adjective

This is a table of type adjective and their frequencies. Use it to search & browse the list to learn more about your study carrel.

adjective	frequency
viral	867
human	641
respiratory	487
small	336
specific	293
immune	265
clinical	256
high	247
different	241
acute	229
severe	226
antiviral	208
anti	206
similar	190
novel	183
supplemental	181
potential	179
like	175
infected	161
infectious	157
important	156
low	155
several	153
many	147
new	146
significant	144
positive	144
cellular	144
single	143
multiple	139
genomic	138
present	130
large	129
dependent	125
higher	125
molecular	125
functional	124
negative	121
wild	115
recombinant	114
pathogenic	109
full	108
first	108
early	107
additional	104
genetic	103
consistent	102
lower	102
available	101
critical	98
bacterial	98
structural	97
possible	95
innate	95
recent	94
major	93
likely	92
avian	92
inflammatory	92
previous	91
lethal	89
long	88
common	87
primary	86
convalescent	86
protective	84
total	84
reactive	81
complete	80
relative	79
experimental	75
independent	74
distinct	74
key	73
healthy	73
public	72
effective	71
global	71
evolutionary	71
red	70
murine	70
green	70
strong	69
current	69
mammalian	68
rapid	64
transcriptional	64
whole	64
complex	63
real	62
epithelial	62
putative	62
unknown	61
reverse	60
phylogenetic	60
nucleotide	60
intracellular	60
due	60
quantitative	59
non	57
essential	57
standard	56
secondary	56
diverse	56
direct	56
differential	56
mutant	55
able	55
overall	55
particular	54
least	54
late	54
individual	53
cross	53
active	53
sufficient	52
future	52
biological	52
live	51
intestinal	51
second	51
statistical	51
cytoplasmic	50
greater	49
zoonotic	48
unique	48
related	48
adaptive	47
fatty	45
relevant	45
responsible	45
resistant	45
various	45
efficient	44
potent	43
double	43
bovine	43
average	43
initial	42
asymptomatic	42
monoclonal	42
pro	42
steady	41
next	41
covid-19	41
open	40
homologous	40
less	40
cultured	40
porcine	40
seasonal	40
robust	40
subsequent	39
sensitive	39
internal	39
complement	39
western	38
short	38
nonstructural	38
broad	38
general	37
therapeutic	37
unclear	36
conserved	36
attenuated	36
susceptible	35
regulatory	35
limited	35
dendritic	35
deep	35
detectable	34
extensive	34
inhibitory	34
free	33
eukaryotic	33
unexposed	33
stable	33
syncytial	32
old	32
normal	32
necessary	32
certain	32
catalytic	32
final	32
wide	31
separate	31
natural	31
main	31
ferret	31
dominant	30
highest	30
microbial	30
equine	29
pbac	29
pulmonary	28
weak	28
numerous	28
fetal	28
circular	28
enhanced	27
biochemical	27
close	27
synthetic	27
larger	27
mild	27
useful	27
blue	26
intermediate	26
original	26
mutational	26
right	26
rotavirus	26
scientific	26
soluble	26
abundant	25
apparent	25
fungal	25
difficult	25
ev7	25
naive	25
icelandic	25
systemic	25
upper	25
little	25
minimal	24
alternative	24
black	24
proteolytic	24
widespread	24
zippered	24
fecal	23
alveolar	23
central	23
clear	23
downstream	23
equal	23
fatal	23
noncoding	23
filamentous	23
minor	23
peripheral	23
select	23
selective	23
systematic	23
third	23
cryptococcal	22
mature	22
deficient	22
diagnostic	22
dual	22
cynomolgus	22
mock	22
nuclear	22
observed	22
posttranslational	22
safe	22
terminal	22
identical	21
better	21
brief	21
cytosolic	21
serological	21
moderate	21
onward	21
rectal	21
nucleic	21
comparative	20
amino	20
antigenic	20
appropriate	20
best	20
basic	20
domestic	20
extracellular	20
longer	20
mean	20
transmissible	20
intact	19
african	19
airborne	19
cold	19
competent	19
comprehensive	19
confocal	19
entire	19
rmers	19
last	19
latter	19
neutral	19
poor	19
substantial	19
unable	19
vesicular	19
inherent	18
antibiotic	18
comparable	18
fresh	18
indirect	18
good	18
invasive	18
parental	18
uninfected	18
unlikely	18
oral	18
maximum	17
biased	17
chronic	17
covalent	17
