high disease | GPE | 1 |
big dye terminator | ORG | 1 |
belgium federal agency | ORG | 1 |
belgium farm | ORG | 1 |
belgium bluetongue | ORG | 1 |
belgique notification obligatoire federal ministry of food and agriculture of germany animal | ORG | 1 |
beijing china tong et al 2008 | ORG | 1 |
beijing | GPE | 1 |
bcov | CHEMICAL | 1 |
baumler 2000 | GPE | 1 |
bat origin | PERSON | 1 |
bidokhti | PERSON | 1 |
bigdye | ORG | 1 |
bovine respiratory syncytial virus brvs | ORG | 1 |
biotechnology co ltd | ORG | 1 |
bosch van de haan | PERSON | 1 |
borders | ORG | 1 |
bootscan | ORG | 1 |
bochkov et al | PERSON | 1 |
bobrowski baker | PERSON | 1 |
bohv 1 | ORG | 1 |
blome desselberger gray 2002 | PERSON | 1 |
bisharat agmon finkelstein | PERSON | 1 |
biotechnology seongnam | PERSON | 1 |
biosystems cat a33402 | PERSON | 1 |
bio inc | PERSON | 1 |
biosoft international | PERSON | 1 |
bionumerics | ORG | 1 |
bioedit | ORG | 1 |
biocare medical decloaking chamber | ORG | 1 |
biorobot m48 | ORG | 1 |
biogreen 21 program rural development administration | ORG | 1 |
bioedit hall | ORG | 1 |
bio tek usa | LOC | 1 |
bio rad t100 forster city ca | ORG | 1 |
cfia news | ORG | 1 |
chjxni2 | CHEMICAL | 1 |
bat cov high | PERSON | 1 |
chase | ORG | 1 |
cheng | PERSON | 1 |
chenais | GPE | 1 |
chen et al 2014 gerber | PERSON | 1 |
chen et al 2014 | PERSON | 1 |
chen et al 2008 | PERSON | 1 |
chen yanyu | PERSON | 1 |
chen junwei | PERSON | 1 |
chekwube chukwudi | PERSON | 1 |
chatzidaki | CHEMICAL | 1 |
characterization | GPE | 1 |
cheng song cheng 2016 | PERSON | 1 |
channel news | ORG | 1 |
changhee lee | PERSON | 1 |
changhai liu xiufan | PERSON | 1 |
chang et al 2014 | PERSON | 1 |
chang et al 2002 | PERSON | 1 |
chang et al 2001 | PERSON | 1 |
challenges | ORG | 1 |
chaintoutis | DISEASE | 1 |
cessie | DISEASE | 1 |
cheng song cheng | PERSON | 1 |
chengxin | DISEASE | 1 |
cavanagh 2007 | DISEASE | 1 |
china genome | ORG | 1 |
choi hwan | PERSON | 1 |
cho et al 2014 | PERSON | 1 |
chinese academy of agricultural sciences | ORG | 1 |
china yang | GPE | 1 |
china song | ORG | 1 |
china sensitive | ORG | 1 |
china phylogenetic | ORG | 1 |
china institute of veterinary drug control when pedv | ORG | 1 |
china infection vaccination | ORG | 1 |
china discovery | ORG | 1 |
chenna | PERSON | 1 |
china detection | ORG | 1 |
china coronavirus | PERSON | 1 |
chimaera siscan | PERSON | 1 |
chile global level 4 health advisory 2020 | ORG | 1 |
chile | GPE | 1 |
chickens origins | PERSON | 1 |
chiang | PERSON | 1 |
chenyan lin sheng | PERSON | 1 |
chenyan | CHEMICAL | 1 |
cells | ORG | 1 |
cavanagh 2005 infectious | DISEASE | 1 |
chn gd16 | ORG | 1 |
cpv 2 | ORG | 1 |
ctt tgacaactgtgt | CHEMICAL | 1 |
cta tcg cca ggg aaa tgt | ORG | 1 |
cta | CHEMICAL | 1 |
csfv viruses | TAXON | 1 |
