key: cord-1047934-f6sique5
authors: Oh, Changin; Kim, Yunjeong; Chang, Kyeong-Ok
title: Caspase-Mediated Cleavage of Nucleocapsid protein of a Protease-Independent Porcine Epidemic Diarrhea Virus Strain
date: 2020-05-18
journal: Virus Res
DOI: 10.1016/j.virusres.2020.198026
sha: fd33167c935b1f676c24c293cf5cba6db8dd5a1c
doc_id: 1047934
cord_uid: f6sique5

Porcine epidemic diarrhea virus (PEDV) infection in neonatal piglets can cause up to 100% mortality, resulting in significant economic loss in the swine industry. Like other coronaviruses, PEDV N protein is a nucleocapsid protein and abundantly presents at all stages of infection. Previously, we reported that the N protein of trypsin-independent PEDV 8aa is cleaved during virus replication. In this study, we further investigated the nature of N protein cleavage using various methods including protease cleavage assays with or without various inhibitors and mutagenesis study. We found that PEDV 8aa infection in Vero cells leads to apoptotic cell death, and caspase 6 or 7 can cleave PEDV 8aa N protein at the late stage of the replication. The caspase-mediated cleavage occurs between D(424) and G(425) near the C-terminal of N protein. We also report that both cleaved and uncleaved N proteins are exclusively localized in the cytoplasm of PEDV infected cells.

Porcine epidemic diarrhea virus (PEDV) is an enveloped virus with a single-stranded positive-sense RNA genome of about 30 kb and a member of the genus Alphacoronavirus in the family Coronaviridae (Kocherhans et al., 2001) . PEDV can cause an enteric disease (PED) with high mortality of up to 100% in neonatal piglets. There are at least two genogroups with PEDV with classical genogroup 1 and newly emerging genogroup 2 Jung and Saif, 2015) . Genogroup 1 PEDV has circulated among countries in Europe and Asia since the early 1980s . In 2010, new highly pathogenic Chinese PEDV strains emerged and classified into Genogroup 2 (Li et al., 2012) . The first US outbreak with genogroup 2a PEDV occurred in 2013 (Stevenson et al., 2013) and subsequently in Canada and Mexico (Anastasia et al., 2014; Chen et al., 2014; Pasma et al., 2016) , resulting in the death of 7 million pigs during one year epidemic period (Cima, 2014) . Moreover, there are several reports that the US PEDV strains (genogroup 2) caused outbreaks in European (Grasland et al., 2015; Hanke et al., 2015; Theuns et al., 2015) and Asian countries Lin et al., 2014; Van Diep et al., 2015) , which raised significant economic and public health concerns worldwide (Schulz and Tonsor, 2015) .

Coronavirus genome encodes four major structural proteins including spike (S), envelope (E), membrane (M) and nucleocapsid (N) (Duarte et al., 1994) . Among them, N protein is an abundant structural protein present at all stages of infection. The coronavirus N protein is J o u r n a l P r e -p r o o f composed of multiple domains including N1 (or N-terminal domain), N2 (or C-terminal domain) and N3 with spacers between them (Hurst et al., 2013) . Both N1 and N2 are very basic and interact with viral RNA genome and/or N protein (Hurst et al., 2013) . N3 is the carboxy-terminal part (~45 aa) with an excess of acidic residues and known to interact with M protein (Hurst et al., 2005; Verma et al., 2006) . The primary role of N protein is to act as an essential architecture component in coronavirus assembly through the interactions with N, M and viral RNA (Cavanagh and Cavanaugh, 1997) . In addition to its primary role, N protein appears to perform multiple functions in the viral replication cycle and pathogenesis (McBride et al., 2014) . Some previous research suggests that the N protein correlates with optimal coronavirus RNA transcription and/or replication, by acting as RNA chaperones to assist the template-switching steps (Zúñiga et al., 2007; Zuniga et al., 2010) , and participating in the replicase components for efficient RNA synthesis (Hurst et al., 2013; Hurst et al., 2010) . In several studies, N protein was also shown to be involved in host cell signaling and immune responses to facilitate viral replication (Cao et al., 2015; Xu et al., 2013) .

