key: cord-1047487-w4vx2ltd
authors: Claude-Taupin, Aurore; Jia, Jingyue; Bhujabal, Zambarlal; Garfa-Traoré, Meriem; Kumar, Suresh; da Silva, Gustavo Peixoto Duarte; Javed, Ruheena; Gu, Yuexi; Allers, Lee; Peters, Ryan; Wang, Fulong; da Costa, Luciana Jesus; Pallikkuth, Sandeep; Lidke, Keith A.; Mauthe, Mario; Verlhac, Pauline; Uchiyama, Yasuo; Salemi, Michelle; Phinney, Brett; Tooze, Sharon A.; Mari, Muriel C.; Johansen, Terje; Reggiori, Fulvio; Deretic, Vojo
title: ATG9A protects the plasma membrane from programmed and incidental permeabilization
date: 2021-07-12
journal: Nat Cell Biol
DOI: 10.1038/s41556-021-00706-w
sha: 1a733316848398befceb3a19dec346360cb1394c
doc_id: 1047487
cord_uid: w4vx2ltd

The integral membrane protein ATG9A plays a key role in autophagy. It displays a broad intracellular distribution and is present in numerous compartments, including the plasma membrane (PM). The reasons for the distribution of ATG9A to the PM and its role at the PM are not understood. Here, we show that ATG9A organizes, in concert with IQGAP1, components of the ESCRT system and uncover cooperation between ATG9A, IQGAP1 and ESCRTs in protection from PM damage. ESCRTs and ATG9A phenocopied each other in protection against PM injury. ATG9A knockouts sensitized the PM to permeabilization by a broad spectrum of microbial and endogenous agents, including gasdermin, MLKL and the MLKL-like action of coronavirus ORF3a. Thus, ATG9A engages IQGAP1 and the ESCRT system to maintain PM integrity.

(Extended Data Fig. 5a ). The HEK293T APEX2-ATG9A cells (Extended Data Figs. 3h and 5b) were treated with digitonin, SLO or GBI followed by APEX2 biotinylation reaction 40, 41 , and ATG9A partners were identified by liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis of the biotinylated proteins (Supplementary Tables 1-9 ,d and Supplementary Tables 1, 3 and 5 ). The increased IQGAP1-ATG9A association during PM damage was confirmed by co-immunoprecipitation (co-IP) experiments ( Fig. 4b and Extended Data Fig. 6a ). FLAG-ATG9A and IQGAP1 colocalized at the PM following treatment with digitonin (Extended Data Fig. 6b,c) . ATG9A and IQGAP1 directly interact, as established in glutathione S-transferase (GST) pulldown assays (Fig. 4c ). In these experiments, GST fusion with full-size ATG9A could not be efficiently expressed, but a GST-ATG9A lacking the last 255 residues of its long carboxy-terminal domain was stable and bound IQGAP1. Recent cryo-EM structures of human ATG9A have revealed the organization of complex cytosolic domains 16, 17, 19 . When we tested cytosolic domains individually, which are adjacent in the three-dimensional cryo-EM structure of ATG9A, they showed a capacity to associate with IQGAP1 in GST pulldown assays (Extended Data Fig. 6d-f ).

