Named entities

This is a table of named entities, their types, and their frequencies from sentences in your study carrel. Use it to search & browse the list to learn more about your study carrel. Please keep in mind that named-entity extraction is not as accurate as more generic parts-of-speech extraction. Unusual results will appear here.

entity	type	frequency
hcq	ORG	7829
covid	ORG	2502
cq	DISEASE	1234
hydroxychloroquine	CHEMICAL	1037
covid 19	ORG	1034
viral	TAXON	891
sars	DISEASE	837
chloroquine	CHEMICAL	790
coronavirus	TAXON	659
infection	DISEASE	641
hydroxychloroquine	PERSON	605
virus	TAXON	561
sars cov 2	ORG	527
azithromycin	CHEMICAL	456
cov	ORG	399
chloroquine	CHEMICAL	310
se	PERSON	254
pneumonia	DISEASE	236
coronavirus	TAXON	235
china	GPE	232
coronavirus disease	DISEASE	220
human	TAXON	215
cq hcq	CHEMICAL	211
lpv	ORG	197
ra	ORG	187
sars cov	ORG	186
death	DISEASE	179
malaria	TAXON	166
un	ORG	159
qt	GPE	159
azi	ORG	158
mice	TAXON	153
azithromycin	CHEMICAL	146
cc	CHEMICAL	144
ecg	ORG	137
iron	CHEMICAL	132
azm	ORG	128
ec	ORG	123
coronavirus disease	DISEASE	123
az	ORG	123
sle	DISEASE	121
viruses	TAXON	120
oxygen	CHEMICAL	120
wuhan	GPE	118
rheumatoid arthritis	DISEASE	118
bias	CHEMICAL	117
lupus erythematosus	DISEASE	115
rna	ORG	114
mers	DISEASE	104
fda	ORG	104
arrhythmias	DISEASE	103
ci	ORG	103
sdra	ORG	97
toxicity	DISEASE	93
inflammation	DISEASE	92
hcq azm	ORG	90
tdp	ORG	87
tnf	ORG	87
lopinavir ritonavir	CHEMICAL	86
critically ill	DISEASE	86
hiv	TAXON	86
ncov	ORG	85
colchicine	CHEMICAL	84
infections	DISEASE	83
humans	TAXON	81
il	ORG	78
hydroxychloroquine hcq	CHEMICAL	77
deaths	DISEASE	77
animal	TAXON	77
mpro	CHEMICAL	75
individuals	TAXON	71
cancer	DISEASE	70
intubación	DISEASE	68
lqt	ORG	66
viral infections	DISEASE	64
diabetes	DISEASE	62
mers cov	ORG	60
el	DISEASE	59
la	GPE	57
mouse	TAXON	56
arrhythmia	DISEASE	56
ifn	ORG	56
tocilizumab	CHEMICAL	55
remdesivir	PERSON	55
italy	GPE	55
sin	TAXON	53
france	GPE	52
hcq az	ORG	51
ivermectin	ORG	51
acute respiratory syndrome coronavirus 2 sars cov	DISEASE	51
pandemia	DISEASE	51
autoimmune diseases	DISEASE	51
vivo	GPE	50
retinopathy	DISEASE	49
viral rna	TAXON	46
glucose	CHEMICAL	46
rmd	ORG	46
ptx	GPE	45
ards	DISEASE	45
india	GPE	45
rheumatic diseases	DISEASE	45
tocilizumab	PERSON	45
lupus	DISEASE	45
macrolide	CHEMICAL	45
amci	ORG	44
tcz	CHEMICAL	44
ca	CHEMICAL	44
us	GPE	44
ivermectin	CHEMICAL	44
fever	DISEASE	43
angiotensin	CHEMICAL	43
cardiotoxicity	DISEASE	41
gs	CHEMICAL	41
middle east	LOC	41
lopinavir ritonavir	PERSON	41
respiratory distress syndrome	DISEASE	41
thrombotic	DISEASE	41
ventricular arrhythmia	DISEASE	41
chloroquine cq	CHEMICAL	40
virus	TAXON	40
k	CHEMICAL	40
hydroxychloroquine hcq	ORG	40
gautret	PERSON	40
who	ORG	39
pd	ORG	38
pcr	ORG	38
hyperpigmentation	DISEASE	38
uci	ORG	38
doxycycline	CHEMICAL	38
thrombosis	DISEASE	37
artemisinin	CHEMICAL	37
acute respiratory syndrome	DISEASE	37
viral	TAXON	37
fip	ORG	37
covid19	ORG	37
vitro	GPE	36
nd 4 0 international license it	CHEMICAL	36
hcq azi	ORG	36
respiratory syndrome	DISEASE	35
cardiomyopathy	DISEASE	35
adenosine	CHEMICAL	34
covs	TAXON	34
chloroquine phosphate	CHEMICAL	34
shock	DISEASE	34
viral infection	DISEASE	34
animals	TAXON	33
nos hcq	PERSON	33
rat	TAXON	32
methotrexate	CHEMICAL	32
respiratory syndrome coronavirus 2 sars	DISEASE	32
rct	ORG	32
li	PERSON	32
infection	DISEASE	32
cardiovascular disease	DISEASE	31
iqr	ORG	31
rbd	DISEASE	31
ate	ORG	31
sepsis	DISEASE	31
tumor necrosis	DISEASE	31
ventricular arrhythmias	DISEASE	31
anakinra	CHEMICAL	30
rats	TAXON	30
fibrosis	DISEASE	30
torsade de pointes	DISEASE	29
ribavirin	CHEMICAL	29
cats	TAXON	29
fbx	ORG	29
tumor	DISEASE	28
myopathy	DISEASE	28
consentimiento	CHEMICAL	28
pneumonia	GPE	28
new york	GPE	28
gs 441 524	CHEMICAL	28
aps	ORG	28
al 2020	PERSON	27
después	DISEASE	27
nucleoside	CHEMICAL	27
favipiravir	CHEMICAL	27
hydroxychloroquine azithromycin	CHEMICAL	26
disminuir	CHEMICAL	26
chloroquine hydroxychloroquine	CHEMICAL	26
pbs	ORG	26
chloroquine phosphate	CHEMICAL	26
the united states	GPE	25
respiratory failure	DISEASE	25
prednisone	CHEMICAL	25
cardiac arrest	DISEASE	25
chloroquine cq	CHEMICAL	25
brazil	GPE	25
icd	ORG	24
cdc	DISEASE	24
crs	ORG	24
lipopolysaccharide	CHEMICAL	24
antiphospholipid	DISEASE	24
retinal toxicity	DISEASE	24
malformations	DISEASE	23
lupus erythematosus sle	DISEASE	23
cough	DISEASE	23
coronavirus pneumonia	DISEASE	23
sars coronavirus infection	DISEASE	23
rpe	ORG	23
kp	PERSON	23
animal	TAXON	23
ii	ORG	22
pbpk	CHEMICAL	22
mhc	ORG	22
h1n1	GPE	22
cholesterol	CHEMICAL	22
bacterial	TAXON	22
cardiac toxicity	DISEASE	22
respiratory syndrome coronavirus	DISEASE	22
diabetes mellitus	DISEASE	22
ensayos	DISEASE	22
hydrogen	CHEMICAL	22
noscapine	CHEMICAL	22
dengue	DISEASE	22
carga	CHEMICAL	21
aspirin	ORG	21
lopinavir	PERSON	21
united states	GPE	21
desethylchloroquine	CHEMICAL	21
heart failure	DISEASE	21
lopinavir	CHEMICAL	21
oseltamivir	CHEMICAL	21
potassium	CHEMICAL	21
ritonavir	CHEMICAL	21
acute respiratory syndrome coronavirus	DISEASE	20
dip	CHEMICAL	20
human	TAXON	20
jak	ORG	20
t2d	ORG	20
uk	GPE	20
renal impairment	DISEASE	20
cardiac complications	DISEASE	20
diabetic	DISEASE	20
myocardial infarction	DISEASE	20
torsades de pointes	DISEASE	20
tumour	DISEASE	20
ventricular tachycardia	DISEASE	20
camas	DISEASE	19
cpe	ORG	19
coronavirus disease	DISEASE	19
meta	ORG	19
plasmodium falciparum	TAXON	19
qrs	ORG	19
spain	GPE	19
vero e6	ORG	19
calcium	CHEMICAL	19
infectious diseases	DISEASE	19
cardiac arrhythmias	DISEASE	19
que	ORG	19
connective tissue diseases	DISEASE	19
systemic lupus erythematosus	DISEASE	19
steroids	CHEMICAL	19
nucleotide	CHEMICAL	19
hydroxychloroquine sulfate	CHEMICAL	19
dexamethasone	CHEMICAL	19
journal	ORG	19
usa	GPE	18
plasmodium	TAXON	18
colchicine	CHEMICAL	18
convalescent	DISEASE	18
ep	ORG	18
gm	ORG	18
lupus	DISEASE	18
pk	ORG	18
acute lung injury	DISEASE	18
sars cov 1	ORG	18
vt	ORG	18
apl	CHEMICAL	18
host	TAXON	18
hyperinflammation	DISEASE	18
rheumatoid arthritis ra	DISEASE	18
toxicities	DISEASE	18
noscapine	ORG	17
ecmo	ORG	17
plasmodium vivax	DISEASE	17
fuerte	PERSON	17
acute respiratory distress syndrome	DISEASE	17
doxycycline	PERSON	17
clinicaltrials	ORG	17
cb	ORG	17
atc	ORG	17
solidarity	ORG	17
sars cov 2 infection	DISEASE	17
disminución	CHEMICAL	17
malarial	TAXON	17
vitamin c	CHEMICAL	17
rheumatic	DISEASE	17
medición	CHEMICAL	17
virus infection	DISEASE	17
la	GPE	17
hypertension	DISEASE	17
hydroxyl	CHEMICAL	17
heparin	CHEMICAL	17
un	ORG	16
crh	PERSON	16
doxy hcq	ORG	16
hcq cq	CHEMICAL	16
iii	ORG	16
igg	ORG	16
las	GPE	16
na	PERSON	16
pk pd	ORG	16
atrial fibrillation	DISEASE	16
zinc	CHEMICAL	16
cardiac death	DISEASE	16