It was reported that N protein of acute respiratory syndrome coronavirus (SARS-CoV) or transmissible gastroenteritis virus (TGEV) is processed by caspases during apoptotic cell death (Diemer et al., 2008; Eléouët et al., 2000) . The N protein cleavage was implied for playing roles in efficient viral replication and pathogenicity (Diemer et al., 2008; Eléouët et al., 2000) . For PEDV N protein, Jaru-Ampornpan et al. demonstrated that virally-encoded 3C-like protease (3CLpro) cleaves N protein during virus replication and the cleavage is associated with viral adaptation in cell culture (Jaru-Ampornpan et al., 2017) . Previously, we reported two forms of N protein from the protease independent PEDV 8aa strain, while only one form from the protease dependent PEDV KD strains (Kim et al., 2017) . We hypothesized that the two forms of N protein are generated by a post-translational modification by host or cellular protease(s) during the replication of PEDV 8aa strain. Here, we demonstrated that the N protein of PEDV 8aa strain is cleaved by caspases during apoptosis of Vero cells. The PEDV N protein was cleaved by J o u r n a l P r e -p r o o f caspase 6 or 7 between D 424 and G 425 near the C-terminal of N protein. Furthermore, N protein was localized exclusively in the cytoplasm of PEDV infected cells regardless of N protein cleavage. Our results demonstrated characteristics during the replication of PEDV 8aa, which provides valuable information to understanding the PEDV biology.

Viruses, cells, and reagents. The cell culture adapted PEDV US strains (8aa and KD) were propagated in Vero cells without any protease (8aa strain) or in the presence of TPCK-treated trypsin (1 μg/ml) (KD strain) as described previously (Kim et al., 2017) . Vero (ATCC-CCL-81 tm ) cells and HEK 293T cells were obtained from ATCC (Manassas, VA). Vero cells were maintained in Dulbecco's minimal essential medium (DMEM) containing 5% fetal bovine serum (FBS) and antibiotics (chlortetracycline [25 μg/ml], penicillin [250 U/ml], and streptomycin [250 μg/ml]). HEK293T cells were maintained in minimal essential medium (MEM) containing 10% fetal bovine serum (FBS) and the antibiotics. L-1-tosylamide-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin and Leupeptin was purchased from Sigma-Aldrich (St. Louis, MO). Furin inhibitor I was purchased from Cayman (Ann Arbor, MI). Pan-caspase inhibitor, Z-VAD-fmk was purchased from Enzo (Farmingdale, NY). Recombinant human Caspase 3 and 6 were purchased from Millipore (Temecula, CA) and recombinant caspase 7 were purchased from R&D Systems (Minneapolis, MIN). The synthesis of a coronavirus 3CLpro inhibitor, GC376, was previously described (Tiew et al., 2011) . Anti-PEDV polyclonal antibody (Pab) was collected from a pig challenge study previously reported by us (Kim et al., 2017) . A monoclonal antibody (Mab) against PEDV N protein was kindly provided by Dr. Ying Fang (Kansas State University).

Protein identification by mass spectrometry. To confirm whether the double bands from PEDV 8aa in SDS-PAGE are both N proteins, they were analyzed by matrix-assisted laser J o u r n a l P r e -p r o o f desorption/ionization-time of flight (MALDI-TOF) mass spectrometry. Briefly, concentrated 8aa strain was loaded on the SDS-PAGE gel and stained with Coomassie brilliant blue. The two bands that correspond to N protein were cut out separately and sent to Applied Biomics, Inc (Hayward, CA) for MALDI-TOF mass spectrometry study.