cytotoxic	17
enzymatic	17
humoral	17
ancestral	17
mucosal	17
partial	17
peritoneal	17
random	17
successful	17
upstream	17
ongoing	17
local	16
adjacent	16
cd47	16
crucial	16
cytopathic	16
endemic	16
epidemiological	16
great	16
patient	16
pathological	16
polarized	16
polyclonal	16
prokaryotic	16
supernatant	16
top	16
transient	16
elevated	15
fewer	15
endosomal	15
immunosorbent	15
divergent	15
annotated	15
ill	15
hierarchical	15
largest	15
left	15
notable	15
pandemic	15
prior	15
reduced	15
technical	15
northern	14
corresponding	14
defective	14
earlier	14
endothelial	14
environmental	14
exact	14
hyaline	14
interesting	14
optical	14
oropharyngeal	14
peptide	14
representative	14
segmented	14
smaller	14
streptococcal	14
symptomatic	14
translational	14
vascular	14
light	13
aged	13
detailed	13
embryonic	13
extreme	13
feline	13
interstitial	13
uncertain	13
mixed	13
parallel	13
proteasomal	13
simple	13
unbiased	13
universal	13
modest	13
conservative	12
heavy	12
false	12
equivalent	12
endogenous	12
egyptian	12
bioinformatic	12
conformational	12
computational	12
bronchial	12
antimicrobial	12
accidental	12
linear	12
immunogenic	12
virulent	12
native	12
serious	12
nucleoside	12
typical	12
thermal	12
surprising	12
stranded	12
young	12
s2-reactive	12
predictive	12
precise	12
polyprotein	12
outer	12
promising	12
fundamental	11
inactive	11
immunocompromised	11
icosahedral	11
hiv	11
helpful	11
gross	11
dsrna	11
enteric	11
emtricitabine	11
conventional	11
compatible	11
absent	11
integral	11
inducible	11
stringent	11
much	11
valuable	11
naked	11
unusual	11
unrelated	11
undetectable	11
true	11
unclassified	11
ribosomal	11
resident	11
rare	11
pre	11
polar	11
nonessential	11
forward	10
nasopharyngeal	10
immediate	10
horizontal	10
heparin	10
greatest	10
gastrointestinal	10
apical	10
fold	10
dynamic	10
dramatic	10
continuous	10
canine	10
obvious	10
adjuvant	10
nonspecific	10
mouse	10
physical	10
sublethal	10
preclinical	10
weighted	10
viable	10
vast	10
toxic	10
tight	10
uncharacterized	10
subject	10
special	10
silent	10
shorter	10
rich	10
raw	10
proinflammatory	10
flag	9
lysosomal	9
intra	9
immunosuppressive	9
hydrophobic	9
historical	9
grateful	9
geometric	9
flavivirus	9
3d	9
economic	9
deformed	9
dead	9
causative	9
bipartite	9
balanced	9
anticoagulant	9
10-fold	9
medical	9
marked	9
absolute	9
minimum	9
subcellular	9
opposite	9
visible	9
venezuelan	9
yellow	9
varied	9
unchanged	9
triple	9
temporal	9
sulfated	9
variable	9
sporadic	9
reasonable	9
proper	9
postmortem	9
personal	9
persistent	9
permissive	9
past	9
simian	9
heterosubtypic	8
fast	8
frequent	8
geographic	8
helical	8
intense	8
hypothetical	8
immunological	8
immunomodulatory	8
increased	8
emergent	8
evident	8
accessory	8
ebov	8
distant	8
devoid	8
detrimental	8
cytokine	8
competitive	8
canonical	8
affected	8
accurate	8
intrinsic	8
a549	8
international	8
following	8
mathematical	8
rational	8
white	8
maximal	8
virological	8
veterinary	8
undetected	8
tailed	8
solid	8
serologic	8
serial	8
rigorous	8
replicative	8
unexpected	8
proximal	8
opsonophagocytic	8
proteomic	8
nucleolar	8
national	8
ocular	8
nonsynonymous	8
phenotypic	8
preliminary	8
principal	8
niv	8
controversial	7
easy	7
crystal	7
cubic	7
cytostatic	7
deglycosylated	7
diffuse	7
dimensional	7
discrete	7
female	7
ethical	7
excessive	7
external	7
former	7
frozen	7
generic	7
glycosylated	7
constant	7
gray	7
contagious	7
ancient	7
considerable	7
amebic	7
histopathological	7
abdominal	7
acceptable	7
acidic	7
adhesin	7
adverse	7
alone	7
altered	7
archived	7
connected	7
asian	7
autoimmune	7
basal	7
biomedical	7
broader	7
chimeric	7
closer	7
commensal	7
hematopoietic	7
pairwise	7
ideal	7
synonymous	7
regular	7
reliable	7
respective	7
safer	7
sequential	7
sterile	7
strict	7
suggestive	7
tracheal	7