IQGAP1 knockdown (Extended Data Fig. 6g ) increased PI uptake (Fig. 4d) and prevented ATG9A translocation to the PM following injury (Extended Data Fig. 6h ). Thus, IQGAP1 controls ATG9A recruitment to the PM during damage. As with ATG9A, IQGAP1 knockdown did not reduce multivesicular body levels, as quantified by LBPA staining (Extended Data Fig. 6i ,j). IQGAP1 responds to Ca 2+ fluxes 42 , and the role of ATG9A protection against PM damage depended on extracellular Ca 2+ (Fig. 1h ). In the absence of Ca 2+ , ATG9A translocation to injured PM and co-IP between ATG9A and IQGAP1 were lost (Extended Data Fig. 6k-n) . Thus, Ca 2+ , IQGAP1 and ATG9A together confer protection against PM damage (Fig. 4e ). Tables 1, 3 , 5, 8 and 10). Proteins from most ESCRT subcomplexes [3] [4] [5] were detected in proximity to ATG9A, including TSG101 and ALIX (also known as PDCD6IP) (Supplementary Tables 8-10) . These data suggest a previously unappreciated property of ATG9A to associate with multiple ESCRT components. We confirmed that ATG9A interacts with TSG101 and the ALIX V domain in co-IP assays ( Fig. 5a and Extended Data Figs. 6a and 7a,b). Interactions between APEX2-ATG9A and endogenous TSG101 and ALIX were additionally assessed in a modified proximity biotinylation assay, which consisted of affinity purification on avidin beads of APEX2 proximity-biotinylated proteins and their detection by western blotting (BioWeB assay; Fig. 5b ). Using BioWeB, we observed that endogenous TSG101 (Fig. 5c,d) , but not ALIX (Extended Data Fig. 7c ), was enriched in the vicinity of ATG9A in HEK293T APEX2-ATG9A cells subjected to PM damage. The TSG101 enrichment in co-IP and BioWeB assays with ATG9A reflects, at least in part, an increased association of IQGAP1 with ATG9A during PM damage (Extended Data Fig. 6a) , and this is in keeping with the reported binding of IQGAP1 to TSG101 (ref. 43 ). Consistent with this result, IQGAP1 knockdown indicated a decrease in TSG101 in immunoprecipitates of endogenous ATG9A from cells subjected to PM damage injury (Extended Data Fig. 8a) .

We tested whether ESCRT-III effector components acting downstream of TSG101 and ALIX 3 can be detected in protein complexes with ATG9A. FLAG-CHMP4A and Myc-CHMP4B were detected in co-IP assays with GFP-ATG9A after PM damage (Fig. 5e,f) . Using TIRF microscopy and quantifying CHMP4B profiles at the PM, their increase after injury was sensitive to NEM (Fig. 5g ,h and Extended Data Fig. 8b) , which parallels the sensitivity of ATG9A profiles (Extended Data Fig. 3d-f ). Increases in both CHMP4A and CHMP4B profiles, detectable at the PM during damage, depended on Ca 2+ and ATG9A, as visualized by confocal microscopy (Extended Data Fig. 8c ,d) and quantified by TIRF microscopy and HCM ( Fig. 5i-l) . GFP-ATG9A and mCherry-CHMP4B appeared juxtaposed following GSDMD-NT-induced PM damage (Extended Data Fig. 8e) . Thus, components of the ESCRT machinery associate with ATG9A and appear together on the PM, and these relationships increase in response to PM damage.

ESCRTs and ATG9A cooperate to protect against PM damage. The ESCRT components play a role in protection against PM damage [6] [7] [8] [9] . We tested whether ESCRTs participate in protection against PM injury conferred by ATG9A. TSG101 knockdown increased the sensitivity to PM damage by digitonin, whereas ALIX knockdown did not, and combined knockdown of ALIX and TSG101 showed no increase in damage relative to single knockdown of TSG101 (Fig. 6a-c) . CRISPR-based knockout of ALIX did not increase the susceptibility to digitonin injury (Fig. 6a-c) . Prior publications have indicated that ALIX does not contribute to protection against certain types of PM permeabilization, such as those caused by effectors of necroptosis and pyroptosis 8, 9 . We could not test overlapping or additive effects of ATG9A and TSG101 because we observed that TSG101 was destabilized in ATG9A KO cells and in cells subjected to ATG9A knockdown. We nevertheless tested contributions of CHMP2A, which is a key downstream ESCRT-III factor that is often used to establish the role of ESCRT-dependent membrane remodelling in different cellular processes 6, 9, 44 . Knocking down CHMP2A increased the sensitivity of ATG9A Huh7-WT cells but not of ATG9A Huh7-KO cells to digitonin and GSDMD ( Fig. 6d-g) . Moreover, CHMP2A directly bound IQGAP1 (GST pulldowns; Fig. 6h ,i). Thus, ATG9A, IQGAP1 and ESCRTs are components of the same pathway protecting cells from PM damage (Fig. 6j) .