To study the kinetics of PEDV N protein synthesis and cleavage, confluent Vero cells were inoculated with PEDV 8aa or KD at an MOI of 0.01 and incubated with or without trypsin (1 μg/ml). Following 24, 36, or 48 h incubation, cells were lysed with Tris-glycine SDS Sample Buffer (Thermo Fisher Scientific, PA) and subjected for the Western blot analysis. To determine the effect of various protease inhibitors on N protein cleavage, Z-VAD-fmk (pan-caspase inhibitor, 100 μM), furin inhibitor I (20 μM), leupeptin (trypsin inhibitor, 20 μM), or mock-medium was added to confluent Vero cells in a 12-well plate, and the cells were then immediately inoculated with PEDV 8aa at an MOI of 0.01. Following 24, 36 or 48 h incubation at 37°C, cells were then lysed with Tris-glycine SDS sample buffer. Cell lysates were resolved by SDS-PAGE (4-12% Tris-glycine gel) and transferred onto nitrocellulose membranes. The membranes were blocked with 5% non-fat milk in phosphatebuffered saline with Tween-20 for 1 h and probed with PEDV Pab antibody followed by horseradish peroxidase(HRP)-conjugated goat anti-swine IgG. Virus proteins were visualized by chemiluminescence reagents (Thermo Fisher Scientific, PA).

inoculated with PEDV 8aa (MOI of 0.01) for 1 h at 37°C in the presence of Z-VAD-fmk (100 μM, 10 μM), or mock (Medium). Following incubation, the plates were washed three times with PBS and replenished with fresh media containing the same concentration of Z-VAD-fmk or mockmedium. After 24 h or 48 h incubation, cells were subjected to three times of freezing and J o u r n a l P r e -p r o o f thawing and PEDV titers were determined by the 50% tissue culture infective dose (TCID 50 ) method (Reed and Muench, 1938) .

Apoptosis assays. Apoptosis in cells was identified using the TdT-mediated dUTP Nick-end labeling (TUNEL) staining according to the manufacturer's protocol(Abcam, MA) or DNA fragmentation assay. Briefly, Vero cells were mock-infected or infected with PEDV 8aa, 8aa with Z-VAD-fmk (100μM), or KD with trypsin(1μg/ml) at an MOI of 1. As a positive control, Vero cells were treated with 1μM of staurosporine. Cells were fixed at 12, 24 or 48 h and treated for 1h at 37°C with the reaction mixture containing terminal deoxynucleotidyl transferase and FITCconjugated digoxigenin-11-UTP for detecting the exposed 3'hydroxyl ends of fragmented nuclear DNA. The cells were then observed using confocal microscopy. Percentage of TUNEL positive cells in images were counted using ImageJ software. To conduct DNA fragmentation assay, Vero cells were inoculated with PEDV 8aa or mock-medium and incubated for 48 h before DNA isolation as described previously (Hinshaw et al., 1994) . Briefly, infected or mocktreated cells were detached with 0.5 ml of detergent buffer (10mM Tris [pH7.4], 5mM EDTA, 0.2%Triton) and incubated on ice for 30 minutes. The cell lysates were centrifuged at 10,000 x g at 4°C for 30 min, and supernatants were used for extraction of DNA with buffered phenol, once with buffered phenol-chloroform, and once with chloroform-isoamyl alcohol (24:1). DNA was ethanol precipitated with 500 mM NaCl and resuspended in 15μl of sterile water. The samples were run on a 2% agarose gel with ethidium bromide.

can cleave N protein, the N gene of PEDV US 8aa strain was cloned into pIRES (Clontech, CA) plasmid. The sequences encoding HA tag was added to the N-or C-terminus of N protein using the primers, 5'-AATTCTCGAGATGTACCCATACGATGTTCCAGATTACGCTGGTGGAGCTT CTGTCAGTTTTCAG-3 and 5'-AATTCTCGAGATGGCTTCTGTCAGTTTTCA-3' for N-terminal J o u r n a l P r e -p r o o f tag; and 5'-AATTCTCGAGATGGCTTCTGTCAGTTTTCAG-3' and 5'-AATTCTCGAGTTAATTT CCTGTGTCGAAGATAGCGTAATCTGGAACATCGTATGGGTATCCACC-3' for C-terminal tag.