randomized	7
tubular	7
unpublished	7
untreated	7
urogenital	7
impossible	7
vp1	7
vulnerable	7
wk-521	7
redundant	7
variant	7
primate	7
mechanistic	7
practical	7
improved	7
informed	7
insufficient	7
integrated	7
later	7
liquid	7
luminal	7
infective	7
median	7
postdoctoral	7
mirna	7
mitochondrial	7
modern	7
modular	7
nervous	7
nonredundant	7
metabolic	7
dry	6
epidemiologic	6
excess	6
fimbrial	6
gastric	6
golden	6
heterogeneous	6
indicative	6
heterologous	6
immunodominant	6
inconsistent	6
informative	6
invertebrate	6
known	6
deadly	6
directional	6
binary	6
dark	6
artificial	6
lymphocytic	6
actual	6
adoptive	6
agricultural	6
american	6
analytical	6
capable	6
cooperative	6
chemical	6
chinese	6
closed	6
commercial	6
complementary	6
concurrent	6
lowest	6
ppgpp	6
massive	6
subacute	6
s2	6
salivary	6
secretory	6
seropositive	6
somatic	6
species	6
transcriptomic	6
remarkable	6
uncleaved	6
uncontrolled	6
unreported	6
unstimulated	6
urgent	6
mechanical	6
reproductive	6
tremendous	6
regional	6
official	6
protein	6
microbiological	6
middle	6
myc	6
necropsy	6
noninfected	6
mycobacterial	6
opsonic	6
perivascular	6
pervasive	6
vaccinated	6
prominent	6
prone	6
pronounced	6
elapsed	5
exogenous	5
exclusive	5
epigenetic	5
enough	5
ectopic	5
efficacious	5
downregulated	5
ectoparasitic	5
extra	5
expansive	5
impaired	5
exudative	5
fit	5
fluorescent	5
formal	5
hot	5
humanized	5
immunosuppressed	5
incomplete	5
influenza	5
dose	5
dotted	5
aspartic	5
dispensable	5
catastrophic	5
4ab	5
accessible	5
agarose	5
allosteric	5
antigenomic	5
integrative	5
beneficial	5
bifc	5
capsid	5
cgas	5
diseased	5
classical	5
closest	5
clustered	5
coordinated	5
cumulative	5
daily	5
dangerous	5
degenerate	5
deoxy	5
insensitive	5
fibrinolytic	5
intriguing	5
spanish	5
prospective	5
reassortant	5
relaxed	5
renal	5
retrospective	5
rhetorical	5
routine	5
simplistic	5
social	5
southwestern	5
striking	5
probable	5
suburban	5
sustained	5
taxonomic	5
traditional	5
transgenic	5
underlying	5
vigorous	5
virologic	5
Ͼ5	5
iterative	5
productive	5
standardized	5
prepared	5
nested	5
longest	5
powerful	5
longitudinal	5
mav-1-infected	5
membranous	5
modified	5
monophyletic	5
necrotic	5
neonatal	5
multi	5
nonpolar	5
nsp14-p250	5
older	5
opportunistic	5
passive	5
pdf-2180	5
peak	5
noncanonical	5
periodate	5
polyadenylated	5
emc12	4
exciting	4
fine	4
federal	4
fat	4
extraintestinal	4
epistemological	4
ex	4
evolved	4
eventual	4
hemorrhagic	4
empirical	4
gnotobiotic	4
magnetic	4
incorrect	4
inhibited	4
institutional	4
instrumental	4
intramuscular	4
juvenile	4
kinetic	4
lactogenic	4
latent	4
male	4
mass	4
meta	4
earliest	4
eastern	4
antiretroviral	4
duplicate	4
distinctive	4
microscopic	4
advanced	4
amphipathic	4
antimycotic	4
arbitrary	4
atomic	4
atrip	4
autopsy	4
bayesian	4
biotinylated	4
bottom	4
calculated	4
categorical	4
cd8	4
co	4
coherent	4
committed	4
confluent	4
congruent	4
cvb3	4
deliberative	4
demographic	4
differentiated	4
digital	4
dipeptidyl	4
metagenomic	4
oligonucleotide	4
molecularbased	4
synergistic	4
radiographic	4
reticular	4
reversible	4
screennc	4
seronegative	4
signal	4
sixth	4
sole	4
sophisticated	4
southern	4
stronger	4
subjective	4
thick	4
pseudo	4
tryptose	4
ubiquitinated	4
ultimate	4
unintended	4
unpaired	4
unprecedented	4
unresolved	4
unsuccessful	4
urinary	4
wider	4
wrong	4
mononuclear	4
rabbit	4
weaker	4
proportional	4
pharmacological	4
negligible	4
prophylactic	4
nasal	4
nonconserved	4
nondomestic	4
nonfat	4
nontoxic	4
occasional	4
overnight	4
paradoxical	4
parasitic	4
ninth	4
physiological	4
powered	4
prime	4
piv5-based	4
prognostic	4
preexisting	4
predominant	4
prepandemic	4
posterior	4
polyphyletic	4
plus	4
plausible	4
il-17a	3
gradual	3
humidified	3
huge	3
hopeful	3
immunologic	3
hmgl	3
histological	3
heparan	3
hemostatic	3