In addition to ESCRTs and IQGAPs, our proximity biotinylation proteomics analyses revealed additional ATG9A interactors, such as Rab GTPases and adaptor proteins (Supplementary Tables 7 and  8) , as well as several ATG proteins (Supplementary Table 10 ).

ATG2A and ATG2B have been perceived as ATG9A interactors, as in yeast 20 , and act in lipid transport 14 . We detected ATG2 peptides with APEX2-ATG9A (Supplementary Table 10 ). When ATG2A or protects the PM from gasdermin pores. a, HCM quantification of PM permeabilization (PI staining) and cell viability (Live/Dead, calcein + cells) of ATG9A Huh7-WT and ATG9A Huh7-KO cells transfected with FLAG-GSDMD-NT. Data show the percentage of FLAG + cells that were PI + or calcein + (inset). Data shown as the mean ± s.e.m.; n = 6 biologically independent samples, unpaired t-test. b, Immunoblot analysis of ATG9A U2OS-KO cells and endogenous GSDMD cleavage (GSDMD NT ). c, Immunoblot analysis of endogenous GSDMD cleavage (GSDMD NT ) in BMMs from Atg9a fl/fl LysM-Cre − and Atg9a fl/fl LysM-Cre + mice. d, HCM quantification of PM permeabilization (PI staining) of ATG9A U2OS-WT and ATG9A U2OS-KO cells electroporated with LPS to induce endogenous GSDMD cleavage. Data shown as the mean ± s.e.m.; n = 6 biologically independent samples, one-way ANOVA Tukey's test. UT, untreated. e, Cell death analysis of supernatants of ATG9A U2OS-WT and ATG9A U2OS-KO cells electroporated with LPS. Data show the percentage of LDH release (mean ± s.e.m.; n = 6 biologically independent samples, one-way ANOVA Tukey's test). f, HCM quantification of PM permeabilization (PI staining) of Atg9a fl/fl LysMCreand Cre + BMMs transfected with LPS to induce endogenous GSDMD cleavage. Data shown as the mean ± s.e.m.; n = 6 biologically independent samples, one-way ANOVA Tukey's test. g, Cell death analysis of supernatants of Atg9a KO (LysMCre + ) and Atg9a WT (LysMCre − ) BMMs after LPS priming and transfection. Data shown the percentage of LDH release (mean ± s.e.m.; n = 6 biologically independent samples, one-way ANOVA Tukey's test). h, Schematic of how ATG9A protects cells against PM damage. ATG2B were knocked out by CRISPR, this did not affect sensitivity to digitonin or endogenous gasdermin activation (Extended Data Fig. 9a-e) . Downregulating another lipid-modifying factor found on ATG9A membranes, PI4KB 39 , did not affect PM damage (Extended Data Fig. 9f,g) . A lipid scramblase activity has been recently reported for ATG9A 16, 17 . We tested whether the ATG9A . The x axis shows the log 2 (fold change) (Dig/Ctrl ratio; spectral counts), the y axis shows −log 10 (P values); t-test (n = 3 biological replicates per group). Green and red dots indicate increase and decrease in proximity to ATG9A after Dig treatment, respectively.

Orange dots indicate values below the statistical significance cut-off (P ≥ 0.05). IQGAP1 and adaptor proteins are highlighted as purple circles. Bubble size represents a normalized value for the total amount of spectral counts for the protein indicated. b, Co-IP (anti-FLAG) analysis of FLAG-ATG9A and GFP-IQGAP1 (HEK293T) with or without PM damage (Dig, SLO or GBI). One of three independent experiments shown. c, GST Articles NATURE CELL BIOLOGy mutant M33 (autophagy-defective and scramblase-defective; K321L, R322L, E323L, T419W) 17 lost the ability to protect the PM from damage. However, ATG9A-M33 complemented ATG9A Huh7-KO cells in the digitonin PM-damage test (Extended Data Fig. 9h) . Thus, the activities of ATG9A that are defective in the M33 mutant 17 do not appear to be essential for protection against PM damage. Additional ATG9A partners observed in the proximity biotinylation proteomics analyses were confirmed for interactions with ATG9A, and some were tested for effects on PM sensitivity to damage (Extended Data Fig. 9i-q) .