cardiotoxic	DISEASE	16
el grupo	ORG	16
murine	TAXON	16
primaquine	CHEMICAL	16
sialic acid	CHEMICAL	16
the world health organization	ORG	16
autoimmunity	DISEASE	16
iron	ORG	15
sepsis	DISEASE	15
se recomienda	PERSON	15
md	PERSON	15
cardiac injury	DISEASE	15
il 6	ORG	15
covid 19	ORG	15
choudhary sharma	PERSON	15
vero	PERSON	15
breast cancer	DISEASE	15
rheumatic disease	DISEASE	15
coronavirus sars cov	DISEASE	15
coronavirus infections	DISEASE	15
creatinine	CHEMICAL	15
human coronavirus	TAXON	15
infected	DISEASE	15
macrolides	CHEMICAL	15
convalescent	DISEASE	15
steroid	CHEMICAL	15
lys353	CHEMICAL	14
respiratory distress syndrome	DISEASE	14
nadph	CHEMICAL	14
tlr9	PERSON	14
ebov	TAXON	14
bdnf	PERSON	14
bacteria	TAXON	14
aspirin	CHEMICAL	14
diseases	DISEASE	14
coronavirus infection	DISEASE	14
feline	TAXON	14
hypokalemia	DISEASE	14
hypoxia	DISEASE	14
teniendo	DISEASE	14
técnicas	GPE	14
viral genome	TAXON	14
iga	ORG	13
ssz	ORG	13
sc	LOC	13
mox	CHEMICAL	13
mers cov infection	ORG	13
lack	PERSON	13
alanine	CHEMICAL	13
germany	GPE	13
europe	LOC	13
chloroquine hydroxychloroquine	CHEMICAL	13
chloroquine diphosphate	CHEMICAL	13
chikungunya	GPE	13
cme	ORG	13
south korea	GPE	13
lung injury	DISEASE	13
antiphospholipid syndrome	DISEASE	13
tórax	CHEMICAL	13
type 2 diabetes	DISEASE	13
s diseases	DISEASE	13
para	PERSON	13
overdose	DISEASE	13
myocardial injury	DISEASE	13
azithromycin a	CHEMICAL	13
lung inflammation	DISEASE	13
congestive heart failure	DISEASE	13
comorbidity	DISEASE	13
chikungunya	GPE	13
cardiac arrhythmia	DISEASE	13
infectious disease	DISEASE	13
japan	GPE	12
anxiety	DISEASE	12
amino acid	CHEMICAL	12
oatp1a2	CHEMICAL	12
mice	TAXON	12
malaria	TAXON	12
ebola virus	TAXON	12
intracellular	ORG	12
il 1	ORG	12
elf	ORG	12
chronic	ORG	12
cd154	CHEMICAL	12
azithromycin azi	CHEMICAL	12
apl	ORG	12
avian	TAXON	12
chikungunya virus	TAXON	12
metformin	CHEMICAL	12
comité	CHEMICAL	12
área	CHEMICAL	12
zidovudine	CHEMICAL	12
thrombocytopenia	DISEASE	12
myocarditis	DISEASE	12
ml	PERSON	12
respiratory syndrome coronavirus mers	DISEASE	12
infectious peritonitis	DISEASE	12
heart disease	DISEASE	12
dogs	TAXON	12
diarrhea	DISEASE	12
decisión	CHEMICAL	12
corticosteroids	CHEMICAL	12
igiv	ORG	11
viruses	TAXON	11
tabla	DISEASE	11
tlr	PERSON	11
sjs	ORG	11
rdv	ORG	11
postexposure	CHEMICAL	11
methotrexate	PERSON	11
azn	ORG	11
hamp	ORG	11
gmp amp	ORG	11
febuxostat	PERSON	11
diabetes	DISEASE	11
bazett	PERSON	11
angiotensin	CHEMICAL	11
artesunate	CHEMICAL	11
anticuerpos	CHEMICAL	11
acute respiratory failure	DISEASE	11
bradycardia	DISEASE	11
nitric oxide	CHEMICAL	11
ventricular fibrillation	DISEASE	11
vasculitis	DISEASE	11
sudden death	DISEASE	11
rheumatic disorders	DISEASE	11
renal failure	DISEASE	11
quienes	CHEMICAL	11
nucleic acid	CHEMICAL	11
cardiac disease	DISEASE	11
melanin	CHEMICAL	11
estándar	CHEMICAL	11
critically ill covid	DISEASE	11
congenital malformations	DISEASE	11
comorbid	DISEASE	11
cardiovascular death	DISEASE	11
viral proteins	TAXON	11
magnesium	CHEMICAL	11
geleris	PERSON	10
arthritis	DISEASE	10
yang	PERSON	10
saudi arabia	GPE	10
sars cov infection	DISEASE	10
peep	ORG	10
off	CHEMICAL	10
marseille france	GPE	10
autophagy	PERSON	10
dexamethasone	CHEMICAL	10
cancer	DISEASE	10
caly	DISEASE	10
antimalarials	DISEASE	10
anakinra	CHEMICAL	10
adenosine	ORG	10
aag	ORG	10
bats	TAXON	10
azithromycin azm	CHEMICAL	10
rt pcr	ORG	10
bovine	TAXON	10
metabolic syndrome	DISEASE	10
virus type 1	TAXON	10
clínicos	CHEMICAL	10
viral diseases	DISEASE	10
viral carriage	DISEASE	10
respiratory infections	DISEASE	10
rash	DISEASE	10
psoriasis	DISEASE	10
nitazoxanide	CHEMICAL	10
respiratory syndrome coronavirus 2 sars	DISEASE	10
malformation	DISEASE	10
hepatitis b	DISEASE	10
hypoglycemia	DISEASE	10
hydroxyurea	PERSON	10
hydroxyferroquine	CHEMICAL	10
encima	CHEMICAL	10
inflammatory arthritis	DISEASE	10
marseille	GPE	9
mercuro	ORG	9
nih	ORG	9
nitazoxanide	CHEMICAL	9
nos hcq conjugate	CHEMICAL	9
rt	ORG	9
rads	CHEMICAL	9
sprotein	PERSON	9
al 2016	PERSON	9
amines	CHEMICAL	9
atrioventricular block	DISEASE	9
max	ORG	9
moh	ORG	9
chen	PERSON	9
lps	ORG	9
interferon	ORG	9
igm	ORG	9
ipt	ORG	9
hydroxychloroquine azithromycin	CHEMICAL	9
htn	ORG	9
coxiella burnetii	TAXON	9
coxiella	ORG	9
baricitinib	PERSON	9
asinex	ORG	9
atp	ORG	9
amp	ORG	9
ace	ORG	9
baja	GPE	9
autoimmune disease	DISEASE	9
furosemide	CHEMICAL	9
ctp	DISEASE	9
lymphopenia	DISEASE	9
cardiovascular complications	DISEASE	9
virus cell	TAXON	9
sulfonylurea	ORG	9
sodium	CHEMICAL	9
sialic acids	CHEMICAL	9
quinone	CHEMICAL	9
psychiatric	DISEASE	9
phosphate	CHEMICAL	9
ocular toxicity	DISEASE	9
obesity	DISEASE	9
negativos	CHEMICAL	9
marco	CHEMICAL	9
macaques	TAXON	9
positivos	DISEASE	9
long qt syndrome	DISEASE	9
dyspnea	DISEASE	9
información	DISEASE	9
coagulopathy	DISEASE	9
coronary artery disease	DISEASE	9
coronaviruses	TAXON	9
cyclic gmp amp	CHEMICAL	9
chloroquine diphosphate	CHEMICAL	9
enantiomer	CHEMICAL	9
encuentran	CHEMICAL	9
endothelial dysfunction	DISEASE	9
headache	DISEASE	9
infecciones	CHEMICAL	9
results	PERSON	8
nsclc	ORG	8
pca	ORG	8
pentoxifylline	PERSON	8
por	PERSON	8
rmse	ORG	8
respiratory syndrome	DISEASE	8
sjögren s syndrome	DISEASE	8
sct	ORG	8
no	CHEMICAL	8
tp e qt	ORG	8
vincent et al 2005	PERSON	8
wang et al	PERSON	8
al 2017	PERSON	8
nsaid	ORG	8
acv	ORG	8
n	ORG	8
hiv infected	DISEASE	8
hcq chloroquine	CHEMICAL	8
hcq pk	CHEMICAL	8
gi	ORG	8
g6pd deficiency	DISEASE	8
eular	ORG	8
ema	ORG	8
coronavirus covid	DISEASE	8
cheng	PERSON	8
cardiotoxicity	DISEASE	8
calcium	ORG	8
cyp450	GPE	8
bcg	ORG	8
anosmia	DISEASE	8
aminoquinoline	CHEMICAL	8
ra sle	DISEASE	8
asociación	DISEASE	8
hydroxychloroquine a	CHEMICAL	8
asthma	DISEASE	8
virions	TAXON	8
septic shock	DISEASE	8
sarilumab	CHEMICAL	8
ruxolitinib	CHEMICAL	8
respiratory disease	DISEASE	8
racemate	CHEMICAL	8
quien	CHEMICAL	8
nítrico	CHEMICAL	8
multicentre	PERSON	8
man	TAXON	8
los pacientes	ORG	8
inflammatory rheumatic diseases	DISEASE	8
hydroxychloroquine retinopathy	CHEMICAL	8
revisión	CHEMICAL	8
human monocytes	TAXON	8
escalas	CHEMICAL	8
host cell	TAXON	8
atherosclerosis	DISEASE	8
burnetii	TAXON	8
difícil	CHEMICAL	8
enantiomers	CHEMICAL	8
encontraban	CHEMICAL	8
depression	DISEASE	8
existen	CHEMICAL	8
Å	CHEMICAL	8
fever cough	DISEASE	8
fungi	TAXON	8
heart block	DISEASE	8
historia clínica	PERSON	8
new york city	GPE	7
plasma	GPE	7
para	GPE	7
ptx dip	ORG	7
oxa	ORG	7
naadp	ORG	7
niv	ORG	7
mediterranean	LOC	7
n95	ORG	7
recovery	ORG	7
portugal	GPE	7
tropheryma whipplei	TAXON	7
respiratory syndrome coronavirus 2 sars cov	DISEASE	7
shanghai	GPE	7
tlr7	ORG	7
tf	PERSON	7
tp	GPE	7
tropheryma	ORG	7
tumor	DISEASE	7
virus disease	DISEASE	7
acute myocardial infarction	DISEASE	7
