key: cord-1048278-zwhe89zr
authors: Perchetti, G. A.; Zhu, H.; Mills, M. G.; Shrestha, L.; Wagner, C.; Bakhash, S. M.; Lin, M. J.; Xie, H.; Huang, M.; Mathias, P. C.; Bedford, T.; Jerome, K.; Greninger, A. L.; Roychoudhury, P.
title: Specific allelic discrimination of N501Y and other SARS-CoV-2 mutations by ddPCR detects B.1.1.7 lineage in Washington State
date: 2021-03-12
journal: nan
DOI: 10.1101/2021.03.10.21253321
sha: eabb89a805a09e136d482e6e3fd1c4fdba131d93
doc_id: 1048278
cord_uid: zwhe89zr

Real-time epidemiological tracking of variants of interest can help limit the spread of more contagious forms of SARS-CoV-2, such as those containing the N501Y mutation. Typically, genetic sequencing is required to be able to track variants of interest in real-time. However, sequencing can take time and may not be accessible in all laboratories. Genotyping by RT-ddPCR offers an alternative to sequencing to rapidly detect variants of concern through discrimination of specific mutations such as N501Y that is associated with increased transmissibility. Here we describe the first cases of the B.1.1.7 lineage of SARS-CoV-2 detected in Washington State by using a combination of RT-PCR, RT-ddPCR, and next-generation sequencing. We screened 1,035 samples positive for SARS-CoV-2 by our CDC-based laboratory developed assay using ThermoFishers multiplex RT-PCR COVID-19 assay over four weeks from late December 2020 to early January 2021. S gene dropout candidates were subsequently assayed by RT-ddPCR to confirm four mutations within the S gene associated with the B.1.1.7 lineage: a deletion at amino acid (AA) 69-70 (ACATGT), deletion at AA 145, (TTA), N501Y mutation (TAT), and S982A mutation (GCA). All four targets were detected in two specimens, and follow-up sequencing revealed a total of 10 mutations in the S gene and phylogenetic clustering within the B.1.1.7 lineage. As variants of concern become increasingly prevalent, molecular diagnostic tools like RT-ddPCR can be utilized to quickly, accurately, and sensitively distinguish more contagious lineages of SARS-CoV-2.

because the FDA emergency use authorization for COVID-19 vaccines in the United parameters. 118

Four sets of primers and probes were designed based on U.K. variant sequence 120 hCoV-19/England/MILK-9E2FE0/2020 (EPI_ISL_581117, collection date 2020-09-21). 121

To check for variation at primer and probe sites, 216 B.1.1.7 sequences were 122 downloaded from GISAID on December 23 rd , 2020, and aligned against the Wuhan-Hu1 123 reference sequence (NC_045512.2) using MAFFT v7.450 within Geneious Prime 124 (https://www.geneious.com) (Supplementary Table 1 ). In addition, a G-block of 490bp 125 was designed that includes four target amplicons. All primer and probes were 126 synthesized by ThermoFisher and the G-block was synthesized by IDT (Coralville, IA, 127 USA). Primers were included at 900 nM and probes were used at 250 nM ACAATCATATGGTTTCCAACCCACTTATGGTGTTGGTTACCAACCATACAGAGTAGT 138 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 

Two multiplex RT-ddPCR reactions per sample were performed in parallel (as 142 outlined in Table 1) wild type clinical nasopharyngeal specimen positive for SARS-CoV-2 was used as a 160 positive control and water was used as no-template negative control. The resulting 161 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) were manually reviewed in addition to automated variant calling within the pipeline. 176

Clade assignment was performed using Nextclade v0.12.0 177 (https://github.com/nextstrain/nextclade). Sequences were deposited to Genbank 178 (accessions pending) and GISAID (EPI_ISL_861730 and EPI_ISL_861731); raw reads 179 were deposited to the NIH's Sequence Read Archive (Bioproject PRJNA610428). 180

Phylogenetic tree construction utilized the Nextstrain pipeline to align sequences, 181 reconstruct maximum-likelihood and time-resolved phylogenetic trees and to infer 182 nucleotide and amino acid substitutions across the phylogeny (26). The specific 183 workflow for this analysis is available at: https://github.com/blab/ncov-wa-build. The tree 184 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review) Means, medians, and the ranges of C T s detected for the S gene, N gene, and 196