ATG9A affects membrane dynamics and shedding. PM repair is often accompanied by membrane rearrangements and emission of membranous particles 6, 7, 45 . Localized laser-induced PM injury, albeit different from other non-confined types of PM damage in this work, was employed for live microscopy observations. GFP-ATG9A coalesced at the interface between the cytosol and protruding membranes that became diffusionally separated (Supplementary Video 1 and Extended Data Fig. 10a ). Following PM damage with digitonin, particles were released that showed a relatively homogenous peak at 95 nm in ATG9A Huh7-WT cells, which shifted to smaller sizes in ATG9A Huh7-KO cells (75 nm; Fig. 7a ,b and Extended Data Fig. 10b ,c). The particles released by ATG9A Huh7-KO cells were enriched for the membrane marker CD63 relative to the particles released from ATG9A Huh7-WT cells (Extended Data Fig. 10d ). Thus, ATG9A participates in dynamic events at the PM and affects the size and type of membranous particles emitted during PM damage.

ATG9A protects the PM from damage by diverse biological agents. Our findings that ATG9A protects against endogenous PM-permeabilizing agents such as GSDMD-NT (Fig. 2 ) correlate with the reports that the ESCRT system protects cells during gasdermin-mediated pyroptotic cell death 8 . Another cell death process, necroptosis, is associated with MLKL-dependent loss of PM integrity and it too is countered by ESCRT-III 9 . We expressed the characterized PM-targeting MLKL system (full-length MLKL-Venus tagged with the HRas 25 PM-targeting motif), which is sufficient to cause a loss of PM integrity 27 , and detected increased PM permeability in ATG9A Huh7-KO cells compared with ATG9A Huh7-WT cells (Fig. 7c) . Moreover, ATG9A protected cells against PM leakage caused by SARS-CoV-2 ORF3a, an activity previously reported for SARS-CoV-1 (ref. 46 ) (Fig. 7d) . In complementation experiments, ATG9A WT rescued ATG9A Huh7-KO cells subjected to PM damage induced by SARS-CoV-2 ORF3a (Fig. 7e) . Mirroring the results from the complementation experiments with digitonin treatment, ATG9A-M33 rescued ATG9A Huh7-KO cells damaged by SARS-CoV-2 ORF3a (Fig. 7e ). In conclusion, ATG9A counters physiological PM perturbations associated with pyroptotic and necroptotic programmed cell death pathways.

External biological agents, such as infectious agents including bacteria, viruses and protozoan parasites, can cause host cell membrane damage. The intracellular pathogen Mycobacterium tuberculosis (Mtb) causes partial phagosomal permeabilization, whereas a subset of autophagy factors play a role in controlling Mtb infection 47,48 . However, Mtb also causes PM damage while interacting with host cells 49,50 . We therefore tested whether ATG9A can protect cells from PM damage caused by Mtb. To avoid complications from intracellular Mtb effects, we used nonphagocytic Huh7 cells, exposed them to virulent Mtb and quantified PI staining, which showed increased Mtb-inflicted PM damage in the absence of ATG9A ( Fig. 7f and Extended Data Fig. 10e) . As a control, we used the nonvirulent derivative of Mtb subspecies, Mycobacterium bovis (BCG), and detected neither PM damage nor increase dependent on ATG9A (Extended Data Fig. 10f,g) . Thus, ATG9A plays a protective role against PM damage caused by Mtb.