half	3
focused	3
germinal	3
gastroenteritis	3
formic	3
foreign	3
financial	3
fimbriated	3
fibrotic	3
faster	3
extended	3
extant	3
exponential	3
expiratory	3
immunopathological	3
isolated	3
inbred	3
lytic	3
multifunctional	3
eosinophilic	3
moral	3
mockinfected	3
mobile	3
mngs	3
minus	3
metaviromic	3
mediastinal	3
meaningful	3
malignant	3
lsectin	3
infection	3
lateral	3
israeli	3
invariant	3
invaluable	3
intraperitoneal	3
interested	3
inter	3
intensive	3
insoluble	3
inner	3
informal	3
experienced	3
clonal	3
enormous	3
antifibrinolytic	3
brilliant	3
binding	3
bimolecular	3
bi	3
authentic	3
attributable	3
associated	3
aquatic	3
applicable	3
apoptotic	3
apocalyptic	3
anticancer	3
endocytic	3
annual	3
ambiguous	3
allergic	3
alanine	3
actin	3
acetic	3
5-min	3
24-h	3
2-min	3
-independent	3
mutagenized	3
cerebrospinal	3
challenging	3
clearer	3
coated	3
empty	3
durable	3
domesticated	3
disordered	3
devastating	3
deleterious	3
deeper	3
d272e	3
cystic	3
correct	3
coronaviral	3
convergent	3
convenient	3
contrary	3
continued	3
contemporary	3
constructive	3
consecutive	3
concomitant	3
concerted	3
complicated	3
combinatorial	3
collaborative	3
multimode	3
pink	3
mutated	3
syrian	3
unaffected	3
unacceptable	3
ultrastructural	3
ubiquitin	3
truncated	3
triplicate	3
transfected	3
trans	3
thorough	3
thoracic	3
tandem	3
sure	3
simulated	3
suitable	3
successive	3
strongest	3
straightforward	3
square	3
spontaneous	3
spike	3
smooth	3
slow	3
slight	3
situ	3
unannotated	3
unbound	3
uncommon	3
undiscovered	3
nascent	3
worth	3
worst	3
worse	3
voluntary	3
villous	3
venous	3
valid	3
vague	3
v5	3
uroepithelial	3
urban	3
unweighted	3
unspliced	3
unsaturated	3
unrecognized	3
unofficial	3
unmapped	3
unlinked	3
unintentional	3
uninoculated	3
unilluminated	3
unequal	3
singular	3
worldwide	3
simplified	3
paraformaldehyde	3
preferred	3
posttranscriptional	3
polysome	3
polymorphonuclear	3
polymicrobial	3
phosphatidylinositol	3
phosphatebuffered	3
phagocytic	3
pbs-0.05	3
passaged	3
paramyxovirus	3
overrepresented	3
problematic	3
outbred	3
ordinary	3
orange	3
nsp5/6	3
nsp4-mediated	3
ns5	3
np	3
noteworthy	3
nonilluminated	3
sick	3
near	3
presymptomatic	3
normalized	3
procoagulant	3
residual	3
professional	3
shallow	3
scarlet	3
sialic	3
s5a	3
s4a	3
rural	3
rrna	3
retroviral	3
resultant	3
responsive	3
secret	3
reproducible	3
prompt	3
reminiscent	3
profound	3
progressive	3
profile	3
ready	3
recognizable	3
refined	3
reflective	3
profibrotic	3
everyday	2
favorable	2
excellent	2
existing	2
expensive	2
expression	2
extrapulmonary	2
familial	2
farmed	2
faulty	2
flaviviral	2
fibroproliferative	2
fifth	2
fixable	2
flanking	2
flexible	2
fluid	2
foundational	2
front	2
fruitful	2
fusogenic	2
fuzzy	2
european	2
electrophoretic	2
established	2
dpp4-mers	2
diluted	2
gentle	2
diminished	2
discernible	2
discontinuous	2
disparate	2
distal	2
disulfide	2
dorsal	2
doublestranded	2
editorial	2
erythroid	2
effector	2
elderly	2
electrospray	2
electrostatic	2
elusive	2
encephalitic	2
endolysin	2
epidermal	2
epistemic	2
equimolar	2
genotypic	2
immense	2
genuine	2
intellectual	2
immunoprecipitated	2
immunoreactive	2
imperative	2
inadequate	2
inadvertent	2
inappropriate	2
indigenous	2
indistinguishable	2
inexpensive	2
infinite	2
intentional	2
geographical	2
interactive	2
interferoninduced	2
intergenic	2
intermediary	2
ischemic	2
intracecal	2
intramural	2
inverted	2
involved	2
dietary	2
immunohistochemical	2
immunocompetent	2
immature	2
il-17-related	2
german	2
globular	2
glycan	2
goat	2
gold	2
graduate	2
grand	2
granular	2
grna	2
haemophilus	2
handicapped	2
harmful	2
heated	2
heightened	2
hepatic	2
highmannose	2
hiv-1	2
holo	2
humane	2
hybrid	2
ihilic	2
digestive	2
bright	2
dichotomous	2
asymmetric	2
antagonistic	2
anti-	2
antifungal	2