lopinavir ritonavir	CHEMICAL	7
lymphopenia	GPE	7
dengue	TAXON	7
hydroxychloroquine sulfate	CHEMICAL	7
hydroxychloroquine a	CHEMICAL	7
anova	ORG	7
africa	LOC	7
artemisinin	PERSON	7
authors	ORG	7
boulware	GPE	7
ctd	ORG	7
dmard	CHEMICAL	7
amoxicillin	GPE	7
eu	ORG	7
egypt	GPE	7
gao	PERSON	7
guangdong province	GPE	7
guo	PERSON	7
h5n1	TAXON	7
hcq azithromycin	CHEMICAL	7
hcv	GPE	7
hiv aids	DISEASE	7
hiv infection	DISEASE	7
hmo	ORG	7
hong kong	GPE	7
horby	PERSON	7
adiponectin	GPE	7
ritonavir	CHEMICAL	7
anemia	DISEASE	7
respiratory illness	DISEASE	7
nausea	DISEASE	7
necesidades	CHEMICAL	7
neutrophil	GPE	7
opacities	DISEASE	7
outbreaks	TAXON	7
para la	PERSON	7
parasitic	TAXON	7
pq8	CHEMICAL	7
presentación	CHEMICAL	7
psychiatric disorders	DISEASE	7
respiratory syndrome coronavirus 2 sars cov	DISEASE	7
mefloquine	CHEMICAL	7
retinol	CHEMICAL	7
rhesus	TAXON	7
rhesus macaque	TAXON	7
tabla	DISEASE	7
tissue damage	DISEASE	7
tomar decisiones	PERSON	7
tumors	DISEASE	7
viral pneumonia	DISEASE	7
vivax	TAXON	7
betulinic acid	CHEMICAL	7
mesylate	CHEMICAL	7
quinine	CHEMICAL	7
lung damage	DISEASE	7
epidemia	DISEASE	7
camp	CHEMICAL	7
lipofuscin	CHEMICAL	7
casos	ORG	7
ceftriaxone	CHEMICAL	7
conduction abnormalities	DISEASE	7
coronavirus 2019 ncov	DISEASE	7
coronavirus covid	DISEASE	7
delirium	DISEASE	7
didanosine	CHEMICAL	7
edema	DISEASE	7
darunavir	CHEMICAL	7
failure	DISEASE	7
hepatitis c	DISEASE	7
hipercapnia	GPE	7
implementación	CHEMICAL	7
influenza	ORG	7
leukopenia	GPE	7
escasez	DISEASE	7
levofloxacin	CHEMICAL	7
liberación	CHEMICAL	7
mmp	ORG	6
psm	ORG	6
ribavirin	CHEMICAL	6
rheumatoid arthritis	DISEASE	6
rmsd	ORG	6
pubmed	ORG	6
nc nd	ORG	6
pd 1	ORG	6
new york state	GPE	6
sars cov mers cov	ORG	6
magnesium	LOC	6
sars cov 2 infection	DISEASE	6
tp e	ORG	6
sars mers	DISEASE	6
sh	ORG	6
salmonella	PERSON	6
sheahan	PERSON	6
stroke	DISEASE	6
tam	ORG	6
tisdale	GPE	6
toll	PERSON	6
torsades de pointes	ORG	6
trump	PERSON	6
washington	GPE	6
ltcf	ORG	6
lee	PERSON	6
arbidol	CHEMICAL	6
korea	GPE	6
death	DISEASE	6
acute respiratory syndrome coronavirus 2	DISEASE	6
ace ii	ORG	6
azt	CHEMICAL	6
bid	ORG	6
cov	ORG	6
cvd	ORG	6
chloroquine hydroxychloroquine	CHEMICAL	6
coagulopathy	PERSON	6
coronavirus infected pneumonia	DISEASE	6
dm	ORG	6
doi	ORG	6
débil	PERSON	6
kawasaki syndrome	DISEASE	6
ebola virus disease	DISEASE	6
esto	LOC	6
favipiravir	ORG	6
hcq azithromycin	ORG	6
hcq sulfate	CHEMICAL	6
hiv 1 infected	DISEASE	6
hrs	ORG	6
healthcare	ORG	6
histoplasma	ORG	6
incidence	PERSON	6
kawasaki disease	DISEASE	6
acute respiratory syndrome sars	DISEASE	6
diálisis	DISEASE	6
al 2014	PERSON	6
lupus erythematosus rheumatoid arthritis	DISEASE	6
melanoma	DISEASE	6
methylprednisolone	CHEMICAL	6
middle east	LOC	6
moxifloxacin	CHEMICAL	6
pss	DISEASE	6
plaque	DISEASE	6
platelet aggregation	DISEASE	6
poisoning	DISEASE	6
primeras	PERSON	6
progresión	DISEASE	6
publicación	CHEMICAL	6
pulmonary embolism	DISEASE	6
pulmonary inflammation	DISEASE	6
pulseless	DISEASE	6
respiratory syndrome coronavirus sars	DISEASE	6
respiratory tract infections	DISEASE	6
rhesus macaques	TAXON	6
rodent	TAXON	6
sea	TAXON	6
sinus bradycardia	DISEASE	6
the preferred reporting items for systematic reviews	ORG	6
trastorno	DISEASE	6
type 2 diabetes mellitus	DISEASE	6
azithromycin az	CHEMICAL	6
vivax malaria	DISEASE	6
mcg ml	PERSON	6
tiempos	CHEMICAL	6
los médicos	GPE	6
dipyridamole	CHEMICAL	6
lactate	CHEMICAL	6
chloroquine chloroquine	CHEMICAL	6
chronic obstructive pulmonary disease	DISEASE	6
complemento	DISEASE	6
confirmación	DISEASE	6
contagio	CHEMICAL	6
coronavirus sars cov 2	ORG	6
coronavirus sars cov 2 infection	DISEASE	6
de	PERSON	6
de la	PERSON	6
diabetes a	DISEASE	6
clasificación	DISEASE	6
hydroxychloroquine chloroquine	CHEMICAL	6
fácil	CHEMICAL	6
estaban	CHEMICAL	6
glucocorticoids	CHEMICAL	6
gaps	DISEASE	6
guinea pig	TAXON	6
flavivirus prm protein	TAXON	6
flares	DISEASE	6
ferritin	GPE	6
febuxostat	CHEMICAL	6
inflammatory diseases	DISEASE	6
sars coronavirus	DISEASE	5
prevalence	ORG	5
russia	GPE	5
retinopathy	DISEASE	5
regimens	ORG	5
rnaaemia	DISEASE	5
results	ORG	5
que	PERSON	5
propofol	CHEMICAL	5
prone	ORG	5
moi	ORG	5
plasmodium gallinaceum	TAXON	5
paracoccidioides brasiliensis	TAXON	5
ps	ORG	5
outcomes	ORG	5
observational study of hydroxychloroquine in hospitalized patients	ORG	5
oms	CHEMICAL	5
nz	ORG	5
nc	GPE	5
mycobacterium	TAXON	5
mortality	DISEASE	5
manejo	CHEMICAL	5
solidarity	ORG	5
whipple s disease	DISEASE	5
sting	PERSON	5
acute q fever	DISEASE	5
arrhythmogenic death	DISEASE	5
mlr	ORG	5
arrhythmic cardiac arrest	DISEASE	5
angiotensin converting	PERSON	5
angiotensin aldosterone	CHEMICAL	5
ammonium chloride	CHEMICAL	5
amino acids	CHEMICAL	5
acute respiratory infection	DISEASE	5
acute kidney injury	DISEASE	5
acute coronary syndrome	DISEASE	5
zika	GPE	5
sy	ORG	5
yao et al 2020	PERSON	5
yao et al	PERSON	5
viral rna	TAXON	5
treg	GPE	5
tocilizumab therapy	PERSON	5
table 1	GPE	5
thp	CHEMICAL	5
t1d	DISEASE	5
systematic	LOC	5
singapore	GPE	5
mmf	ORG	5
favipiravir t 705	ORG	5
lu	PERSON	5
chikungunya virus	TAXON	5
due	ORG	5
di castelnuovo	ORG	5
darunavir	CHEMICAL	5
drv	CHEMICAL	5
doxy	PERSON	5
cryptococcus	ORG	5
creative commons	ORG	5
cox	PERSON	5
coronavirus infections	DISEASE	5
como	PERSON	5
cardiovascular	ORG	5
liu	PERSON	5
cv disease	DISEASE	5
cq phosphate	CHEMICAL	5
ccae	ORG	5
baseline	ORG	5
ba	GPE	5
artemisia	GPE	5
appendix	GPE	5
amx	CHEMICAL	5
a12	LOC	5
bacterial fungal	TAXON	5
durcan	PERSON	5
fv	GPE	5
fe	CHEMICAL	5
g6pd	CHEMICAL	5
laboratory	GPE	5
lv dysfunction	DISEASE	5
kaplan meier	PERSON	5
ku2	PERSON	5
journal	ORG	5
influenza	ORG	5
irb	ORG	5
ida	ORG	5
hypomagnesemia	DISEASE	5
hypertension	DISEASE	5
hydroxychloroquine retinopathy	CHEMICAL	5
hq	ORG	5
hibiscus	ORG	5
hcq hcq	ORG	5
hcq azn	ORG	5
h5n1 virus	TAXON	5
h3n2	TAXON	5
golgi	PERSON	5
grf	ORG	5
gm csf	ORG	5
gc	ORG	5
avian influenza	PERSON	5
hipotensión	DISEASE	5
bat	TAXON	5
metoprolol	CHEMICAL	5
plants	TAXON	5
pathologies	DISEASE	5
pain	DISEASE	5
organ failure	DISEASE	5
organ damage	DISEASE	5
org	ORG	5
nítrico inhalado	TAXON	5
nausea vomiting	DISEASE	5
multiple organ failure	DISEASE	5
mmhg	ORG	5
methotrexate toxicity	CHEMICAL	5
interferon	ORG	5
metas	CHEMICAL	5
mammalian	TAXON	5
malignant ventricular arrhythmias	DISEASE	5
los recursos	ORG	5
los que	GPE	5
los diferentes	GPE	5
lopinavir ritonavir ribavirin	CHEMICAL	5
liver injury	DISEASE	5
ligand	GPE	5
la carga	ORG	5
poliovirus	TAXON	5
porphyrin	CHEMICAL	5
presenten	CHEMICAL	5
quinasa	GPE	5
bioseguridad	CHEMICAL	5
warfarin	CHEMICAL	5
volúmenes	CHEMICAL	5
virus hiv	TAXON	5
viral nucleic acid	CHEMICAL	5
viral envelope	TAXON	5
ventricular hypertrophy	DISEASE	5
ventilatorias	CHEMICAL	5