csfv nucleic acids | CHEMICAL | 1 |
csfv rna | TAXON | 1 |
csf marcus czub university of calgary | ORG | 1 |
cpvs | TAXON | 1 |
cpv xu et al 2015 | ORG | 1 |
covid 19 and daily | ORG | 1 |
calidris | PERSON | 1 |
covid 19 sheridan 2020 | ORG | 1 |
covid 19 one | ORG | 1 |
covid 19 lack | ORG | 1 |
covid 19 india | ORG | 1 |
covid 19 african | ORG | 1 |
cnn | ORG | 1 |
cn fujian | PERSON | 1 |
chn gd16 13 | ORG | 1 |
chn gd16 01 | ORG | 1 |
calculate | ORG | 1 |
california usa | ORG | 1 |
cavanagh 2003 cavanagh 2005 the poultry industry | CHEMICAL | 1 |
cargnel | CHEMICAL | 1 |
cavanagh | PERSON | 1 |
catalunya | CHEMICAL | 1 |
castanheira | DISEASE | 1 |
cases of corona virus infection | ORG | 1 |
carstensen 2020a | PERSON | 1 |
carrillo santisteve | PERSON | 1 |
carpenter | PERSON | 1 |
carmona | GPE | 1 |
carlsbad ca usa dneasy blood | ORG | 1 |
capture | ORG | 1 |
calvet et al 2016 | PERSON | 1 |
cape verde costanheira | LOC | 1 |
caniforms | ORG | 1 |
cancer sars cov | DISEASE | 1 |
canadian council on animal care | ORG | 1 |
canada mutation of the s | ORG | 1 |
canada letter | ORG | 1 |
canada emerging | ORG | 1 |
canada cfia news | ORG | 1 |
cameron wykstra | PERSON | 1 |
bat cov rashc014 | ORG | 1 |
bat cov 1a | ORG | 1 |
choleraesuis | PERSON | 1 |
atcc | ORG | 1 |
accession | ORG | 1 |
abuja | GPE | 1 |
absence of middle east | ORG | 1 |
aboubakr hamada | PERSON | 1 |
abi xue luo yan shen | PERSON | 1 |
ay277921 | CHEMICAL | 1 |
avl qiagen | ORG | 1 |
avl | DISEASE | 1 |
av | DISEASE | 1 |
ata | CHEMICAL | 1 |
acetylmannosamine | CHEMICAL | 1 |
asf outbreaks | TAXON | 1 |
asf | ORG | 1 |
aj1102 | CHEMICAL | 1 |
aiv newcastle | ORG | 1 |
agc | CHEMICAL | 1 |
afcd77 eu420139 rousettus | PERSON | 1 |
afcd77 eu420139 | PERSON | 1 |
af531433 | CHEMICAL | 1 |
af139 wuhan paris af1004 | ORG | 1 |
accumulations | ORG | 1 |
ackermann tobler | PERSON | 1 |
ace 2 roles | ORG | 1 |
africa molecular | LOC | 1 |
aichivirus f bat kobuvirus adams | CHEMICAL | 1 |
aichivirus e | CHEMICAL | 1 |
aichivirus b f | PERSON | 1 |
aichivirus b | CHEMICAL | 1 |
aichivirus | GPE | 1 |
agrimer office | ORG | 1 |
agranovski 2018 | PERSON | 1 |
agnes | LOC | 1 |
agpath id | CHEMICAL | 1 |
africa amrani | PERSON | 1 |
acute respiratory diseases office of inspector general hospitals | ORG | 1 |
aerosol | GPE | 1 |
aedes albopictus mosquitoes | TAXON | 1 |
adney et al 2016 alexandersen | PERSON | 1 |
adney et al 2016 | PERSON | 1 |
adney bielefeldt ohmann | ORG | 1 |
adney bielefeldt | CHEMICAL | 1 |
additional supporting information | ORG | 1 |
adams et al | PERSON | 1 |
adams king | PERSON | 1 |
adrv n | ORG | 1 |
abi prism | CHEMICAL | 1 |
akaike | ORG | 1 |
1977 song | PERSON | 1 |
312x | PERSON | 1 |
3 3 diaminobenzidine dab | CHEMICAL | 1 |