The amplified DNA was cloned into the plasmid in the downstream of the CMV promoter and the resulting plasmid was designated as pCI-N-nHA or pCI-N-cHA. The 60-80% confluent 293T cells were transfected with pCI-N-nHA or pCI-N-cHA using Lipofectamine 3000 reagent (Thermo Fisher Scientific, PA) according to the instructions of the manufacturer and incubated for 48h for N protein expression. Following incubation, cell lysates (5 μl) were prepared and incubated with 20 or 2 unit of recombinant human caspase 3, 6 or 7 (1:2 or 1:10, respectively) in the reaction buffer (20 μl) for 2 h at 37°C (Stennicke and Salvesen, 1997) . The samples were then subjected to SDS-PGE using 4-12% Tricine gel (Thermo Fisher Scientific, PA) and the proteins were transferred onto nitrocellulose membranes. The membranes were probed with anti-HA mouse monoclonal antibodies followed by horseradish peroxidase-conjugated antimouse secondary antibody.

Plasmid constructions and mutagenesis assay. First, the cleavage site was determined at the C-terminus using the N protein with HA tag at N-or C-terminal. To determine the exact cleavage site in N protein, four putative cleave sites were selected using the online tool (Cascleave: http://sunflower.kuicr.kyoto-u.ac.jp/~sjn/Cascleave/index.html) (Song et al., 2010) and aspartic acid at four different locations (345, 372, 424, and 427 ) at the C-terminus of pIRES-N-nHA was mutated to glycine using the QuikChange site-directed mutagenesis kit (Agilent, CA). These plasmids carrying each mutation were generated with following primers: for Germany) using a 100x oil-immersion objective lens. The images were processed by Image J software 1.52n (http://imagej.nih.gov/ij/). For the evaluation of colocalization between N protein and nucleus, colocalization analysis was performed using JACoP for ImageJ software. Singlechannel images were thresholded by Costes' auto threshold method and the Manders' split correlation coefficient for colocalization was then determined for each image.

Statistical analysis. The effects of Z-VAD-fmk in PEDV 8aa replication were compared to the Mock treatment using GraphPad Prism (GraphPad Software, La Jolla, CA, USA). Statistical J o u r n a l P r e -p r o o f analysis was performed using the student t-test. P-value of <0.05 was considered as statistically significant. Data were from at least three independent experiments.

The N protein of PEDV 8aa is cleaved during virus replication. We have previously generated two distinct PEDV strains, 8aa and KD by serially passaging a field-isolated US PEDV strain in different culture conditions (Kim et al., 2017) . PEDV 8aa strain shows some distinct characteristics including protease independence, no cell fusion formation, efficient virus replication (viral titers reach over 10 8 TCID 50 /ml), and putative N protein cleavage (Kim et al., 2017) . In this current study, we confirmed that these bands are both N proteins by analyzing the two protein bands at approximately 49 and 47 kDa on an SDS-PAGE gel using MALDI-TOF mass spectrometry (data not shown). Next, we examined the kinetics of N protein cleavage in the cells (cell lysates). The cleaved N protein appeared at 36 and 48 hpi, but not at 24 hpi ( Figure 1A , left lanes). The ratios of the intact(N) and cleaved(N') N protein were approximately 1:1 for both 36 and 48 hpi ( Figure 1A ). In contrast, scarcely detectable cleaved N protein from PEDV KD strain grown in the presence of trypsin (1 μg/ml) was observed only at 48 hpi ( Figure   1A , right lanes). Of note, PEDV KD infection produced extensive cell-fusion and cell lysis after 24 hpi, which resulted in reduced levels of N protein in 36 and 48 hpi ( Figure 1A , right lanes).

N protein cleavage is dependent on the induction of apoptosis. We explored potential protease(s) that can cleave N protein during PEDV 8aa replication using protease inhibitors. As shown in Figure 1B , the N protein cleavage was abolished by the addition of Z-VAD-fmk (36 and J o u r n a l P r e -p r o o f 48 hpi). However, furin or trypsin inhibitors did not block N protein cleavage (Data not shown).