tyrosine	CHEMICAL	5
toxic myopathy	DISEASE	5
titulación	CHEMICAL	5
the food and drug administration	ORG	5
tamoxifen	CHEMICAL	5
sulfonylureas	CHEMICAL	5
smoking	CHEMICAL	5
shortness of breath	DISEASE	5
retinal damage	DISEASE	5
respiratory distress	DISEASE	5
renally	CHEMICAL	5
recomendaciones	CHEMICAL	5
quinoline	CHEMICAL	5
interferon beta 1b lopinavir ritonavir	CHEMICAL	5
thrombus	DISEASE	5
influenza a	ORG	5
duck	TAXON	5
demanda	DISEASE	5
deberá	DISEASE	5
cyclosporine	CHEMICAL	5
cremación	DISEASE	5
coronavirus infected	DISEASE	5
coronavirus 2019 covid	DISEASE	5
conocer	DISEASE	5
conjunto	CHEMICAL	5
conjugate	CHEMICAL	5
conducción	CHEMICAL	5
cohorte	CHEMICAL	5
clarithromycin	CHEMICAL	5
cisplatin	CHEMICAL	5
cisapride	CHEMICAL	5
chronic diseases	DISEASE	5
chloroquine hydroxychloroquine	CHEMICAL	5
cardiac toxicities	DISEASE	5
cancers	DISEASE	5
camostat	CHEMICAL	5
indicación	CHEMICAL	5
birds	TAXON	5
desethylhydroxychloroquine	CHEMICAL	5
choque	DISEASE	5
el inicio de los síntomas	ORG	5
gastrointestinal symptoms	DISEASE	5
hydroxychlorquine	CHEMICAL	5
elevación	CHEMICAL	5
incluso	DISEASE	5
hydroxychloroquine sulphate	CHEMICAL	5
hydroxychloroquine methotrexate	CHEMICAL	5
human monocytes macrophages	TAXON	5
human macrophages	TAXON	5
human immunodeficiency virus type 1	DISEASE	5
hepatitis a	DISEASE	5
gout	DISEASE	5
hydroxy chloroquine	CHEMICAL	5
establece	CHEMICAL	5
fda	ORG	5
enfermeras	CHEMICAL	5
fueron	ORG	5
emitir	DISEASE	5
estrogen	CHEMICAL	5
endocarditis	DISEASE	5
feline coronavirus	TAXON	5
fever endocarditis	DISEASE	5
formación	CHEMICAL	5
naes	CHEMICAL	4
nae	ORG	4
netherlands	GPE	4
nct04316377	CHEMICAL	4
nhis	ORG	4
np	ORG	4
national institutes of health nih	ORG	4
pangolin cov	ORG	4
non	PERSON	4
newcastle	GPE	4
nipah	TAXON	4
north america	LOC	4
nos	CHEMICAL	4
nrf2	ORG	4
ocular toxicity	DISEASE	4
molina	ORG	4
pangolin	GPE	4
nac	ORG	4
mas	ORG	4
molecular	GPE	4
lupus erythematosus	DISEASE	4
king county	GPE	4
primaquine	CHEMICAL	4
lac	ORG	4
las muestras	LOC	4
le	CHEMICAL	4
long qt	ORG	4
los	GPE	4
map	ORG	4
mitja	CHEMICAL	4
moa	ORG	4
magagnoli	GPE	4
mahévas	CHEMICAL	4
mayaro	GPE	4
mediterranean fever	DISEASE	4
meta analysis	ORG	4
middle east	LOC	4
plasmodium falciparum	TAXON	4
vitamin d	PERSON	4
pubmed embase	PERSON	4
amiodarone	CHEMICAL	4
vina	GPE	4
yan	PERSON	4
acid	CHEMICAL	4
acute respiratory distress syndrome ards	DISEASE	4
al 2013	PERSON	4
al día	PERSON	4
algoritmo	CHEMICAL	4
anaemia	GPE	4
rem	PERSON	4
analgesia	GPE	4
angina	DISEASE	4
antimalarials toxicity	CHEMICAL	4
antiphospholipid syndrome aps	DISEASE	4
arachidonic acid	CHEMICAL	4
aspartate	CHEMICAL	4
kg	PERSON	4
va	GPE	4
tuberculosis	DISEASE	4
tmax	PERSON	4
the world health organization	ORG	4
sa	ORG	4
sae	ORG	4
sars cov 2 cell entry	ORG	4
sars cov 2 s	ORG	4
sars cov	ORG	4
sch	CHEMICAL	4
sic	ORG	4
ss	ORG	4
savarino	PERSON	4
se recomienda que	PERSON	4
si	PERSON	4
sjogren	ORG	4
stevens johnson syndrome	PERSON	4
strongyloides	TAXON	4
tdp	ORG	4
kinetic	PERSON	4
cardiac injury	DISEASE	4
keyaerts	GPE	4
cardiac complications	ORG	4
cns	ORG	4
copd	ORG	4
covid 19 cardiac complications	DISEASE	4
cpr	ORG	4
crp	ORG	4
cv	ORG	4
ca 2	ORG	4
cardiac complications	DISEASE	4
borba	ORG	4
chan	PERSON	4
chloroquine diphosphate	CHEMICAL	4
cholesterol	PERSON	4
cmax	CHEMICAL	4
cochrane	ORG	4
cohortmethod	ORG	4
conti et al 2020	PERSON	4
car	ORG	4
belgium	GPE	4
italia	GPE	4
av block	DISEASE	4
autoimmune rheumatic disorders	DISEASE	4
3 737	CHEMICAL	4
ace angii	PERSON	4
ace inhibitors	CHEMICAL	4
adc	ORG	4
aiptw	ORG	4
arbs	CHEMICAL	4
azi hcq	CHEMICAL	4
by nc nd 4 0	ORG	4
akt	PERSON	4
antimalarial	GPE	4
arnold buckner	PERSON	4
arrhythmias	DISEASE	4
asai	GPE	4
asia	LOC	4
aspergillus fumigatus	TAXON	4
coronavirus pneumonia	DISEASE	4
corticosteroid	PERSON	4
covid19estimationhydroxychloroquine	PERSON	4
harapan	GPE	4
guangdong	GPE	4
h2o	CHEMICAL	4
hbv	PERSON	4
hcq 9	ORG	4
hcq mox	CHEMICAL	4
hhs	ORG	4
hiv 1	TAXON	4
health commission of	ORG	4
cpg	ORG	4
hepg2	ORG	4
huang	PERSON	4
hydroxychloroquine sulfate	CHEMICAL	4
imv	CHEMICAL	4
iptw	ORG	4
iso	ORG	4
iran	GPE	4
gs 441524	CHEMICAL	4
francisella	PERSON	4
francia	GPE	4
findings	PERSON	4
cryo em	PERSON	4
dc	GPE	4
deben	ORG	4
devaux	PERSON	4
dexmedetomidine	PERSON	4
doi	PERSON	4
eua	ORG	4
epstein barr	PERSON	4
erythematosus	TAXON	4
esta	GPE	4
existen	CHEMICAL	4
fmf	ORG	4
fst	ORG	4
feline	TAXON	4
ferrets	TAXON	4
atherosclerotic	DISEASE	4
challenges	ORG	4
aérea	GPE	4
propone	CHEMICAL	4
parasite	TAXON	4
participación	CHEMICAL	4
pentoxifylline	CHEMICAL	4
pioglitazone	CHEMICAL	4
premature ventricular contractions	DISEASE	4
presenta	GPE	4
presiones	CHEMICAL	4
psoriatic arthritis	DISEASE	4
pandemic disease	DISEASE	4
que puede	ORG	4
rabbits	TAXON	4
relacionado	GPE	4
renal disease	DISEASE	4
resolución	CHEMICAL	4
respiratory complications	DISEASE	4
respiratory infection	DISEASE	4
para que	PERSON	4
pancreatitis	DISEASE	4
mammalian cells	TAXON	4
necrosis	DISEASE	4
mascarilla	CHEMICAL	4
modulación	CHEMICAL	4
multi organ failure	DISEASE	4
mutagenicity	DISEASE	4
myotoxicity	DISEASE	4
más de los siguientes	ORG	4
naproxen	CHEMICAL	4
neuroblastoma	DISEASE	4
oxaliplatin	CHEMICAL	4
neurológicos	CHEMICAL	4
ningún	GPE	4
nucleic acids	CHEMICAL	4
nucleoside nucleotide	CHEMICAL	4
nucleotides	CHEMICAL	4
ocular disease	DISEASE	4
organisms	TAXON	4
respiratory syndrome mers	DISEASE	4
respiratory syndrome coronavirus infection	DISEASE	4
rheumatic diseases hydroxychloroquine	DISEASE	4
viral protein	TAXON	4
transferrin	CHEMICAL	4
trauma	DISEASE	4
tularensis	TAXON	4
una	ORG	4
uric acid	CHEMICAL	4
urticaria	DISEASE	4
viral carriage reduction	DISEASE	4
viremia	DISEASE	4
rheumatologic diseases	DISEASE	4
virus rna	TAXON	4
virus disease	DISEASE	4
virus type 2	TAXON	4
vitamin d	CHEMICAL	4
vivo guinea	GPE	4
whipplei	TAXON	4
xanthine	CHEMICAL	4
tomas	DISEASE	4
tomadas	CHEMICAL	4
tissue injury	DISEASE	4
thrombocytosis	DISEASE	4
rhodopsin	CHEMICAL	4
sarcoidosis	DISEASE	4
siltuximab	CHEMICAL	4
spondylitis	DISEASE	4
sufrimiento	CHEMICAL	4
bacterial infections	DISEASE	4
sulfasalazine	CHEMICAL	4
syncope	DISEASE	4
systemic sclerosis	DISEASE	4
tachypnea	DISEASE	4
teicoplanin	CHEMICAL	4
terfenadine	CHEMICAL	4
the american heart association	ORG	4
the institutional review board irb	ORG	4
the united states food and drug administration adverse event reporting system	ORG	4
mammals	TAXON	4
triphosphate	CHEMICAL	4
macaque	TAXON	4
cutaneous lupus erythematosus	DISEASE	4
considerados	TAXON	4
coronavirus 229e infection	DISEASE	4
coronavirus oc43 infection	DISEASE	4
coronavirus infected pneumonia	DISEASE	4
correlación	TAXON	4
creatine	CHEMICAL	4
crizotinib	CHEMICAL	4
células	TAXON	4
congenital heart disease	DISEASE	4