apathogenic	2
approximate	2
aqueous	2
arabian	2
archaeal	2
arterial	2
arthropod	2
atypical	2
bronchointerstitial	2
automated	2
autosampler	2
bacteriological	2
baseline	2
basolateral	2
big	2
bioavailable	2
biomolecular	2
blind	2
blunt	2
analogous	2
alternate	2
alkaline	2
algal	2
-f	2
-mediated	2
-restricted	2
-transformed	2
1-min	2
20-week	2
3-week	2
6sb3ipab	2
80s	2
aberrant	2
abnormal	2
academic	2
accelerated	2
adequate	2
adjunctive	2
adventitious	2
aforementioned	2
aggressive	2
agnostic	2
airtight	2
airway	2
british	2
bulk	2
diabetic	2
crowded	2
conditional	2
conical	2
consequent	2
convoluted	2
corpuscular	2
counterintuitive	2
countless	2
countrywide	2
cov-2-positive	2
cov-2-reactive	2
cryptic	2
c3	2
crystallographic	2
cyanobacterial	2
cytologic	2
daf	2
decreased	2
dedicated	2
defensive	2
definitive	2
descriptive	2
determinant	2
concordant	2
conclusive	2
concerned	2
concentric	2
c3-deficient	2
cambodian	2
capsular	2
cardiac	2
careful	2
cationic	2
causal	2
cd47-treated	2
cecal	2
center	2
cerebral	2
chilled	2
ciliated	2
clean	2
cleaved	2
cognate	2
collective	2
combined	2
compensatory	2
composite	2
conceivable	2
irreversible	2
intolerable	2
justifiable	2
subclinical	2
sialyl	2
simplest	2
slower	2
spatial	2
specimen	2
speculative	2
ssdna	2
stained	2
stainless	2
stimulated	2
subgenomic	2
tive	2
substrate	2
suited	2
superficial	2
suppressive	2
sustainable	2
targeted	2
technological	2
tentative	2
tenuous	2
thermolysin	2
shortest	2
sharp	2
sfbcolonized	2
serine	2
proline	2
proteinaceous	2
pseudotyped	2
pure	2
purple	2
qualitative	2
quasi	2
realistic	2
restrained	2
reticulovesicular	2
retinoic	2
rheumatic	2
risky	2
rough	2
rrt	2
sectional	2
semiliquid	2
senior	2
separable	2
serendipitous	2
serinc5	2
timely	2
tolerant	2
procoagulative	2
virusderived	2
unvaccinated	2
uridylate	2
uropathogenic	2
urothelial	2
uterine	2
vaginal	2
variola	2
vernacular	2
vertical	2
virtual	2
vivo	2
tomographic	2
w114a	2
warm	2
west	2
wildtype	2
willing	2
worthwhile	2
worthy	2
ϩ	2
ϩrna	2
kind	2
unstained	2
unstable	2
unrealistic	2
unproven	2
traceable	2
transendothelial	2
transverse	2
trichloroacetic	2
trifluoroacetic	2
ubiquitous	2
unadjusted	2
unanswered	2
unconventional	2
undeniable	2
undirected	2
unexplored	2
unicellular	2
uniform	2
uninduced	2
unlabeled	2
unlimited	2
unmet	2
unnecessary	2
unpredictable	2
unprocessed	2
profibrinolytic	2
unmodified	2
processive	2
morphological	2
measurable	2
medium	2
metastatic	2
methodological	2
micrornas	2
microvascular	2
mini	2
misleading	2
molar	2
monocyte	2
mosaic	2
narrow	2
mouseadapted	2
mrna	2
multicenter	2
multifocal	2
multivalent	2
murky	2
mutagenic	2
mycolylarabinogalactan	2
myd88	2
myeloid	2
mate	2
mast	2
marine	2
manual	2
kingdom	2
primed	2
knowledgeable	2
laboratoryadapted	2
lacking	2
lamina	2
latest	2
lead	2
legitimate	2
lentiviral	2
lesser	2
leukemic	2
lexiconic	2
llama	2
logistical	2
loose	2
m1	2
macaque	2
malayan	2
malicious	2
mammary	2
narnavirus	2
lymphoid	2
nationwide	2
piv5-gfpimmunized	2
palindromic	2
pasty	2
pathophysiological	2
pcdna3.1-furin	2
peribronchial	2
pertinent	2
pharyngeal	2
phosphatidic	2
phylogenomic	2
pirna	2
plasmin	2
p53	2
pneumococcal	2
pneumonic	2
poly	2
polybasic	2
pr/	2
pregnant	2
premature	2
naïve	2
prevalent	2
preventive	2
paired	2
plastic	2
orogastric	2
nrde	2
neural	2
net	2
optimistic	2
neolithic	2
neurological	2
neutralization	2
newborn	2
noninfectious	2
nonlinear	2
nonparametric	2
nontreated	2
noncovalent	2
nsp4	2
nutritional	2
objective	2
obscure	2
observational	2
oligoadenylate	2
optimal	2
opposing	2
oncogenic	2
fulllength	1
fourth	1
fractionated	1
fragmented	1
friend	1
frustrating	1
gamma-	1
generalizable	1
gaussian	1
gammacoronavirus	1
gammainducible	1
gatccgcgagaactcctctttccctcgagggaaagagg	1
gen	1
foreseeable	1
fortunate	1