In this study, we uncovered a hitherto unknown role of ATG9A in PM repair. In response to Ca 2+ influx due to PM damage, IQGAP1, ATG9A and ESCRTs are recruited to the sites of injury for repair ( Fig. 7g ). IQGAP1, a known Ca 2+ responder 42 , recruits ATG9A to the damaged PM, and together they organize the ESCRT machinery for PM repair. ATG9A has been traditionally viewed as an important autophagy factor, whereas our results show that it should also be considered as a peripheral factor cooperating with the ESCRT system. ATG9A and IQGAP1 combine with their ESCRT effectors in protection against GSDMD and MLKL pores 8, 9 to prevent excessive necrotic death. This may be of significance in controlling inflammation and tissue damage under various pathophysiological conditions.

Our MS analyses uncovered the hitherto unknown association of ATG9A with IQGAPs, a class of proteins that, along with their binding partner calmodulin, act as Ca 2+ -sensing factors 51-55 , with IQGAP1 better known for its ability to govern cytoskeletal rearrangements at the leading edge of the PM in migrating cells 56, 57 . The ATG9A-IQGAP1 interactions defined here and the previously known functions of IQGAP1 are furthermore compatible with the reported role of ATG9A in cell migration 58 . Others have described a process whereby Ca 2+ recruits ALG-2 and ESCRTs to repair the PM after laser-induced PM damage 7 . However, ALG-2 does not play a role in protection against GSDMD or MLKL-induced PM damage 8,9 . In addition to ESCRT components, our proteomics findings include a variety of previously reported ATG9A partners identified by conventional biochemical methods, thereby validating the use of APEX2-ATG9A. The repertoire of ATG9A interactors includes a suite of Rab GTPases, which probably reflect the multiple trafficking routes taken by ATG9A. This may include the small vesicles observed subcortically during PM damage that we propose ferry . One of three independent experiments shown. b, Schematic of the BioWeB assay (HEK293T APEX2-ATG9A tetracycline (Tet)-inducible cells) for capture, elution and detection by immunoblotting of endogenous proteins that are proximal to APEX2-ATG9A in different conditions. c, BioWeB analysis of changes in TSG101 proximity to APEX2-ATG9A during PM damage (Dig, SLO, GBI, HEK293T APEX2-ATG9A ). d, Quantification of the ratios of eluted TSG101 band intensities versus TSG101 in the input relative to c (mean ± s.e.m.; n = 4 biologically independent experiments, unpaired t-test). e, Co-IP analysis (anti-GFP) of FLAG-CHMP4A and GFP-ATG9A interactions during PM damage (Dig, HEK293T). One of three independent experiments shown. f, Co-IP analysis (anti-GFP) of interactions between Myc-CHMP4B and GFP-ATG9A during PM damage (Dig, HEK293T). Asterisk indicates a nonspecific band. One of three independent experiments shown. g,h, Quantification of TIRF microscopy images of mCherry-CHMP4B recruitment to PM (MyrPalm-EGFP) during PM damage (Dig) in ATG9A Huh7-WT cells pretreated with NEM or NEM + DTT. CHMP4B total fluorescence intensity (g) and CHMP4B puncta number in the TIRF field (h). Data shown as the mean ± s.e.m.; n = 5 independent images, unpaired t-test. i-k, TIRF microscopy images (i) and quantification (j,k) of mCherry-CHMP4B (red) recruitment to PM (MyrPalm-EGFP, green) following damage (Dig) in ATG9A Huh7-WT and ATG9A Huh7-KO cells. Scale bars, 5 µm. Data of CHMP4B total fluorescence intensity (j) and CHMP4B puncta number in the TIRF field (k) shown as the mean ± s.e.m.; n = 5 biologically independent samples, unpaired t-test. l, HCM quantification of mCherry-CHMP4B overlap with PM (MyrPalm-EGFP) in cells washed with 5 mM EGTA and incubated in a Ca 2+ -free HBSS medium with (+) or without (−) added 3.6 mM Ca 2+ during PM damage (Dig). Data show the overlap area between CHMP4B and MyrPalm (mean ± s.e.m.; n = 4 biologically independent samples, one-way ANOVA Tukey's test).