deben	ORG	4
diarrhea nausea	DISEASE	4
diarrhoea	DISEASE	4
débil	PERSON	4
ebolavirus	TAXON	4
el	ORG	4
emetine	CHEMICAL	4
congenital long qt syndrome	DISEASE	4
conflict	DISEASE	4
entre otros	PERSON	4
cardiaco	DISEASE	4
lupus nephritis	DISEASE	4
bacterium	TAXON	4
berberine	CHEMICAL	4
bundle branch block	DISEASE	4
cgamp	CHEMICAL	4
cada	ORG	4
cardiac malformations	DISEASE	4
cardiovascular diseases	DISEASE	4
concentración	CHEMICAL	4
cefalorraquídeo	CHEMICAL	4
china	GPE	4
chloroquine hcq	CHEMICAL	4
chlorpromazine	CHEMICAL	4
chronic q fever	DISEASE	4
chronic kidney disease	DISEASE	4
civets	TAXON	4
encefalitis	DISEASE	4
cardiovascular	ORG	4
estructura	TAXON	4
kidney failure	DISEASE	4
hypoxemia	DISEASE	4
inflamación	DISEASE	4
influenza like symptoms	DISEASE	4
interferon beta	CHEMICAL	4
ischemic heart disease	DISEASE	4
ketoconazole	CHEMICAL	4
kidney disease	DISEASE	4
lichen planus	DISEASE	4
human viral	TAXON	4
linfopenia	CHEMICAL	4
liver spleen kidney and lung	DISEASE	4
los	GPE	4
los 28	GPE	4
los eventos	GPE	4
expansión	CHEMICAL	4
los medicamentos	GPE	4
hypersensitivity	DISEASE	4
lopinavir 400	CHEMICAL	4
human primates	TAXON	4
homoharringtonine	CHEMICAL	4
human monocyte	TAXON	4
fatigue	DISEASE	4
flavivirus	TAXON	4
fungal	TAXON	4
herpes simplex	DISEASE	4
herpes zoster	DISEASE	4
hidrógeno	DISEASE	4
gangliosides	CHEMICAL	4
ferrets	TAXON	4
human body	TAXON	4
human cells	TAXON	4
human coronavirus 229e	TAXON	4
human immunodeficiency virus hiv	DISEASE	4
horas escenario b	PERSON	4
human immunodeficiency virus infectivity	DISEASE	4
neutrophil	GPE	3
otras	ORG	3
oseltamivir	ORG	3
ocular	ORG	3
orchid	ORG	3
nipah virus	TAXON	3
méditerranée infection	DISEASE	3
nh	ORG	3
ne	GPE	3
nct04341207	GPE	3
mycobacterium tuberculosis	CHEMICAL	3
outcome	ORG	3
nct04321278	CHEMICAL	3
nct04381936	CHEMICAL	3
prio	CHEMICAL	3
oxygen	CHEMICAL	3
pam	ORG	3
pdb	ORG	3
picot	ORG	3
po	GPE	3
ppe	CHEMICAL	3
pandemia covid	CHEMICAL	3
pathogenic	ORG	3
pharmacologic	ORG	3
picot 2020	PERSON	3
plantone	ORG	3
plasma therapy	PERSON	3
mumcu	ORG	3
plasmodium berghei	TAXON	3
plasmodium falciparum malaria	DISEASE	3
murine	ORG	3
leronlimab	ORG	3
muller	PERSON	3
minocycline	ORG	3
jtc	CHEMICAL	3
pompe	LOC	3
janus	CHEMICAL	3
johns hopkins university	ORG	3
ku	ORG	3
kawasaki like disease	DISEASE	3
kim	PERSON	3
kumar clark	PERSON	3
lels	CHEMICAL	3
lrti	ORG	3
la información	CHEMICAL	3
lancet	ORG	3
landewé	ORG	3
lassa	TAXON	3
lisofylline	PERSON	3
liver injury	DISEASE	3
london	GPE	3
longterm	PERSON	3
mers infection	DISEASE	3
mers infections	DISEASE	3
mertk	ORG	3
mip	ORG	3
madrid	GPE	3
maisonnasse	ORG	3
malek	PERSON	3
med doi	PERSON	3
mejora	PERSON	3
mg	CHEMICAL	3
middle east respiratory syndrome	LOC	3
plasmodium yoelii	TAXON	3
savarino et al 2003	PERSON	3
pompe disease	DISEASE	3
por lo	PERSON	3
stata	ORG	3
saccharomyces cerevisiae	TAXON	3
saleh	PERSON	3
se debe	LOC	3
se propone	CHEMICAL	3
servicios	CHEMICAL	3
servicios de medicina intensiva	ORG	3
siemieniuk	CHEMICAL	3
sigma aldrich usa	PERSON	3
sindbis	ORG	3
sindbis virus	TAXON	3
singh	PERSON	3
sjogren s syndrome	DISEASE	3
somer	PERSON	3
sotalol	CHEMICAL	3
springer nature	ORG	3
staphylococcus	LOC	3
stevens johnson	PERSON	3
studies	ORG	3
sun	ORG	3
tac	CHEMICAL	3
tams	CHEMICAL	3
tcr	ORG	3
tf	ORG	3
tfg	ORG	3
tgf	ORG	3
tgn	ORG	3
tgt	ORG	3
interleukin	ORG	3
spss	ORG	3
sle ra	DISEASE	3
sirs	DISEASE	3
revman	ORG	3
presión	CHEMICAL	3
pro bnp	PERSON	3
proarrhythmic syndrome azithromycin	DISEASE	3
pshenichnaya	PERSON	3
qtch	PERSON	3
raas	ORG	3
rco	ORG	3
rox	CHEMICAL	3
ra	ORG	3
ratg13	TAXON	3
rainsford	GPE	3
rdrp	GPE	3
renmin hospital	ORG	3
rheumatic	DISEASE	3
si	ORG	3
rheumatoid arthritis	DISEASE	3
risk	PERSON	3
rosenfeld	PERSON	3
ruxolitinib	PERSON	3
sars cov 2	ORG	3
sars cov 2 covid 19	ORG	3
sars cov 2 infection chloroquine	DISEASE	3
sars cov 2	ORG	3
sars cov 2 infection	DISEASE	3
sars infection	DISEASE	3
sas	ORG	3
sccs	ORG	3
sd	DISEASE	3
israel	GPE	3
comparative	ORG	3
infections	DISEASE	3
borba et al	PERSON	3
borna disease	DISEASE	3
cck8	CHEMICAL	3
chikv	ORG	3
ckd	DISEASE	3
clbbb	ORG	3
corist	DISEASE	3
covid 19 3	ORG	3
covid 19 hcq	ORG	3
covid 19 hydroxychloroquine	ORG	3
crb	ORG	3
caco 2	ORG	3
canada	GPE	3
cardiac toxicity	DISEASE	3
centers for disease control and prevention	ORG	3
chikungunya virus infection	DISEASE	3
chloroquine umifenovir hydroxychloroquine favlplravir	ORG	3
chowdhuri	ORG	3
comorbidity	DISEASE	3
tmprss2	CHEMICAL	3
con	PERSON	3
consentimiento	GPE	3
control de infecciones	ORG	3
coronaviridae	ORG	3
coronavirus covid 19	ORG	3
cov2	ORG	3
creatine	ORG	3
critically ill	DISEASE	3
cryptococcus neoformans	TAXON	3
cyclic gmp amp	ORG	3
borna	TAXON	3
beaumont	GPE	3
immune	LOC	3
bayes	ORG	3
3cl pro protein	TAXON	3
abo	ORG	3
adp	ORG	3
ag	ORG	3
aicar	ORG	3
ap	ORG	3
acidotropic	ORG	3
actualmente	PERSON	3
adicionalmente	GPE	3
aerosol	GPE	3
al	CHEMICAL	3
algeria	GPE	3
alzheimer s disease	DISEASE	3
amiodarone	PERSON	3
ammonium chloride	CHEMICAL	3
amphotericin b	CHEMICAL	3
analysis	GPE	3
angiotensin aldosterone	CHEMICAL	3
animals	TAXON	3
antiphospholipid	LOC	3
asai et al 2020	PERSON	3
asociación	CHEMICAL	3
association of cardiac injury with mortality in hospitalized patients with covid 19	ORG	3
associations	ORG	3
atrial fibrillation	DISEASE	3
bnp	ORG	3
barbosa	PERSON	3
bat	PERSON	3
batcov	CHEMICAL	3
dhl	CHEMICAL	3
dsmb	PERSON	3
diagnosis	GPE	3
dipyridamole	PERSON	3
ha	CHEMICAL	3
hcq amx	CHEMICAL	3
hcq hcq azithromycin	ORG	3
hcq myopathy	CHEMICAL	3
hcq toxicity	CHEMICAL	3
hcqs	ORG	3
hdl	ORG	3
hepes	CHEMICAL	3
hiv protease inhibitors	TAXON	3
hlh	ORG	3
hnf	ORG	3
hepcidin	PERSON	3
herein	PERSON	3
histidine	CHEMICAL	3
histoplasma capsulatum	TAXON	3
hubei	GPE	3
hydroxychloroquine favlplravir	CHEMICAL	3
hydroxychloroquine cardiotoxicity	CHEMICAL	3
hypokalemia	ORG	3
ia	ORG	3
id	DISEASE	3
idu	ORG	3
ifa	ORG	3
ifn beta	CHEMICAL	3
ifnbeta	ORG	3
il 17	ORG	3
iot	CHEMICAL	3
isi	ORG	3
il 1β	CHEMICAL	3
h7n9	GPE	3
h20	CHEMICAL	3
gómez guzmán	PERSON	3
este	PERSON	3
discovery	PERSON	3
documento	CHEMICAL	3
drosophila	GPE	3
dysphagia	ORG	3
eds	ORG	3
emg	ORG	3
emr	PERSON	3
eolia	ORG	3
epm	ORG	3
er	GPE	3
ebolavirus	TAXON	3
epigenetic	LOC	3
epub	PERSON	3
fipv ii	CHEMICAL	3
glucose	CHEMICAL	3
fp402	CHEMICAL	3
fabry	PERSON	3
fluorescence	ORG	3
food and drug administration	ORG	3
furst 1996	LOC	3
g csf	ORG	3
gs 5734	ORG	3
gtp	ORG	3
gzn	ORG	3
galidesivir	PERSON	3
galidesivir noscapine	PERSON	3
garcia cremades	PERSON	3
gautret et al	PERSON	3
tic	CHEMICAL	3
mmwr	ORG	3
tpc1	CHEMICAL	3
los últimos	GPE	3
malaria rheumatoid arthritis ra	DISEASE	3
malarial drug	TAXON	3
malignant arrhythmia	DISEASE	3
mecánicos	CHEMICAL	3
meta	CHEMICAL	3
midazolam	CHEMICAL	3