fiducial	1
foremost	1
focal	1
favorite	1
feasible	1
gfp)-sinv	1
febrile	1
felid	1
ferrettransmissible	1
fibrous	1
fide	1
filovirus	1
finished	1
finnish	1
flat	1
flavi	1
flex	1
flocculent	1
genus	1
hcv)-infected	1
glacial	1
glandular	1
hazy	1
hcovinduced	1
healthier	1
hemagglutinin	1
hemic	1
herbaceous	1
herbivorous	1
herpesviral	1
heteroaromatic	1
heteroclitic	1
heterotypic	1
heterozygous	1
hev	1
falsifiable	1
hhsn272200800060c	1
hard	1
handheld	1
hairpin	1
gp9	1
glaring	1
glucuronic	1
glutamine	1
glyceraldehyde-3-phosphate	1
glycerol	1
gmp-140	1
granulocytic	1
haemorrhagic	1
granulomatous	1
guttural	1
h.p.t	1
h5n1-infected	1
h7n9	1
haemagglutinin	1
famous	1
electronegative	1
faithful	1
fair	1
efluor710	1
efnb2	1
egfp	1
eif2alpha	1
electrical	1
electronic	1
electrophoresed	1
eligible	1
elite	1
eluted	1
em	1
encouraging	1
endo-	1
endolysosomal	1
endoproteolytic	1
ef	1
eea1	1
educational	1
drastic	1
highquality	1
disserted	1
distilled	1
divalent	1
dntp	1
doubleinactivated	1
dsred2	1
easier	1
dualindexed	1
dubious	1
ductular	1
dutch	1
dynaminmediated	1
earlyinfected	1
engineered	1
english	1
enhancer	1
extramural	1
expert	1
explicit	1
exploitable	1
explorative	1
explosive	1
exquisite	1
extraordinary	1
expected	1
extrinsic	1
faced	1
facsaria	1
factual	1
facultative	1
faint	1
expeditious	1
exocrine	1
enterobacteria	1
epistatic	1
enterotoxin	1
entomopathogenic	1
enveloped	1
enzymelinked	1
eosinophil	1
epidemic	1
eral	1
exhaustive	1
erroneous	1
estimated	1
eua)-approved	1
exanthema	1
exempt	1
exhausted	1
highanimal	1
irrevocable	1
hispanic	1
histolytica	1
inward	1
in~75,000	1
ionexchange	1
ip	1
irdyeconjugated	1
irf-3)mediated	1
irregular	1
disposable	1
iscom	1
ish	1
isocratic	1
isogenic	1
isometric	1
isopropyl-	1
isotopic	1
invisible	1
investigative	1
investigational	1
intraepithelial	1
interleukin-8	1
intermittent	1
interquartile	1
intimate	1
intractable	1
intradermal	1
intragastric	1
inverse	1
intraspecific	1
intratracheal	1
intrepid	1
intricate	1
introductory	1
intronic	1
itive	1
jamaican	1
joint	1
logarithmic	1
lipidmimetic	1
lipolytic	1
lipopoly	1
llysinated	1
localized	1
log(2)-normalized	1
logical	1
lighter	1
longlived	1
looking	1
lost	1
lowly	1
lowtiter	1
lps)-mediated	1
linking-	1
lifelong	1
justified	1
landmark	1
k3l	1
kennel	1
kqcx7lrq	1
labengineered	1
laboratoryacquired	1
laboratoryderived	1
latino	1
licensed	1
layered	1
leftmost	1
leftover	1
legal	1
leucinylleucinylleucinal	1
levivirus	1
intercontinental	1
interassay	1
integrin	1
identifiable	1
hyporesponsive	1
i2000sr	1
i]n	1
ibc/	1
iberian	1
icrobial	1
idiopathic	1
hypersensitive	1
ifit1	1
ifn)-inducible	1
il-17-mediated	1
il-17adependent	1
ilar	1
illegal	1
hypervariable	1
hypergeometric	1
immobilized	1
hrp)-conjugated	1
hku4	1
hmm	1
hmm)-based	1
homologybased	1
host	1
hostile	1
humananimal	1
hyperfucosylated	1
humanitarian	1
humid	1
hydatidiform	1
hymenopteran	1
hypaque	1
hyperbolic	1
imminent	1
immunized	1
instructive	1
inevitable	1
indisputable	1
indo-1	1
industryrelated	1
ineffective	1
inefficient	1
inescapable	1
infant	1
inclusive	1
infrastructural	1
inhalational	1
insectivorous	1
inside	1
insightful	1
instant	1
incongruent	1
inactivated	1
immuno	1
impending	1
immunodeficient	1
immunohistochemistry	1
immunometabolic	1
immunopositive	1
immunoregulatory	1
impartial	1
impor	1
inaccessible	1
imprecise	1
impressive	1
improbable	1
improper	1
imprudent	1
in-	1
disruptive	1
circulativepropagative	1
disease	1
airy	1
antiadhesive	1
antiapoptotic	1
anticipated	1
anticonservative	1
antiinflammatory	1
antiintellectual	1
antimalarial	1
antinuclear	1
antipneumococcal	1
antiscientific	1
antiviraltreated	1
apis	1
appreciable	1
arcane	1
architectural	1
anthroponotic	1
anthropogenic	1
anterograde	1
anatomical	1
als3plaminin	1