ATG9A en route to or from PM. The Rab GTPases identified in proximity to ATG9A include RAB7A, which is known to colocalize with ATG9A 21 , and a RAB7-specific GTPase activating protein (GAP), TBC1D15 (ref. 59 ), thereby underscoring the role of RAB7 in ATG9A trafficking that is also reflected in the observed sensitivity of RAB7-depleted cells to PM damage. By MS, we also detected dynamic changes in associations and confirmed several by co-IP assays with the adaptor proteins AP-1, AP-2, AP-3 (with the AP-3 

interaction being identified here) and AP-4 (refs. 24,35,60 ). We interpret these relationships as indicative of increased ATG9A trafficking during PM damage.

Our findings suggest that ATG9A confers protection against diverse PM-damaging products and activities, including those of microbial pathogens. ATG9A protects cells from PM injury 

caused by Mtb 49,50,61 . Likewise, SARS-CoV-1 ORF3a 46 and, as shown here, ORF3a of SARS-CoV-2 cause PM damage, and ATG9A protects against this activity. ORF3a, apart from its membrane-permeabilization activities, plays a role in lysosomal damage and deacidification, with a proposed contribution to nonlytic viral egress via endosomal and lysosomal exocytosis 62 . Thus, ATG9A activities at the PM intersect with a spectrum of microbial pathogenesis processes. This is in keeping with a growing recognition of the expanding effects of the components of the autophagy apparatus in various cellular processes 2,10 . The physical and functional cooperation of ATG9A with IQGAP1 and the ESCRT machinery represents another example of non-canonical functions of the ATG factors and broadens the fundamental scope and translational potential of both the ATG and the ESCRT systems.

Any methods, additional references, Nature Research reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at https://doi.org/10.1038/ s41556-021-00706-w. 

Methods Antibodies and reagents. The following antibodies were from Abcam: GFP (ab290) (1:1,000 for western blotting (WB)); GFP (ab38689) (1:100 for immunoprecipitation (IP)); GM130 (ab1299) Plasmids, siRNAs and transfection. Plasmids used in this study for immunoprecipitation or IF assays, such as those expressing ATG9A, ALIX (including their mutants' deletions) and CHMP4A were cloned into pDONR221 (Gateway Technology cloning vector, Thermo Scientific) using a BP cloning reaction. Expression vectors were then made by a LR cloning reaction (Gateway, ThermoFisher) in appropriate destination (pDEST) vectors.

ATG9A mutants were generated utilizing a QuikChange site-directed mutagenesis kit (Agilent) and confirmed by sequencing (Genewiz). Small interfering RNAs (siRNAs) were from GE Dharmacon (siGENOME SMART pool). Plasmid transfections were performed using the calcium phosphate transfection method in HEK293T cells or using Lipofectamine 2000 in the other cell lines (ThermoFisher Scientific). siRNAs were delivered into cells using Lipofectamine RNAiMAX (ThermoFisher Scientific).

Generating cell lines by CRISPR-Cas9. ATG9A (ATG9A Huh7-KO and ATG9A U2OS-KO ), ATG2A (ATG2A U2OS-KO ), ATG2B (ATG2B U2OS-KO ) and ALIX (ALIX HeLa-KO ) cell lines by CRISPR-Cas9. Sequences of the two single-guide RNA (sgRNA) used to generate ATG9A Huh7-KO cells were GACCCCCAGGAGTGTGACGG and TCTGGAAACGGAGGATGCGG. Those to generate ATG9A U2OS-KO , ATG2A U2OS-KO and ATG2B U2OS-KO were CTGTTGGTGCACGTCGCCGAGGG and CCCTGGGGGTGAATCACTATAGG, CACTGCACAGTGCGCGTGTCCGG and CCAGGGCACGGCCACCTCGATGG, and GAGGATTAGAAATGGTCTTCCGG and AAGAGCCCCATGGAACTGACAGG, respectively. The sequence of the sgRNA used to knockout ALIX (PDCD6IP) was CTTAAGTCGAGAGCCGACCG.