min	ORG	3
mucolipin	PERSON	3
multiorgan	PERSON	3
muscle toxicity	DISEASE	3
musculoskeletal diseases	DISEASE	3
myopathy hydroxychloroquine	DISEASE	3
myositis	DISEASE	3
neuroinflammation	DISEASE	3
neuromyopathy	DISEASE	3
neuropathy	DISEASE	3
nonhuman	TAXON	3
norma3100	CHEMICAL	3
obesity diabetes	DISEASE	3
oliguria	DISEASE	3
opacity	DISEASE	3
opportunistic	TAXON	3
orthomyxoviruses	TAXON	3
para el manejo	PERSON	3
para el traslado	PERSON	3
para mejorar	PERSON	3
pegylated interferon	CHEMICAL	3
penetración	CHEMICAL	3
pequeña	CHEMICAL	3
lupus erythematosus hydroxychloroquine	DISEASE	3
los siguientes	GPE	3
porphyria cutanea	DISEASE	3
los datos	GPE	3
hypertensive	DISEASE	3
hypotension	DISEASE	3
imidazole	CHEMICAL	3
immunocompromised	DISEASE	3
infarct	DISEASE	3
infectious peritonitis fip	DISEASE	3
infectious peritonitis virus infection	DISEASE	3
inflammatory disorders	DISEASE	3
inflammatory multisystem syndrome	DISEASE	3
influenza a h1n1 infection	DISEASE	3
influenza pneumonia	DISEASE	3
ingresar	GPE	3
injuria	GPE	3
institución	CHEMICAL	3
interferon ifn	CHEMICAL	3
intermedios	CHEMICAL	3
juvenile rheumatoid arthritis	DISEASE	3
ketoamide	CHEMICAL	3
la escala	ORG	3
la estancia	PERSON	3
la mortalidad	PERSON	3
la que	PERSON	3
la terapia	PERSON	3
limpieza	CHEMICAL	3
lopinavir ritonavir lpv	CHEMICAL	3
lopinavir with ritonavir	CHEMICAL	3
los epp	GPE	3
los casos	GPE	3
los cuales	GPE	3
por lo	PERSON	3
pq10	PERSON	3
hydroxychloroquine overdose	CHEMICAL	3
tetrandrine	CHEMICAL	3
the middle east	LOC	3
the pk pd	ORG	3
the u s food and drug administration fda	ORG	3
the world health organization who	ORG	3
thromboembolic	DISEASE	3
tomar	ORG	3
torno	CHEMICAL	3
torsade de pointes arrhythmia	DISEASE	3
trabajador	CHEMICAL	3
triaje	DISEASE	3
tuberculosis	DISEASE	3
tumour necrosis	DISEASE	3
ulcerative stomatitis	DISEASE	3
urinary defects	DISEASE	3
valvular dysfunction	DISEASE	3
venous thromboembolism	DISEASE	3
ventricular arrythmias	DISEASE	3
vertebrate cells	TAXON	3
videolaringoscopio	DISEASE	3
viral disease	DISEASE	3
viral envelope proteins	TAXON	3
virus cell membrane	TAXON	3
virus membrane	TAXON	3
vomiting	DISEASE	3
y la	PERSON	3
y que	PERSON	3
zanamivir	CHEMICAL	3
zidovudine chloroquine	CHEMICAL	3
trali	ORG	3
the institutional review board	ORG	3
tetracycline	CHEMICAL	3
pregnancy loss	DISEASE	3
temozolomide	CHEMICAL	3
prestador	CHEMICAL	3
primary antiphospholipid syndrome	DISEASE	3
proarrhythmia	DISEASE	3
proguanil	CHEMICAL	3
prostaglandins	CHEMICAL	3
protectora	GPE	3
proteinuria	DISEASE	3
práctica clínica	CHEMICAL	3
que debe	PERSON	3
que genera	PERSON	3
que los pacientes	ORG	3
que reciben	PERSON	3
que recibieron	PERSON	3
quinacrine	CHEMICAL	3
rabies virus	TAXON	3
rat hepatocytes	TAXON	3
renal insufficiency	DISEASE	3
respiratory insufficiency	DISEASE	3
rheumatic autoimmune diseases	DISEASE	3
rheumatoid arthritis hydroxychloroquine	DISEASE	3
rifampicin	CHEMICAL	3
seizure	DISEASE	3
situación	CHEMICAL	3
stroke	DISEASE	3
superoxide	CHEMICAL	3
swab pcr	PERSON	3
síntoma	GPE	3
tachyarrhythmia	DISEASE	3
tandem	ORG	3
hydroxychloroquine sulfate hydroxychloroquine	CHEMICAL	3
stomatitis	DISEASE	3
hydroxychloroquine hydroxychloroquine	CHEMICAL	3
acute respiratory syndrome coronavirus sars cov	DISEASE	3
al 2012	PERSON	3
al 2015	PERSON	3
al manejo	PERSON	3
alcohol	CHEMICAL	3
allergy	DISEASE	3
ammonia	GPE	3
amodiaquine	CHEMICAL	3
angiotensin ii	PERSON	3
annexin	CHEMICAL	3
anorexia	DISEASE	3
anthracis	TAXON	3
antihistamine	CHEMICAL	3
antihistamines	CHEMICAL	3
arcsine	CHEMICAL	3
arrhythmogenesis	DISEASE	3
arrythmia	DISEASE	3
atrial tachycardia	DISEASE	3
autoimmune rheumatic diseases	DISEASE	3
azithromycin hcq	CHEMICAL	3
bdmards	ORG	3
bacterial infection	DISEASE	3
beta cell dysfunction	DISEASE	3
biventricular cardiomyopathy	DISEASE	3
bradykinin	CHEMICAL	3
brote	CHEMICAL	3
cardiac diseases	DISEASE	3
cardiovascular morbidity	DISEASE	3
cathepsin b	CHEMICAL	3
cerca	CHEMICAL	3
adverse drug reactions	DISEASE	3
acute respiratory syndrome coronavirus sars	DISEASE	3
chronic hepatitis c	DISEASE	3
actualidad	CHEMICAL	3
trpml1	CHEMICAL	3
human immunodeficiency virus type 1 replication	DISEASE	3
taiwan	GPE	3
tdp arrhythmia	DISEASE	3
teicoplanin	LOC	3
the qt interval in patients with sars cov	ORG	3
the united states food and drug administration	ORG	3
thrombotic	DISEASE	3
torsades de pointes	DISEASE	3
trauma	ORG	3
trias pujol	PERSON	3
u s	ORG	3
uci y	ORG	3
umifenovir	PERSON	3
united kingdom	GPE	3
vt vf	ORG	3
virus infection	DISEASE	3
wiv04	CHEMICAL	3
world health organization	ORG	3
wuhan hubei	GPE	3
xtt	ORG	3
xu et al 2016	PERSON	3
yoon	PERSON	3
zika virus	PERSON	3
zika virus	TAXON	3
abdominal pain	DISEASE	3
abnormal coagulation	DISEASE	3
acetaminophen	CHEMICAL	3
acidosis	DISEASE	3
chikungunya virus infection	DISEASE	3
xanthine	PERSON	3
chronic infection	DISEASE	3
endothelial injury	DISEASE	3
erythema	DISEASE	3
escenario	DISEASE	3
establecer	CHEMICAL	3
evalúen	CHEMICAL	3
everolimus	CHEMICAL	3
exacerbations	DISEASE	3
falla	PERSON	3
falla respiratoria	PERSON	3
fatiga	GPE	3
fibrosing diseases	DISEASE	3
fluoroquinolone	CHEMICAL	3
folate	CHEMICAL	3
gp91phox	GPE	3
guanosine	CHEMICAL	3
herg	CHEMICAL	3
heart rhythm problems	DISEASE	3
hemodinámica	LOC	3
heparinas	DISEASE	3
hepatitis	DISEASE	3
hepatitis virus mhv	DISEASE	3
histamine	CHEMICAL	3
horas continuas	PERSON	3
hospitalarios	DISEASE	3
hosts	TAXON	3
https www fda	ORG	3
human coronavirus oc43	TAXON	3
cimetidine	CHEMICAL	3
human ether	TAXON	3
human immunodeficiency virus hiv infection	DISEASE	3
epilepsia	GPE	3
hemophagocytic lymphohistiocytosis	DISEASE	3
end stage renal disease	DISEASE	3
connective tissue disease	DISEASE	3
ddi	CHEMICAL	3
cysteine	CHEMICAL	3
cuentan	CHEMICAL	3
criterio	CHEMICAL	3
corona virus disease	DISEASE	3
connective tissue disorders	DISEASE	3
confirmado	CHEMICAL	3
del medio	PERSON	3
comorbidities disease	DISEASE	3
comodidad	CHEMICAL	3
citalopram	CHEMICAL	3
emociones	CHEMICAL	3
coagulopatía	DISEASE	3
colorectal cancer	DISEASE	3
de los	ORG	3
consideran	CHEMICAL	3
dementia	DISEASE	3
dog	TAXON	3
el grupo de	ORG	3
dyslipidaemia	DISEASE	3
deoxyribonucleic acid	CHEMICAL	3
el grupo de tcz	ORG	3
el pronóstico	GPE	3
dying	DISEASE	3
dry cough	DISEASE	3
diaria	DISEASE	3
desarrollaron	DISEASE	3
depuración	CHEMICAL	3
milan	GPE	2
mouse	TAXON	2
mild	ORG	2
mientras	PERSON	2
microsoft	ORG	2
mol med doi	PERSON	2
microbiology	GPE	2
monalizumab cholroquine	ORG	2
mount sinai	LOC	2
mpro of sars cov 2	ORG	2
mpro nos hcq	PERSON	2
mpro noshcq	PERSON	2
multivariable	ORG	2
multivariate	PERSON	2
murakami	GPE	2
myopathy	DISEASE	2
myokardia	CHEMICAL	2
methods a	ORG	2
mycobacterium avium	TAXON	2
mutagenicity	CHEMICAL	2
microbes	TAXON	2