Because activation of the caspase family plays central roles in cellular apoptosis, we analyzed the occurrence of apoptosis in PEDV infected Vero cells using TUNEL staining and DNA fragmentation assay. At 48hpi, 8aa infected cells became TUNEL-positive with a typical cellular feature of apoptosis and the percentage of TUNEL-positive 8aa infected cells was 35%, which was statistically significantly higher than that of mock-treated cells, (Figure 2A did not block N protein cleavage at 36 or 48 hpi ( Figure 6B ). As a positive control, Z-VAD-fmk at 100 µM prevented the N protein cleavage at 36 or 48 hpi ( Figure 6B ).

Because previous studies suggested PEDV N protein was localized in both nucleus and cytoplasm (Shi et al., 2014) , and the nuclear localization of SARS-CoV N protein determined N protein cleavage by caspases (Diemer et al., 2008) , we analyzed the localization of N protein of PEDV 8aa (and KD) with or without Z-VADfmk (100 µM) using the confocal microscopy. With or without Z-VAD-fmk, N protein was exclusively localized in the cytoplasm at 36 hpi of PEDV 8aa ( Figure 7A ). The N protein of PEDV KD (with trypsin) or the expressed N protein were also localized in the cytoplasm at 12 hpi or 36hpi, respectively ( Figure 7A ) (Pearson's coefficient of <0.1). There is a possibility that N enters the nucleus at earlier or later time of infection. In order to test this possibility, we examined cells infected with 8aa or 8aa and Z-VAD-fmk at 12, 24, or 48hpi. PEDV N protein was consistently distributed in the cytoplasm and no detectable nuclear translocation of N protein was observed( Figure 7B ) (Pearson's coefficient of <0.1).

Induction of apoptosis by coronavirus infection and caspase cleavage of N protein by caspases have been reported in TEGV and SARS studies (Diemer et al., 2008; Eléouët et al., 2000) . TGEV N protein is cleaved by caspase 6 and 7 during replication in HRT18 cells, which resulted in 22 amino acid fragment from the C-terminal of N protein (Eléouët et al., 2000) .

SARS-CoV N protein is also cleaved by caspase 6 and potentially by caspase 3, and the J o u r n a l P r e -p r o o f possible cleavage site is located at residues 400 and 403 on the C-terminal of N protein (Diemer et al., 2008) . The biological significance of the virus-induced apoptosis and N protein cleavages is still unclear, but it is suggested to be involved in the pathogenicity (Diemer et al., 2008; Eléouët et al., 2000) . In this study, we demonstrated similar findings to TEGV and SARS mediated apoptosis in protease independent PEDV 8aa strain. The cleaved N band (N') appeared at the late stage (after 36 hpi) of 8aa infection ( Figure 1A ) and required caspase activities because the N' product was abolished by the addition of pan-caspase inhibitor (Z-VAD-fmk) ( Figure 1B ). This cleavage was closely associated with the virus-induced apoptosis evident with TUNEL staining and the DNA fragmentation at 48 hpi ( Figure 2 ). However, the N protein of PEDV KD was barely cleaved during virus replication ( Figure 1A ). Because PEDV KD, a trypsin-dependent strain, causes extensive cell fusion formation with lysis at 24hpi without cellular apoptosis (Figure 2) , there were significant differences in the virus-induced cell death by these two different PEDV strains.

The induction of apoptosis of virus-infected cells raised a discussion of whether apoptosis is favorable to host or virus. In a host defense point of view, apoptosis curtails the use of cellular machinery necessary for viral protein synthesis and facilitates the elimination of viral proteins through caspase-mediated proteolysis, resulting in the reduction of viral replication and spread (Danthi, 2011; Yan et al., 2010) . Thus, viruses in diverse families encode anti-apoptotic proteins (Clem et al., 1991) to limit apoptosis. On the other hand, viruses can take advantage of the apoptosis of host cells to facilitate virus replication. Various viruses have utilized caspases to cleave their viral proteins for successful replication, which is aborted when the caspase cleavage sites on the viral proteins are eliminated (Best et al., 2003; Moody and Laimins, 2009) .