2b g2b | ORG | 1 |
23 1607 1609 https | CHEMICAL | 1 |
20160414029gh | CHEMICAL | 1 |
2010 ge et al 2013 sun et | PERSON | 1 |
2 porcine | TAXON | 1 |
2 phosphotungstic acid | CHEMICAL | 1 |
2 nucleic acid | CHEMICAL | 1 |
1767 1768 nucleotides | CHEMICAL | 1 |
331740 | CHEMICAL | 1 |
1705 virus infection | DISEASE | 1 |
17 qx | PERSON | 1 |
13782 sha 9efc9721f93124956c6bc58cd11f33caf2224ec7 | CHEMICAL | 1 |
13379 sha 90643a0f17590c228f6a0a78cbef7aa910d62687 | CHEMICAL | 1 |
1 vibrio | PERSON | 1 |
1 canine | ORG | 1 |
1 4 m 2 groups 1 2 3 and 4 were | CHEMICAL | 1 |
1 390 amino acids | CHEMICAL | 1 |
0001 8201 | CHEMICAL | 1 |
3274 4296 | CHEMICAL | 1 |
3394 3702 | CHEMICAL | 1 |
ab576631 | CHEMICAL | 1 |
8158 | DISEASE | 1 |
ab576629 | CHEMICAL | 1 |
aavv amarasinghe | PERSON | 1 |
aavv | CHEMICAL | 1 |
aaa | CHEMICAL | 1 |
a959v | CHEMICAL | 1 |
a33402 | CHEMICAL | 1 |
a visual exploratory data | ORG | 1 |
a aboubakr | PERSON | 1 |
8cqxz3wi | DISEASE | 1 |
5a399b53d86962eb78ea7cf31d4b377a284327d1 | CHEMICAL | 1 |
3a | ORG | 1 |
5 nucleotide | CHEMICAL | 1 |
5 201608 ky075996 | CHEMICAL | 1 |
5 2016 ky075986 | CHEMICAL | 1 |
5 0 biotin | CHEMICAL | 1 |
5 0 fam | CHEMICAL | 1 |
4651 | CHEMICAL | 1 |
4625 | CHEMICAL | 1 |
4 6 diamidino 2phenylindole | CHEMICAL | 1 |
3d | ORG | 1 |
aichivirus kobuvirus | PERSON | 1 |
al qassem 9 racing 9 a3 20 20 9 | CHEMICAL | 1 |
barry miller | PERSON | 1 |
bcov infection | DISEASE | 1 |
brd fulton | ORG | 1 |
bpiv | PERSON | 1 |
bmr genomics | ORG | 1 |
bm | ORG | 1 |
blast | ORG | 1 |
bhq | CHEMICAL | 1 |
beast bioinformatics | ORG | 1 |
bdv hobi | TAXON | 1 |
bcov or ecov mn | GPE | 1 |
bcov s genes 9 | CHEMICAL | 1 |
brsv arns et al 2003 | ORG | 1 |
bcov s | GPE | 1 |
bcov mn | GPE | 1 |
bcov headley et al 2018 pasteurella | PERSON | 1 |
bcov f i g u r e 7 phylogenetic | ORG | 1 |
bcov bovine coronavirus | CHEMICAL | 1 |
balb | ORG | 1 |
b15 | ORG | 1 |
b l e 1 association | ORG | 1 |
azkur | CHEMICAL | 1 |
brown et al | GPE | 1 |
brsv ballooning | ORG | 1 |
avogadro | ORG | 1 |
baele g lemey p rambaut a | ORG | 1 |
barlan | GPE | 1 |
barbara di martino et al | PERSON | 1 |
banna virus | PERSON | 1 |
bande | PERSON | 1 |
bambas | GPE | 1 |
balasuriya | PERSON | 1 |
baker | PERSON | 1 |
bai et al 2020 chan et | PERSON | 1 |
bagging | GPE | 1 |
bacterial pneumonia homology based identification of a mutation | ORG | 1 |
brsv bohv 1 | ORG | 1 |
bacteria | TAXON | 1 |
bvdv subgenotypes | TAXON | 1 |
bvdv massi rp | ORG | 1 |
bvdv liu et al | PERSON | 1 |
bvdv flores | ORG | 1 |
bvdv cortez et al 2006 | PERSON | 1 |
bvdv bohv 1 | ORG | 1 |
bvd virus | TAXON | 1 |
bs c 1 | ORG | 1 |
azizzadeh | CHEMICAL | 1 |
avian coronaviruses | TAXON | 1 |
ala | ORG | 1 |
altamimi ahmed | PERSON | 1 |
anene | CHEMICAL | 1 |