ameba	1
amorphous	1
ampicillin	1
anaerobic	1
analogue	1
ancillary	1
anonymous	1
and~100	1
anecdotal	1
anesthetized	1
angular	1
anionic	1
anisotropic	1
arithmetic	1
aromatic	1
arthritogenic	1
bifunctional	1
bat	1
benevolent	1
benign	1
beta	1
bi-	1
bicinchoninic	1
bigger	1
bangladeshi	1
biggest	1
biophysical	1
biosafety	1
biosynthetic	1
biotinpolymerized	1
blinded	1
base	1
bad	1
aseptic	1
audible	1
asm	1
associate	1
atic	1
attainable	1
attenuatedvirus	1
attractive	1
australian	1
bactericidal	1
automatic	1
averse	1
aware	1
awry	1
axenic	1
azathioprinetreated	1
alarming	1
ai106772	1
discriminatory	1
agro	1
13-fold	1
15min	1
17th	1
2-fold	1
20th	1
21st	1
24-hour	1
24th	1
2=-modified	1
2=-specific	1
3-fold	1
3-min	1
3.12eϪ4	1
30-fold	1
3=-modified	1
12-week	1
12-month	1
11-week	1
-ketoacyl	1
-bound	1
-dependent	1
-director	1
-established	1
-g	1
-helical	1
-modeled	1
10th	1
-nitrilotriacetic	1
-other	1
-preliminary	1
-strata	1
-tubulin	1
-unexposed	1
3=-terminal	1
4-fold	1
5-day	1
advantageous	1
activation	1
activitybased	1
adherent	1
adi	1
adjusted	1
adult	1
aerobic	1
acoustic	1
aerosolised	1
aerosolized	1
af594-ev7	1
affymetrix	1
aggregated	1
ago2	1
actionable	1
achievable	1
5-week	1
9-day	1
5=-triphosphate	1
6-week	1
60-year	1
6th	1
8-week	1
80ϩyear	1
9-min	1
acetylgalactosamine	1
9o9tb28h	1
9th	1
abrupt	1
accepted	1
accessed	1
acetylated	1
boas2	1
boas3	1
bona	1
bortezomib	1
cotranslational	1
cov	1
cov-2-naive	1
cov-2-susceptible	1
cov.	1
covering~21	1
cp9	1
cp9-based	1
cross-	1
crossreactive	1
crosssectional	1
cryopreserved	1
crystalized	1
ct	1
culturable	1
costly	1
costeffective	1
correlative	1
copdrelated	1
conspicuous	1
constitutive	1
contaminated	1
contiguous	1
contingent	1
convincing	1
cord-001223	1
corre-	1
cord-001340-kqcx7lrq	1
cord-004469-m2fwefuy	1
cord-252671-uf96jgig	1
cord-274663-zyzgk2z3	1
cord-290297-efo9f7c5	1
coronavi-	1
cultural	1
cultureadaptive	1
curved	1
diarrheal	1
deserving	1
detached	1
determined	1
developed	1
developmental	1
devoted	1
diethyl	1
derivative	1
dig	1
digested	1
dim	1
dimerized	1
dire	1
disabled	1
derived	1
denuded	1
cutaneous	1
debilitating	1
cute	1
cytolytic	1
d225	1
damaging	1
data,~400ϫ	1
ddi	1
deepest	1
densitometric	1
defeatist	1
degraded	1
delayed	1
delicate	1
deltacoronavirus	1
denatured	1
conspecific	1
connective	1
connec	1
cd14	1
cantankerous	1
carboncoated	1
caribbean	1
cautious	1
caveolin	1
ccl-223	1
cd3	1
camelpox	1
cd4	1
cd43/45-mediated	1
cd45ra	1
cd47-associated	1
cd47-like	1
cellspecific	1
canned	1
c5a	1
cervical	1
bsl3	1
bound	1
boxed	1
brightest	1
bronchoalveolar	1
brood	1
brown	1
budding	1
c57bl/10sccr	1
bulged	1
bulky	1
bumble	1
buoyant	1
but-	1
bx41	1
centrifugal	1
cfx	1
conflicting	1
com	1
cognitive	1
cohoused	1
coincident	1
coital	1
colorectal	1
colorimetric	1
commonplace	1
coastal	1
compact	1
complacent	1
concatenated	1
conceptual	1
concrete	1
confirmatory	1
coding	1
coagulative	1
changed	1
chymotrypsin	1
characteristic	1
chemokine	1
chemotactic	1
chi	1
chirascan	1
chromogenic	1
luciferase	1
clustalw	1
cis	1
clinicopathological	1
cloacal	1
clonable	1
clone	1
closeup	1
ltr	1
noncatalytic	1
lumenal	1
semiarbitrary	1
sociometric	1
solitary	1
sore	1
sp8	1
sparse	1
specialized	1
specter	1
spectra	1
spectral	1
spin	1
spinal	1
splenocyte	1
spycep	1
stagnant	1
standalone	1
slippery	1
skillful	1
skilled	1
sim	1
senescent	1
sensible	1
septic	1
seroepidemiological	1
seventh	1
sheep	1
simmunized	1
siv)-infected	1
simultaneous	1
singlestranded	1
siphoviral	1
sirna)-based	1
sirp	1
sitespecific	1
staphylococcal	1
statewide	1
stationary	1
surrogate	1
sucrose	1
super	1
supertyperestricted	1
supportive	1
surgical	1
surprised	1
survival	1
suboptimal	1
sweet	1
swine	1
swiss	1
syndromic	1
synergic	1
syntenic	1
subtle	1
submerged	1
stemloop	1