In this study, the replication of 8aa was slightly but significantly increased in the presence of Z-VAD-fmk (Figure 3) , suggesting the apoptosis is not favorable for viruses. Of note, the replication of PEDV KD in the presence of trypsin induced extensive fusions with cell lysis J o u r n a l P r e -p r o o f starting 12 hpi, and the addition of Z-VAD-fmk in the medium did not affect virus replication (data not shown).

We demonstrated that caspase 6 or 7, but not caspase 3, is responsible for the N protein cleavage (Figure 4 ) and the cleave site located at the C-terminal of the PEDV N protein between D 424 /G 425 ( Figure 5 ). This cleavage location is similar to that of TGEV N protein (Eléouët et al., 2000) . This site is located within domain 3 on the PEDV N protein. Because domain 3 is not involved in N-N interaction and RNA binding, the cleavage may not affect these functions of N protein. However, the cleavage resulted in the reduction of 8aa replication ( Figure   3 ) probably because domain 3 interacts with M protein to plays an important role in coronavirus replication (Narayanan et al., 2000) and the N cleavage disrupts the N-M interaction.

Interestingly, we observed that both forms of N proteins were present in the concentrated (purified) PEDV 8aa virus at the ratio of 1:1 (Kim et al., 2017) suggesting that the cleaved form of N protein could still integrate into virions at the similar rates as the uncleaved form.

It was previously reported in a study that PEDV N protein is processed by viral 3CLpro glutamine at the position 382 (P1) and leucine at the position 381 (P2), and this cleavage was speculated to be associated with cell culture adaptation of PEDV (Jaru-Ampornpan et al., 2017) .

In this study, we used a specific 3CLpro inhibitor (GC376) to investigate whether the N protein of PEDV 8aa is cleaved by 3CLpro or not. The treatment of GC376 did not abolish N protein cleavage for PEDV 8aa (Figure 6 ). 3CLpro-mediated N protein cleavage may dependent on the different PEDV strains.

A nucleus localization of N protein has been reported for several coronaviruses including PEDV, TGEV, Murine Hepatitis Virus(MHV), SARS-CoV, and infectious bronchitis virus (IBV) (Diemer et al., 2008; Hiscox et al., 2000; Shi et al., 2014; Wurm et al., 2001) . Shi et al. (Shi et al., 2014) reported nuclear localization of PEDV N protein in Vero E6 cells after transfection with N genes. Amino acid 71-90 region sufficiently mediated nuclear localization of the N protein and R87 and R89 were crucial for its function. This 71-90 region is almost conserved N protein of J o u r n a l P r e -p r o o f 8aa and KD strains with a single mutation (G84-to-A84). The N protein of 8aa and KD also poses two potential nuclear localization signals (NLS) that are composed of "pat 7" NLS sequences at 261-PKKNKSR-267 and 381-PQRKKEK-387. However, during the examination of Vero cells with 8aa, KD infection or N transfection using confocal microscopy, N proteins were exclusively localized in the cytoplasm (Figure 7) . he cytoplasmic localization of N protein was consistently shown when it was examined at different time points for both PEDV 8aa and KD (data not shown). It is possible a minor population of N protein (with or without N protein cleavage) may be localized to the nucleus, and there could be variations among strains. To further elucidate the functional role of N protein and its cleavage, we are currently investigating the cleaved (and uncleaved) N protein in viral assembly and replication.

The authors thank David George for technical assistance. 