mcchesney	PERSON	2
metformin	GPE	2
maycotte	PERSON	2
manual	PERSON	2
mao	PERSON	2
marco	CHEMICAL	2
n k d s	PERSON	2
marseille france travel	ORG	2
massachusetts	GPE	2
matched	LOC	2
max super speciality hospital saket	ORG	2
maximum	PERSON	2
mclachlan	PERSON	2
mesylate	CHEMICAL	2
mesh	ORG	2
mechanisms	GPE	2
med sci doi	PERSON	2
medicina	GPE	2
mediterranean fever fmf	DISEASE	2
medrxiv	GPE	2
mefloquine	PERSON	2
melanin	ORG	2
merck	ORG	2
n 7 324	CHEMICAL	2
nipah virus infection	DISEASE	2
n diethyl	ORG	2
nueva york	GPE	2
newcastle disease	DISEASE	2
nidovirales	GPE	2
niemann pick c1 npc1	ORG	2
ningbo	GPE	2
nitric oxide	CHEMICAL	2
no evidence of rapid antiviral clearance or clinical benefit	ORG	2
notably	ORG	2
nucleoside	CHEMICAL	2
nucleoside nucleotide	CHEMICAL	2
nuevas	PERSON	2
namd	ORG	2
o2	CHEMICAL	2
ocss	DISEASE	2
ohdsi	ORG	2
omop	ORG	2
observational	ORG	2
occasional	ORG	2
manejo domiciliario	CHEMICAL	2
orthocoronavirinae	PERSON	2
ondansetron formetrol	PERSON	2
neurological	ORG	2
negative	ORG	2
nebulizador	CHEMICAL	2
national institutes of health covid 19	ORG	2
nc nm ec	ORG	2
nct04260594 nct04255017	PERSON	2
nct04304053	CHEMICAL	2
nct04316377 norwegian coronavirus	PERSON	2
nct04318015 hydroxychloroquine	CHEMICAL	2
nct04333732	CHEMICAL	2
nct04407130 favipiravir	PERSON	2
netosis	ORG	2
nfat	ORG	2
nia	CHEMICAL	2
nk	ORG	2
nme	ORG	2
nnt	ORG	2
npc1	CHEMICAL	2
npt	ORG	2
nsaids	CHEMICAL	2
nafamostat	GPE	2
naicker	PERSON	2
national institute of health nih	ORG	2
mann whitney u	PERSON	2
khan	PERSON	2
malnutrition	DISEASE	2
lc ms ms	ORG	2
kras	PERSON	2
kappa	ORG	2
kardiamobile	ORG	2
kawa covid 19	ORG	2
kawasaki syndrome	ORG	2
keratopathy	PERSON	2
kidney	ORG	2
kr	PERSON	2
lc esi ms ms	ORG	2
ldlcholesterol	ORG	2
malaysia	GPE	2
li	ORG	2
lqts	DISEASE	2
lr	ORG	2
ltec	ORG	2
lumina	CHEMICAL	2
lv	ORG	2
lvef	ORG	2
lassa virus	TAXON	2
lastly	ORG	2
kmg	ORG	2
kd	ORG	2
juan gabriel	PERSON	2
journal of proteome research	ORG	2
inclusion	ORG	2
oseltamivir favipiravir	CHEMICAL	2
indian council of medical research icmr	ORG	2
individuals	TAXON	2
infectious disease	DISEASE	2
inflammation	DISEASE	2
inflammatory bowel disease	DISEASE	2
instituciones	CHEMICAL	2
interactions	ORG	2
interim	ORG	2
introduction	ORG	2
invitrogen	ORG	2
isabella zanella	PERSON	2
iwata yoshikawa	PERSON	2
jak stat	ORG	2
jama epub	PERSON	2
jasp	ORG	2
joquer	ORG	2
js	CHEMICAL	2
legionella pneumophila	TAXON	2
leica	LOC	2
leung	PERSON	2
mdcr	ORG	2
mers cov clinical	ORG	2
mers cov sars cov 1	ORG	2
mers cov infected	DISEASE	2
mers cov por	ORG	2
mis	ORG	2
mn	ORG	2
mpa	ORG	2
mr1811190620	ORG	2
ma	PERSON	2
macfarlane manzel	PERSON	2
macroautophagy	PERSON	2
macrolide	CHEMICAL	2
macrolides azole	ORG	2
madjid	GPE	2
maes	PERSON	2
mahanta	GPE	2
mahevas	ORG	2
mahevas tran	PERSON	2
malawi	ORG	2
mem	ORG	2
mdcd new england institutional review board irb	ORG	2
levine	PERSON	2
mcl	CHEMICAL	2
li et al 2007	PERSON	2
lichen	GPE	2
lidocaine	GPE	2
likelihood	GPE	2
lipinski	GPE	2
lipofuscin	GPE	2
lodoco2	ORG	2
loehberg	PERSON	2
lombardy	GPE	2
lombardy section italian	ORG	2
lopinavir lpv	PERSON	2
lopinavir ritonavir propofol	PERSON	2
lopinavir ritonavir lpv	CHEMICAL	2
los autores	GPE	2
los dispositivos	LOC	2
low	PERSON	2
lowe	PERSON	2
lupus erythematosus	DISEASE	2
lys353 n	ORG	2
orthomyxoviridae	TAXON	2
south	LOC	2
ototoxicity	ORG	2
sociedad	CHEMICAL	2
shah et al	PERSON	2
sharon	PERSON	2
shi	PERSON	2
shock	DISEASE	2
sialic	ORG	2
sin embargo	ORG	2
single	ORG	2
sjögren s syndrome	DISEASE	2
smith germolec	PERSON	2
sociedad española	CHEMICAL	2
sars pneumonia	DISEASE	2
southern china	LOC	2
spike	ORG	2
sprotein	ORG	2
stille	ORG	2
strengths	PERSON	2
stroke protegido	PERSON	2
sulfonylurea	PERSON	2
swissdock	GPE	2
taco	DISEASE	2
severe acute respiratory syndrome corona virus	ORG	2
septic shock	DISEASE	2
septic	DISEASE	2
se recomienda considerar	PERSON	2
sc similarly	ORG	2
se	DISEASE	2
sfv	TAXON	2
shiv	TAXON	2
sle sle	DISEASE	2
sle disease	DISEASE	2
sle flares	DISEASE	2
snp	CHEMICAL	2
st segment	ORG	2
saket	CHEMICAL	2
saleh et al	PERSON	2
samuel sharmeen	PERSON	2
sanders	ORG	2
sangawa	ORG	2
sarma	LOC	2
sars cov 2 infection covid 19 a	CHEMICAL	2
sattui	CHEMICAL	2
scopus	ORG	2
se necesitan	CHEMICAL	2
tbst	ORG	2
tfh	ORG	2
tfo	CHEMICAL	2
tocilizumab tocilizumab	PERSON	2
torsades de pointes instability	ORG	2
toxicity	DISEASE	2
trichostatin a	CHEMICAL	2
trump s	PERSON	2
twitter facebook	ORG	2
ty	CHEMICAL	2
type 2 diabetes	DISEASE	2
tórax	CHEMICAL	2
u l	ORG	2
ucsf chimera	ORG	2
understandably	ORG	2
unidades coronarias	CHEMICAL	2
universitario de alicante instituto de investigación sanitaria	PERSON	2
uno de los	PERSON	2
vldl	ORG	2
vpm1002	ORG	2
vsv	ORG	2
vt torsade de pointes	ORG	2
iu	GPE	2
toimela	PERSON	2
tleyjeh	CHEMICAL	2
tgtctgaagcagctatggcaac	ORG	2
tizanidine	GPE	2
tip3p	GPE	2
tm	ORG	2
tnfalpha	ORG	2
table 2	ORG	2
tafenoquine	CHEMICAL	2
taiwán	GPE	2
tdp ventricular tachycardia	DISEASE	2
tdp	PERSON	2
the international committee of medical journal editors	ORG	2
vts	DISEASE	2
the lancet infectious diseases	ORG	2
the lancet respiratory medicine clinical	ORG	2
the united states	GPE	2
the world health organization who	ORG	2
theoharides	CHEMICAL	2
therapy	GPE	2
thromboembolic	ORG	2
thrombosis	DISEASE	2
time	ORG	2
sas institute inc cary nc	ORG	2
sars coronavirus infections	DISEASE	2
otro	ORG	2
psychiatric	DISEASE	2
precautionary	GPE	2
preparación	GPE	2
prescrição	ORG	2
presenting characteristics comorbidities	ORG	2
pro	PERSON	2
procalcitonin	CHEMICAL	2
prolonged qt	ORG	2
promover	GPE	2
protección	CHEMICAL	2
pubmed medline	LOC	2
sars coronavirus sars cov	DISEASE	2
pubchem	ORG	2
pubmed cochrane	PERSON	2
q fever endocarditis	DISEASE	2
qsarins	PERSON	2
qt qrs	PERSON	2
qt abnormalities	DISEASE	2
qt syndrome	DISEASE	2
qtcfrh	GPE	2
quinoline	ORG	2
popert 1976	PERSON	2
plasmodium vivax malaria	DISEASE	2
plasmodium knowlesi	TAXON	2
plaquenil	ORG	2
ovid embase	PERSON	2
pac	CHEMICAL	2
pamp	ORG	2
pci	ORG	2
pcrbased	ORG	2
pd 1 αpd 1	ORG	2
pep	CHEMICAL	2
pnt	ORG	2
pp	LOC	2
prisma	PERSON	2
pao	ORG	2
pangolins	CHEMICAL	2
parte	GPE	2
patientsan	PERSON	2
pencivlovir	PERSON	2
pertusati	CHEMICAL	2
peru	GPE	2
pfdhfr	GPE	2
pierre	DISEASE	2
ra nsaid	GPE	2
ra sle ss	ORG	2
rad001	PERSON	2
respiratory syndrome mers	DISEASE	2
retamozo	PERSON	2
retraction hydroxychloroquine	ORG	2
review	ORG	2
rheumatoid arthritis ra	ORG	2
ribavirina el remdesivir	PERSON	2
rickettsia	GPE	2
risch	ORG	2
rosenberg	PERSON	2
roviello	PERSON	2
rubió	DISEASE	2
rönnblom elkon	PERSON	2
sar cov 2	ORG	2
sars cov 2 characterization	ORG	2
sars cov 2 conforti et	ORG	2
sars cov 2 rna	ORG	2
sars cov 2 infection hydroxychloroquine	DISEASE	2
sars cov mers	DISEASE	2
sars cov infections	DISEASE	2