andrews kennedy | PERSON | 1 |
anas | ORG | 1 |
analysis of infectious disease data | ORG | 1 |
amuasi et al | PERSON | 1 |
amuasi | DISEASE | 1 |
america bande | GPE | 1 |
america | GPE | 1 |
altizer ostfeld johnson kutz | PERSON | 1 |
alphacoronaviruses | ORG | 1 |
anhui | GPE | 1 |
alphacov | CHEMICAL | 1 |
alonso | CHEMICAL | 1 |
alison lee genereach usa | PERSON | 1 |
alfieri 2014 headley | PERSON | 1 |
alexandersen kobinger soule | PERSON | 1 |
alexander | ORG | 1 |
alena babenko | PERSON | 1 |
alcindo saut | GPE | 1 |
alam et al | PERSON | 1 |
angus j d title | PERSON | 1 |
anti mouse | PERSON | 1 |
avian coronaviruses maurel et | ORG | 1 |
asia collin | GPE | 1 |
avian coronaviruses maurel | DISEASE | 1 |
autopsies | ORG | 1 |
authors | ORG | 1 |
australian government department of health | ORG | 1 |
associations | ORG | 1 |
assay kit | PERSON | 1 |
asp | ORG | 1 |
asia ped | ORG | 1 |
asia geng | LOC | 1 |
ascaris infection | DISEASE | 1 |
antibody | PERSON | 1 |
arterivirus | PERSON | 1 |
arteriviridae isolation | ORG | 1 |
arteriviridae | PERSON | 1 |
armor conseil régional de bretagne conseil régional des pays de loire | ORG | 1 |
armor | CHEMICAL | 1 |
arlington | GPE | 1 |
applied biosystems 3130xl | ORG | 1 |
apoptosis | PERSON | 1 |
apaa | ORG | 1 |
choi lee lee oem 2015 | PERSON | 1 |
choleraesuis streptococcus | PERSON | 1 |
henan hebei | GPE | 1 |
g2b vaccine | PERSON | 1 |
gi 13 4 91 | ORG | 1 |
ggcatttctactacc | ORG | 1 |
gee | CHEMICAL | 1 |
gds01 km089829 | PERSON | 1 |
gctagtggcgttcatggtat | ORG | 1 |
gc 2020 chile screening | ORG | 1 |
gac | CHEMICAL | 1 |
g4 p16 p18 animals | ORG | 1 |
g2bbased | CHEMICAL | 1 |
g2b strain | PERSON | 1 |
gii c phylogenetic | ORG | 1 |
g2b porcine | PERSON | 1 |
g2b genomes | PERSON | 1 |
g2b epidemics | PERSON | 1 |
g2 porcine | PERSON | 1 |
g1 versus g2 | PERSON | 1 |
furthermore m bovis | PERSON | 1 |
furin | ORG | 1 |
frey | DISEASE | 1 |
freshwater | ORG | 1 |
gi 19 | ORG | 1 |
gtaaaacgacggccagtgaattattactaccaaagtgc | CHEMICAL | 1 |
france isolation | ORG | 1 |
gao | PERSON | 1 |
genereach usa lexington ma usa | ORG | 1 |
genclean column | ORG | 1 |
genbank the | ORG | 1 |
genbank figure 1 consistent | ORG | 1 |
gen bank | ORG | 1 |
gelb | ORG | 1 |
gautret | PERSON | 1 |
gary 2020 | PERSON | 1 |
gaps | CHEMICAL | 1 |
gansu provinces of china | ORG | 1 |
gtaaaacgacggccagtgacatactattaccagagtcag | ORG | 1 |
gansu | GPE | 1 |
gammacoronavirus diagnosis r m jones | CHEMICAL | 1 |
gamma coronavirus nr2515 | CHEMICAL | 1 |
gallagher buchmeier 2001 | PERSON | 1 |
gu199514 | CHEMICAL | 1 |
gtaaaacgacggccagtggtttactactaccagagtgc | CHEMICAL | 1 |
gtaaaacgacggccagtggtgtattactaccagagtgc | ORG | 1 |
gtaaaacgacggccagtggtgtactactaccaaagtgc | ORG | 1 |
gtaaaacgacggccagtggtctactactaccaaagcgc | DISEASE | 1 |