ORF1ab targets are characterized in Table 2 . Seven samples were candidates for 197 SGTF, out of a total of 1,035 samples screened for the B.1.1.7 variant. Of these, 5/7 198 had C T s >33.5 for all targets with a mean and median C T of 35.7 and 35.6 for N gene, 199 and C T s 37.8 and 37.5 for ORF1ab, respectively. Two samples however, had strong 200 fluorescent amplification for the N gene and ORF1ab targets, but no S gene 201 amplification (Fig. 2 ). Candidate 1 (55538) had C T s of 23.4 and 23.7 for N gene and 202

ORF1ab targets respectively, without S gene amplification. Candidate 2 (55545) had 203 C T s of 26.7 and 26.4 for N gene and ORF1ab. Consequently, we decided to ddPCR and 204 sequence these specimens. 205

. CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101/2021.03.10.21253321 doi: medRxiv preprint thresholds of all four targets for both sets of RT-ddPCR reactions (Fig. 3) . Amplification 208 characteristics are outlined in Table 3 melting temperature between the wild type and variant sequences for a given target, the 217 probe may show some binding to the wild type sequence as well, but at a lower 218 efficiency than it binds to the variant sequence. In RT-PCR, inefficient binding to the 219 wild type strand is indistinguishable from high-efficiency binding to a lower-220 concentration variant strand. In RT-ddPCR, because individual template strands are 221 amplified in separate droplets, inefficient probe binding can be identified as lower-222 amplitude fluorescence from each droplet. Thus, even an A to T single nucleotide 223 polymorphism such as that present in the N501Y mutation (S1B) is easily 224 distinguishable by RT-ddPCR by screening for droplets with S1B probe amplitude 225 above a threshold of 5,700. 226

We obtained good quality consensus genomes for both samples, with more than 228 20,000X average coverage across the genome (Table 4 ). Both samples were classified 229 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. with sequencing, clinical laboratories can efficiently and quickly identify SGTF 261 specimens that are candidate variants of concern. Helix reported that of the positive 262 COVID-19 tests screened, less than 1% had SGTF, however, of those SGTFs, more 263 than one-third were confirmed B.1.1.7 lineages (35). samples. However, reports indicate that due to B.1.1.7's increased transmissibility, it is 275 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101/2021.03.10.21253321 doi: medRxiv preprint the United States (6, 27, 35, 40) . The large number of genomic mutations associated 277 with B.1.1.7, including single nucleotide polymorphisms (SNPs) A570D, D614G, P681H, 278 T716I, S982A, and D1118H, underscores the need to distinguish these subtle mutations 279 in emerging variants of concern (41). RT-ddPCR is more sensitive than RT-PCR at 280 resolving SNPs, and is better suited for allelic discrimination to differentiate the B.1.1.7 281 lineage or other variants of concern (42-44). The S982A SNP, for instance, is specific 282 for B.1.1.7 lineages, whereas the N501Y mutation is not (40). The S982A SNP is readily 283 detectable using RT-ddPCR, however, would not be distinguishable by RT-PCR. 284

understand new SARS-CoV-2 variants of concern in real-time, RT-ddPCR continues to 286 cement its place in the clinical laboratory armamentarium (15, 17, 26, 41, 45 We gratefully acknowledge the authors and laboratories involved in the generation and 296 deposition of sequencing data, which we obtained via the GISAID Initiative 297 (Supplementary Table 2 ). The authors would also like to thank Victoria Mallett Rachleff 298 for assistance in data deposition. 299 300 301 302 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 Primer and probe sets used in B.1.1.7 genotyping RT-ddPCR assay for SARS-CoV-2 308 variant detection. In the "Sequence" column, the bolded and underlined nucleotides 309 reflect the region of deletion or mutation. For instance, for the probe used in S1A to 310 detect the 69-70 deletion, the sequence ACATGT is inserted between the bolded and 311 underlined thymine and cytoside nucleotides. In the probe used for S1B, a thymine 312 nucleotide is included in place of adenosine at position 18 in the probe sequence. 313