sars coronavirus 2 covid	DISEASE	2
respiratory failure	DISEASE	2
respiratory syndrome coronavirus	DISEASE	2
rd	ORG	2
respiratory failure	DISEASE	2
riq	ORG	2
rtc	ORG	2
radius	PERSON	2
ramachandran	PERSON	2
ramos ruiz	PERSON	2
rangwala et al 2014	PERSON	2
raoult	ORG	2
rapid	PERSON	2
ratikan	PERSON	2
rationale	ORG	2
recientemente	DISEASE	2
recomendaciones	CHEMICAL	2
recovery	ORG	2
remdesivir lopinavir emetine	PERSON	2
remdesivir s	PERSON	2
renin angiotensin	PERSON	2
representan	GPE	2
request	ORG	2
researchgate	ORG	2
immunopathogenesis	GPE	2
azm amiodarone	PERSON	2
itt	ORG	2
cq enantiomers	CHEMICAL	2
covid 19 prevalence	ORG	2
covid 19 pulmonary infection	DISEASE	2
covid 19 safety	ORG	2
covid19 several	ORG	2
covid nineteen	ORG	2
cprd	PERSON	2
cq accordingly hcq	ORG	2
cq hc	CHEMICAL	2
cq hcq cq	CHEMICAL	2
crd42020195886	GPE	2
blasius beutler	PERSON	2
crrt	ORG	2
ctap	ORG	2
ctc	ORG	2
cxr	ORG	2
cyp23a5	GPE	2
cyp2c	CHEMICAL	2
cyp3a	ORG	2
ca2	CHEMICAL	2
cairoli	DISEASE	2
covid 19 neutrophil	ORG	2
covid 19 liver and kidney injuries	ORG	2
covid 19 drug	ORG	2
covid 19 coronavirus disease	DISEASE	2
blocked	PERSON	2
blue	ORG	2
bondeson sundler	PERSON	2
borrelia	GPE	2
borrelia burgdorferi	TAXON	2
borrelia burgdorferi brucella abortus	TAXON	2
brucella	ORG	2
brugada	PERSON	2
caagctcatttcctggtatgac	ORG	2
cac	ORG	2
cad	ORG	2
cath	ORG	2
cd4	GPE	2
cd4 cd8	ORG	2
cddp	ORG	2
cddp crizotinib pd	CHEMICAL	2
cdm	DISEASE	2
covid 19 2	ORG	2
covid 19 cardiac complications	ORG	2
calhr	PERSON	2
calderon	ORG	2
calidad	CHEMICAL	2
china characteristics	ORG	2
chloroquine phosphate	CHEMICAL	2
chloroquine cardiomyopathy	CHEMICAL	2
chloroquine neuromyopathy	PERSON	2
chlorpromazine haloperidol	PERSON	2
chorin	CHEMICAL	2
chorin dai et al 2020	PERSON	2
chorin et al	PERSON	2
chromatographic	ORG	2
chromosomal	ORG	2
cimetidine	ORG	2
clin infect dis doi	PERSON	2
clin med res doi	PERSON	2
clin pharmacol ther doi	PERSON	2
clinical characteristics	ORG	2
colombia	GPE	2
conduction disorders	DISEASE	2
conflicts	ORG	2
cong	PERSON	2
congestive heart failure	DISEASE	2
chloroquine neuromyopathy	PERSON	2
cherabuddi	CHEMICAL	2
california	GPE	2
chen j	PERSON	2
camostat	ORG	2
camostat mesylate	ORG	2
carbillon	ORG	2
cardiac arrhythmias	PERSON	2
cardiac manifestations	PERSON	2
cardiac toxicity	DISEASE	2
cardiovascular disease	DISEASE	2
cardiovascular safety of potential drugs for the treatment of coronavirus disease	ORG	2
cardiovascular disease	DISEASE	2
carmichael	GPE	2
catteau	PERSON	2
cell	PERSON	2
central	ORG	2
characteristics	ORG	2
characteristics of	ORG	2
characteristics of and important lessons from the	ORG	2
charlson	ORG	2
chatre et al	PERSON	2
chemdraw	ORG	2
bleomycin	GPE	2
biomédica de	PERSON	2
control	ORG	2
abd el aziz	PERSON	2
amx amoxicillin	PERSON	2
ana	ORG	2
ap 1	ORG	2
aps hcq	GPE	2
arn	DISEASE	2
asociaciÓn	ORG	2
auc	ORG	2
az pbpk	ORG	2
azi patients	ORG	2
acharya yogesh sayed abida	PERSON	2
bhubaneswar	PERSON	2
acute lung injury	ORG	2
administration of hcq	ORG	2
administration of these two	ORG	2
adult	ORG	2
aim	ORG	2
akademia	DISEASE	2
al farabi cluster	PERSON	2
al kofahi	PERSON	2
al rawi	PERSON	2
amci un	ORG	2
aids	DISEASE	2
aic akaike information criterion 36	ORG	2
aha	DISEASE	2
ventricular	ORG	2
1 2 5033	CHEMICAL	2
1 mcg ml	PERSON	2
1376	DISEASE	2
1740 4398	CHEMICAL	2
2 mcg ml	PERSON	2
3725	CHEMICAL	2
390ms	ORG	2
4 aminoquinoline	CHEMICAL	2
4 aminoquinolines chloroquine hydroxychloroquine	CHEMICAL	2
5 cyclic gmp amp dinucleotide	CHEMICAL	2
6lzg	CHEMICAL	2
7573	DISEASE	2
a systematic review	ORG	2
ab	ORG	2
acc	ORG	2
acei arb	ORG	2
aceis	CHEMICAL	2
ad	DISEASE	2
aleix fabregat	PERSON	2
am j cardiol	ORG	2
aminoquinolines	CHEMICAL	2
asymptomatic contact	PERSON	2
atg7	ORG	2
avian	TAXON	2
azithromycin azi	ORG	2
bame	ORG	2
bbq	ORG	2
bdnf	PERSON	2
bhpr	ORG	2
bnm	ORG	2
background hydroxychloroquine	PERSON	2
balevic et al 2019	PERSON	2
bao yi	PERSON	2
bcell	TAXON	2
bedaquiline lopinavir	PERSON	2
beijing	GPE	2
belouzard et al	PERSON	2
beneficial	ORG	2
betacoronavirus	PERSON	2
bethesda	GPE	2
bevacizumab	CHEMICAL	2
ataque	CHEMICAL	2
association of treatment with hydroxychloroquine or azithromycin with in hospital mortality in patients	ORG	2
amiodarone azi	PERSON	2
association	ORG	2
amodiaquine	CHEMICAL	2
anand	PERSON	2
andersen	ORG	2
andes	LOC	2
anecdotes	ORG	2
aneja et al 2006	PERSON	2
anemia	DISEASE	2
anticoagulantes por	PERSON	2
antihistaminics	ORG	2
antimalaria	GPE	2
antirheumatic therapy actions	ORG	2
anxa5	PERSON	2
aplasia	GPE	2
aralen	ORG	2
arizona	GPE	2
artesunate	CHEMICAL	2
asadi	ORG	2
asinex compound	CHEMICAL	2
assessment of qt	ORG	2
contact	GPE	2
coomes haghbayan	PERSON	2
isth	GPE	2
hcov 229e hcov oc43 hcov nl63	PERSON	2
hcq ssz	PERSON	2
hcq third	ORG	2
hcq chloroquine azm	CHEMICAL	2
hcq ondansetron	CHEMICAL	2
hcq sulphate	CHEMICAL	2
hcq4cov19	CHEMICAL	2
hcqazithromycin	ORG	2
hcs	ORG	2
hcw	ORG	2
hcov oc43 infection	DISEASE	2
fracción	CHEMICAL	2
hcovs	CHEMICAL	2
hdq	ORG	2
herg	ORG	2
hesn	PERSON	2
hfe	PERSON	2
hiv 1 coronavirus	TAXON	2
hiv type 1	TAXON	2
hm hospitales	PERSON	2
hpv	ORG	2
hcq azm forest	ORG	2
hcq 29	ORG	2
hcq 21	ORG	2
hcq 19	ORG	2
frédérique	GPE	2
fulminant myocarditis	DISEASE	2
furst 1996 munster	LOC	2
gcsf	CHEMICAL	2
gea rime committee	ORG	2
gpi	ORG	2
gravy	ORG	2
gamunex c	ORG	2
gastrointestinal	ORG	2
geng et al 2020	PERSON	2
genomic	ORG	2
gln 493 leu	PERSON	2
goldman	PERSON	2
goldman et al 2000	PERSON	2
group rc effect of dexamethasone in hospitalized patients	ORG	2
guillain	DISEASE	2
h2o se	CHEMICAL	2
hae	DISEASE	2
hcq 100	ORG	2
hr1	ORG	2
hrp	ORG	2
htb	CHEMICAL	2
human coronavirus	TAXON	2
hydroxychloroquin	ORG	2
hydroxychloroquin hcq	PERSON	2
hydroxychloroquine lopinavir ritonavir	CHEMICAL	2
hydroxychloroquine for covid 19	ORG	2
hydroxychloroquine hydroxycarbamide	CHEMICAL	2
hydroxychloroquine hydroxyurea	ORG	2
hydroxychloroquine neuromyotoxicity	CHEMICAL	2
hydroxychloroquine sulphate	CHEMICAL	2
hydroxycholoroquine	ORG	2
hypertensive	DISEASE	2
hypoglycemia	PERSON	2
icmje	ORG	2
ifn β	CHEMICAL	2
ifna	CHEMICAL	2
il 1beta	ORG	2
il 2	ORG	2
il1	ORG	2
inn	ORG	2
issn 1740 4398	CHEMICAL	2
hydroxy	PERSON	2
human coronavirus	TAXON	2
hydrosapl	ORG	2
hospitalization	LOC	2
hydroxychloroquine	CHEMICAL	2
hasta el	GPE	2
haładyj	ORG	2
hela	PERSON	2
hev	TAXON	2
healthcare personnel	ORG	2
healthcare workers	ORG	2
healthcare workers hcw	ORG	2
heart failure	DISEASE	2
heart conduction disorders	DISEASE	2
hemorragia	GPE	2
hendra virus	TAXON	2
heparin	ORG	2
hepatitis c	DISEASE	2
his41	CHEMICAL	2
hoarding	DISEASE	2
hodges	PERSON	2
hoechst	ORG	2
hospital	ORG	2
francisella tularensis	TAXON	2
formar	GPE	2
corea	GPE	2
disagreements	DISEASE	2
delphi	ORG	2