française | DISEASE | 1 |
fr tcov strain 080385d | PERSON | 1 |
genetic | ORG | 1 |
exp 1 | GPE | 1 |
fl2013 | CHEMICAL | 1 |
fj556872 | CHEMICAL | 1 |
fecv kipar | GPE | 1 |
fbs gibco life technologies | ORG | 1 |
fam cccgttgaaaacc mgb | ORG | 1 |
f84 | GPE | 1 |
f12 | ORG | 1 |
f li | PERSON | 1 |
exp 3 | PERSON | 1 |
exp | ORG | 1 |
fab | PERSON | 1 |
european union funds qren feder | ORG | 1 |
european union | ORG | 1 |
european centre for disease prevention control | ORG | 1 |
european centre for disease prevention | ORG | 1 |
europe vector | LOC | 1 |
europe the veterinary record antibodies | LOC | 1 |
europe kingsley | LOC | 1 |
eurofins genomics huntsville al usa vectors | PERSON | 1 |
estrogen | ORG | 1 |
fmd hanover | ORG | 1 |
fabricius viral | PERSON | 1 |
fouchier | PERSON | 1 |
fihlani | CHEMICAL | 1 |
forni | GPE | 1 |
forest | DISEASE | 1 |
foods human | ORG | 1 |
foodborne viral illnesses | DISEASE | 1 |
folitse | CHEMICAL | 1 |
flynn et al | PERSON | 1 |
fluorescence | GPE | 1 |
fiona mcmenamy | PERSON | 1 |
fihlani 2020 | ORG | 1 |
fields virology | ORG | 1 |
fagerberg et al 2014 | PERSON | 1 |
ficetola rubolini | PERSON | 1 |
feng li | PERSON | 1 |
feline coronavirus type ii | TAXON | 1 |
feline coronavirus | TAXON | 1 |
feinstone | CHEMICAL | 1 |
federal agency | ORG | 1 |
fekov | DISEASE | 1 |
fatal | GPE | 1 |
fan et al 2018 | PERSON | 1 |
generay biotech | PERSON | 1 |
geng et al 2015 guo | PERSON | 1 |
esona et al 2010 | PERSON | 1 |
hi | DISEASE | 1 |
hn | ORG | 1 |
hljby p10 | ORG | 1 |
hljby | PERSON | 1 |
hku5 a434 sc2013 | PERSON | 1 |
hku4 | PERSON | 1 |
hku3 2 | ORG | 1 |
hku2 nc009988 bat coronavirus | PERSON | 1 |
hku1 | TAXON | 1 |
hiv | TAXON | 1 |
hcov oc43 hcov hku1 | DISEASE | 1 |
ht | DISEASE | 1 |
hcov emc 2012 | PERSON | 1 |
hcov emc | DISEASE | 1 |
hcov 229e and hcov nl63 | DISEASE | 1 |
hcov 229e mhv tgev | DISEASE | 1 |
hcv | GPE | 1 |
haa | ORG | 1 |
h9 weike | PERSON | 1 |
h7n7 virus | TAXON | 1 |
h20 | CHEMICAL | 1 |
hr n | ORG | 1 |
hvr iii | GPE | 1 |
h lee g | PERSON | 1 |
hause et al 2013 | PERSON | 1 |
hemophilus | GPE | 1 |
hemmatzadeh | CHEMICAL | 1 |
hemida m g chu d | PERSON | 1 |
hemida | PERSON | 1 |
health research coalition regulating backyard | ORG | 1 |
health human development | ORG | 1 |
health domestic | ORG | 1 |
hen 2 china 2019 | ORG | 1 |
he hongxuan | PERSON | 1 |
hastie et al 2009 | ORG | 1 |
hvr regions | ORG | 1 |
hastie | PERSON | 1 |
hartwig bowen | PERSON | 1 |
harbin veterinary research institute | ORG | 1 |
hao pan | PERSON | 1 |
hao liying bai | PERSON | 1 |
hamel | GPE | 1 |
hall ltd | ORG | 1 |
haines clark dubovi 1992 | PERSON | 1 |
hafenstein | DISEASE | 1 |
h1n1 influenza | PERSON | 1 |
gómara | PERSON | 1 |
gerdts zakhartchouk | PERSON | 1 |