Distinct Characteristics and Complex Evolution of PEDV Strains

Caspase cleavage of the nonstructural protein NS1 mediates replication of Aleutian mink disease parvovirus

Porcine epidemic diarrhea virus infection induces NF-κB activation through the TLR2, TLR3 and TLR9 pathways in porcine intestinal epithelial cells

Nidovirales: a new order comprising Coronaviridae and Arteriviridae

Isolation and characterization of porcine epidemic diarrhea viruses associated with the 2013 disease outbreak among swine in the United States

PED virus reinfecting U.S. herds

Prevention of apoptosis by a baculovirus gene during infection of insect cells

Enter the kill zone: Initiation of death signaling during virus entry

Cell Type-Specific Cleavage of Nucleocapsid Protein by Effector Caspases during SARS Coronavirus Infection

Genome Organization of Porcine Epidemic Diarrhoea Virus

The viral nucleocapsid protein of transmissible gastroenteritis coronavirus (TGEV) is cleaved by caspase-6 and -7 during TGEV-induced apoptosis

Complete genome sequence of a porcine epidemic diarrhea s gene indel strain isolated in france in

Comparison of Porcine Epidemic Diarrhea Viruses from Germany and the United States

The coronavirus infectious bronchitis virus nucleoprotein localizes to the nucleolus

Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States

Characterization of a Critical Interaction between the Coronavirus Nucleocapsid Protein and Nonstructural Protein 3 of the Viral Replicase-Transcriptase Complex

A major determinant for membrane protein interaction localizes to the carboxy-terminal domain of the mouse coronavirus nucleocapsid protein

An Interaction between the Nucleocapsid Protein and a Component of the Replicase-Transcriptase Complex Is Crucial for the Infectivity of Coronavirus Genomic RNA

Porcine Epidemic Diarrhea Virus 3C-Like Protease-Mediated Nucleocapsid Processing: Possible Link to Viral Cell Culture Adaptability

Porcine epidemic diarrhea virus infection: Etiology, epidemiology, pathogenesis and immunoprophylaxis

Porcine epidemic diarrhea virus induces caspase-independent apoptosis through activation of mitochondrial apoptosis-inducing factor

Trypsin-independent porcine epidemic diarrhea virus US strain with altered virus entry mechanism

Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence

Outbreak-Related Porcine Epidemic Diarrhea Virus Strains Similar to US Strains, South Korea

New variants of porcine epidemic diarrhea virus

US-Like Strain of Porcine Epidemic Diarrhea Virus Outbreaks in Taiwan

The coronavirus nucleocapsid is a multifunctional protein

Human papillomaviruses activate the ATM DNA damage pathway for viral genome amplification upon differentiation

Characterization of the coronavirus M protein and nucleocapsid interaction in infected cells

Outbreak investigation of porcine epidemic diarrhea in swine in Ontario. The Canadian veterinary journal = La revue veterinaire canadienne

A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT ENDPOINTS12

Intracellular localization of the severe acute respiratory syndrome coronavirus nucleocapsid protein: absence of nucleolar accumulation during infection and after expression as a recombinant protein in vero cells

Assessment of the economic impacts of porcine epidemic diarrhea virus in the United States

Molecular Characterizations of Subcellular Localization Signals in the Nucleocapsid Protein of Porcine Epidemic Diarrhea Virus, Viruses

Biochemical characteristics of caspases-3

Emergence of <i>Porcine epidemic diarrhea virus</i> in the United States: clinical signs, lesions, and viral genomic sequences

Complete genome sequence of a porcine epidemic diarrhea virus from a novel outbreak in belgium

Design, synthesis, and evaluation of inhibitors of Norwalk virus 3C protease

US-like isolates of porcine epidemic diarrhea virus from Japanese outbreaks between

Identification of functionally important negatively charged residues in the carboxy end of mouse hepatitis coronavirus A59 nucleocapsid protein

Localization to the nucleolus is a common feature of coronavirus nucleoproteins, and the protein may disrupt host cell division

Porcine epidemic diarrhea virus N protein prolongs S-phase cell cycle, induces endoplasmic reticulum stress, and up-regulates interleukin-8 expression

Functional analysis of the orf390 gene of the White Spot Syndrome Virus

Coronavirus nucleocapsid protein is an RNA chaperone

Coronavirus Nucleocapsid Protein Facilitates Template Switching and Is Required for Efficient Transcription

We would like to thank David George for technical assistance. This work was supported by NIH Grant, R01 AI130092.