Notably, in S2B, although the mutation is a T to G transversion, the probe sequence is a 314 reverse complement and so is reflected by a cytosine nucleotide at position 17 in the 315 S2B probe sequence. Primers were included at 900 nM and probes were used at 250 316 nM concentrations. . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. Three SARS-CoV-2 specific amplicons, N gene, ORF1ab, and S gene, were targeted 325 with the multiplex RT-PCR ThermoFisher COVID-19 Assay. Over 1,000 samples 326 positive for SARS-CoV-2 were screened for SGTF, with seven candidates having N 327 gene and ORF1ab amplification without S gene detection. Two of these seven 328 candidates were determined to candidates for genotyping by RT-ddPCR and 329 sequencing based on their viral load characteristics (i.e. mean and median C T s> 35.0 330 for all targets detected). Copies per µl RNA for each target amplified in multiplex RT-ddPCR reaction. 337

Parentheticals denote virus copies/mL back-calculated to consider RNA extraction and 338 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101/2021.03.10.21253321 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101/2021.03.10.21253321 doi: medRxiv preprint . CC-BY 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted March 12, 2021. ; https://doi.org/10.1101 https://doi.org/10. /2021 

US case of COVID-19 variant found in Colorado

California Identifies A Case Of Coronavirus Variant First Seen In

Coronavirus Disease 2019 (COVID-19). Cent Dis Control Prev

WHO | SARS-CoV-2 Variant -United Kingdom of Great Britain and Northern 402

World Health Organization

Viral targets for vaccines against COVID-19

SARS-CoV-2 strain lineage

Identification of a novel SARS-CoV-2 Spike 69-70 deletion lineage 435 circulating in the United States

Correspondent EC CNN Senior Medical. Much of US data to catch newest 438 coronavirus variants is several months old

GISAID: Global initiative on sharing all influenza data -440 from vision to reality

Neutralization of N501Y 443 mutant SARS-CoV-2 by BNT162b2 vaccine-elicited sera

Covid-19: Novavax vaccine efficacy is 86% against UK variant 455 and 60% against South African variant

Comparative Performance of SARS-CoV-458

Detection Assays Using Seven Different Primer-Probe Sets and One Assay Kit

Multiplexing 461 primer/probe sets for detection of SARS-CoV-2 by qRT-PCR

Validation of SARS-CoV-2 detection across 465 multiple specimen types

S-468 variant SARS-CoV-2 is associated with significantly higher viral loads in samples 469 tested by ThermoFisher TaqPath RT-QPCR

A statistical framework for SNP calling, mutation discovery, association 476 mapping and population genetical parameter estimation from sequencing data

MAFFT: a novel method for rapid multiple sequence alignment 479 based on fast Fourier transform

Nextstrain: real-time tracking of pathogen evolution

SARS-CoV-2 Variants of Concern | CDC

mRNA-1273 vaccine induces neutralizing antibodies against spike 487 mutants from global SARS-CoV-2 variants

Neutralizing Activity of BNT162b2-Elicited Serum -491

Serum Neutralizing Activity Elicited by 495 mRNA-1273 Vaccine -Preliminary Report

Covid-19: South Africa pauses use of Oxford vaccine after study 497 casts doubt on efficacy against variant

Medicine launches large-scale surveillance of coronavirus variants in Bay 499

Two-step strategy for the identification of SARS-CoV-2 504 variant of concern 202012/01 and other variants with spike deletion H69-V70

Update on the Helix, Illumina surveillance program: B.1.1.7 variant of SARS-517

CoV-2, first identified in the UK, spreads further into the US. Helix. 518 36. The US is way behind on tracking COVID-19 variants

Mutations on COVID-19 diagnostic 520 targets

Presence of mismatches between diagnostic PCR 522 assays and coronavirus SARS-CoV-2 genome

Sequence mismatch in PCR probes may mask the 524 COVID-19 detection in Nepal

Emergence of SARS-CoV-2 B.1.1.7 Lineage -United States

Sequence Analysis of 20,453 SARS-CoV-2 Genomes from the 532

Houston Metropolitan Area Identifies the Emergence and Widespread Distribution 533

Reverse transcriptase droplet digital PCR to identify the 537 emerging vesicular virus Senecavirus A in biological samples

Application of droplet digital PCR to detect the pathogens of infectious diseases

Human Diseases Associated Gene Mutation

Digital PCR provides sensitive 545 and absolute calibration for high throughput sequencing