globally eu | PERSON | 1 |
gostin debartolo | PERSON | 1 |
gostin cranmer kraemer | PERSON | 1 |
gostic | LOC | 1 |
gore | PERSON | 1 |
gorbalenya baker baric 2020 | ORG | 1 |
gong et al 2017 | ORG | 1 |
goiás state | GPE | 1 |
goscript reverse transcription system | ORG | 1 |
gniadkowski hryniewicz | PERSON | 1 |
global warming engineering | ORG | 1 |
grande | GPE | 1 |
giammarioli | ORG | 1 |
gesley 2020 brazil employees | ORG | 1 |
germany rothe | GPE | 1 |
germany federal ministry of food agriculture of germany | ORG | 1 |
germany epidemiology | ORG | 1 |
germany epidemic | ORG | 1 |
germany detection of salmonella | ORG | 1 |
germany detection | ORG | 1 |
germany coronavirus | PERSON | 1 |
goyal https orcid | DISEASE | 1 |
graphpad | ORG | 1 |
gélinas boutin | PERSON | 1 |
guido ruggero schirò giorgia chiaramonte gabriele tion | PERSON | 1 |
gámbaro et al 2020 | PERSON | 1 |
guy 2013 | PERSON | 1 |
guy 2000 cavanagh | PERSON | 1 |
guo yiwen qiao hongxing xu yaohui | PERSON | 1 |
guo jiahui fang liurong ye | PERSON | 1 |
guo | PERSON | 1 |
gundy | PERSON | 1 |
guionie | PERSON | 1 |
guina | GPE | 1 |
guangzhou | GPE | 1 |
graphpad prism | ORG | 1 |
guangxi infectious | GPE | 1 |
guangxi | GPE | 1 |
grone | CHEMICAL | 1 |
greece identification of wild boar | ORG | 1 |
greece | GPE | 1 |
great yorkshire dutch landrace | PERSON | 1 |
great britain gel | GPE | 1 |
great britain complete | GPE | 1 |
grau roma | ORG | 1 |
estradiol | PERSON | 1 |
equine coronavirus | PERSON | 1 |
chongqin city | GPE | 1 |
current opinion in food science meteorological | ORG | 1 |
dab dako | PERSON | 1 |
d1466 d274 | PERSON | 1 |
d virus a | CHEMICAL | 1 |
d sorbitol fermentation d mannitol | CHEMICAL | 1 |
d jeong d g title | PERSON | 1 |
d 221 n k | CHEMICAL | 1 |
céline weerts erik | PERSON | 1 |
céline | CHEMICAL | 1 |
current opinion in virology detection | ORG | 1 |
cumming | GPE | 1 |
deng et al giant | PERSON | 1 |
cultures | PERSON | 1 |
cuba | GPE | 1 |
crystal | ORG | 1 |
cross | ORG | 1 |
costanheira | DISEASE | 1 |
cosmogenetech co ltd | ORG | 1 |
corsham | PERSON | 1 |
coronaviruses | LOC | 1 |
coronavirus infections | DISEASE | 1 |
dapi | ORG | 1 |
deng et al giant panda | CHEMICAL | 1 |
coronavirus disease | DISEASE | 1 |
dane hannah duffy catherine guelbenzu maria | PERSON | 1 |
debouck pensaert 1980 pijpers nieuwstadt terpstra | ORG | 1 |
deadly | DISEASE | 1 |
dea tijssen | PERSON | 1 |
decaprio gartner burgess kothari | ORG | 1 |
daw et | PERSON | 1 |
davies 2004 | ORG | 1 |
darnell et al 2004 | PERSON | 1 |
darmstadt germany | GPE | 1 |
danon 2009 siettos | DISEASE | 1 |
daly tarlinton 2016 dogonyaro | CHEMICAL | 1 |
dm | CHEMICAL | 1 |
dako target retrieval | ORG | 1 |
dako carpinteria ca usa | ORG | 1 |
dako | GPE | 1 |
dq648858 | CHEMICAL | 1 |