stray	1
stereochemical	1
steric	1
sticky	1
stim-1	1
strand	1
strategic	1
streptavidinhorseradish	1
subdominant	1
stringy	1
structurebased	1
stuffy	1
stunted	1
stupid	1
subcutaneous	1
semiquantitative	1
selfreported	1
quantifiable	1
selfish	1
reiterative	1
relational	1
releasable	1
reliant	1
remnant	1
renatured	1
replete	1
resemble	1
residue	1
rested	1
restricted	1
restrictive	1
retro	1
retroelement	1
retrograde	1
refractory	1
reductive	1
reduced~100-fold	1
ray	1
questionable	1
quick	1
rab7	1
rab7—inhibited	1
randomised	1
rastransformed	1
reactivity	1
redbrown	1
read	1
realtime	1
reassuring	1
receptormediated	1
reconstructed	1
recorded	1
revised	1
revolutionary	1
rhabdovirus	1
schematic	1
scalable	1
scan	1
scant	1
scarce	1
scary	1
scf)fbxw11-nss	1
scpa	1
saudi	1
scribed	1
sd6	1
seamless	1
secretive	1
secure	1
seldomdocumented	1
savvy	1
saponinderived	1
ribavirin	1
rollicking	1
ribonucleoside	1
ribose-2-o	1
rigid	1
riskbenefit	1
rna/	1
rneasy	1
rostral	1
sample	1
rpef	1
ruffled	1
running	1
runny	1
russian	1
sa27201rs	1
szen	1
talented	1
tannic	1
targetscan	1
untranslated	1
untreatable	1
unvalidated	1
unwise	1
upright	1
upward	1
uranyl	1
usa).coimmunoprecipitation	1
usa).dual	1
used	1
useless	1
usual	1
utmost	1
v1.5	1
v450-anti	1
untested	1
unsupported	1
unstudied	1
unobserved	1
unified	1
unknowable	1
unmerged	1
unnatural	1
unnoticed	1
unobservable	1
unpermeabilized	1
unsafe	1
unphased	1
unprimed	1
unprotected	1
unreacted	1
unrealized	1
unreasonable	1
vacuolar	1
ventral	1
veritable	1
ϭ	1
yearly	1
|log	1
®	1
ϩ)rna	1
ϩ)ssrna	1
Ϫiptg	1
ϳ0	1
workable	1
ϳ60	1
Յ2	1
Ն1	1
Ն1:640	1
؉	1
␤	1
wound	1
wet	1
versatile	1
visual	1
versene	1
vertebrate	1
virgavirus	1
virocentric	1
virusencoded	1
virusspecific	1
vital	1
wellestablished	1
volumetric	1
vp7	1
walled	1
weekly	1
wellaccepted	1
welldescribed	1
unidentified	1
unharmed	1
unfractionated	1
tran-	1
tombuslike	1
topological	1
toxigenic	1
to~8	1
tracellular	1
tractable	1
transcription-1-deficient	1
tlr9	1
transdisciplinary	1
transformed	1
translucent	1
transmembrane	1
transparent	1
trcp1	1
to-8-week	1
tlr7-mediated	1
trehalose	1
th2-biased	1
taxa	1
tbk1	1
tdp-43	1
tenfold	1
tetramer	1
tetrameric	1
th2-dominant	1
thrombotic	1
thawed	1
the~100	1
thicker	1
thickest	1
threefold	1
thrombin	1
treatable	1
tri	1
unfortunate	1
undesirable	1
uncorrelated	1
uncultivable	1
uncultured	1
undefined	1
underresourced	1
undescribed	1
undiluted	1
uncharged	1
undisturbed	1
unelated	1
unethical	1
uneven	1
unfavorable	1
unfeasible	1
uncontrollable	1
uncapped	1
tropical	1
tϭ2	1
troubling	1
trypanosomatid	1
tryptic	1
turbo	1
turreted	1
twofold	1
tϭ3	1
unbeknownst	1
ubiquitinate	1
ubiquitination	1
ulent	1
ultra	1
unambiguous	1
unaware	1
queen	1
quadrupole	1
lymphadenopathyassociated	1
multiplex	1
nitrocellulose	1
nod	1
nominal	1
nonactivated	1
nonannotated	1
nonbacterial	1
noncardiogenic	1
noncleaved	1
nonconservative	1
nonconventional	1
nonenveloped	1
nonenzymatic	1
nonexistent	1
nonhomogeneous	1
nonhospitalized	1
nimble	1
nidoviral	1
nicotinic	1
nanospray	1
multipronged	1
multivariable	1
mx1	1
mycobacteriophage_285	1
n=,n=-tetraacetic	1
nanomolar	1
narnavirus"-like	1
nh4oh	1
negativestranded	1
neu-	1
neuraminidase	1
neuraminidaseinhibitor	1
neutrophilic	1
newer	1
nonimmune	1
nonimmunosuppressed	1
noninternalized	1
nosocomial	1
nonubiquitinated	1
nonviable	1
nonviral	1
nonzero	1
north	1
nosed	1
noticeable	1
nontraditional	1
ns4	1
nsp10	1
nsp10-nsp14	1
nsp14	1
nt	1
nt-647	1
nontranslated	1
nonsyncytial	1
nonlethal	1
nonopsonic	1
nonlymphoid	1
nonmammalian	1
nonmodified	1
nonnegligible	1
nonobese	1
nonobvious	1
nonpermissive	1
nonsevere	1
nonpharmaceutical	1
nonpreferred	1
nonprotective	1
nonpseudotyped	1
nonpulmonary	1
nonsegmented	1
multiplicative	1
multifarious	1