ATG9A Huh7-KO and ALIX HeLa-KO cells were generated by infecting target cells with the appropriate sgRNA, lentiviral vectors and lentiCRISPRv2 as previously described 64 . Briefly, HEK293T cells were transfected with lentiCRISPRv2 sgRNA vectors together with psPAX2 and pMD2.G at the ratio of 4 μg, 2.5 μg and 1.5 μg per 6-cm dish. After 60 h, the supernatants containing lentiviruses were collected and spun down at 300 × g for 5 min to clear cell debris. Lentiviruses were diluted with DMEM full medium at 1:2 ratio and used to infect target cells overnight with in presence of 8 μg ml −1 of polybrene (hexadimethrine bromide) in 12-well plates. Then, the medium with lentivirus was removed and changed to fresh medium to continue incubation for 24 h. Cells were selected on 2 μg ml −1 puromycin for 5 days before validation of the knockout. Single clones were isolated by seeding single cells in 96-well plates after serial dilutions.

ATG9A U2OS-KO , ATG2A U2OS-KO and ATG2B U2OS-KO cells were created by first cloning the sgRNA into the pX458 plasmid (Addgene), which also allows the simultaneous expression of Cas9 and GFP. U2OS cells were transfected with the generated plasmids using Xfect (Takara Bio), and 48 h later clonally sorted by FACS based on GFP expression. Single-cell clones were then expanded and sequenced, and protein expression was assessed by immunoblotting.

Generating Flp-In cell lines. HEK293T Flp-In-FLAG-APEX2-ATG9A TetON (HEK293T APEX2-ATG9A ) and HeLa Flp-In-mCherry-CHMP4A cell lines. HEK293T or HeLa Flp-In T-REX host cells were transfected with ATG9A and CHMP4A reconstructed plasmid, respectively, and the pOG44 expression plasmid at ratio of 9:1. After 24 h of transfection, cells were washed and fresh medium added. One day later, cells were split into fresh medium containing 100 μg ml −1 hygromycin, at a confluency around 25%. Selective medium was renewed every 3-4 days until single-cell clones could be identified. Hygromycin-resistant clones were picked and expanded. Clones were tested by immunoblotting after overnight incubation in medium containing 1 μg ml −1 tetracycline to analyse the expression of FLAG-APEX2-ATG9A or mCherry-CHMP4A.

Co-IP and immunoblotting. Cells transfected with 8-10 μg of plasmids were lysed in NP-40 buffer (ThermoFisher Scientific) supplemented with protease inhibitor cocktail (Roche) and 1 mM phenylmethylsulfonyl fluoride (Sigma) for 30 min on ice. Supernatants were incubated with 2-3 μg of antibodies at 4 °C overnight. The immune complexes were captured with Dynabeads (ThermoFisher Scientific). Dynabeads were washed three times with PBS and bound proteins eluted with 2× Laemmli sample buffer (Bio-Rad) before being subjected to immunoblot analysis. Immunoblotting images were visualized and analysed using ImageLab v.6.0.0.

For IF confocal microscopy, cells were plated onto coverslips in 12-well plates. Cells were transfected with plasmids and treated as indicated in the figures before fixing in 4% paraformaldehyde (PFA) for 10 min followed by permeabilization with PBS 0.1% saponin for 10 min. Cells were then blocked in PBS 5% BSA, 0.05% saponin for 30 min before labelling with primary antibodies overnight at 4 °C. After washing with PBS and incubation with appropriate secondary antibodies for 1 h at room temperature, coverslips were mounted using ProLong Gold Antifade Mountant (Invitrogen) and analysed by confocal microscopy using a Zeiss LSM510 laser scanning microscope driven by Zeiss LSM 510 v.4.2 SPI software.

GST pulldown assay. Recombinant GST and GST-fusion proteins were produced in Escherichia coli SoluBL21 (Genlantis, C700200) by inducing expression in overnight cultures with 50-75 μg ml −1 isopropyl β-d-1-thiogalactopyranoside. Expressed proteins were purified by immobilization on glutathione sepharose 4 fast flow beads (GE Healthcare, 17-5132-01). For GST pulldown assays, Myc-tagged proteins were in vitro translated and radiolabelled with [ 35 S]-methionine using a TNT T7 Reticulocyte Lysate system (Promega, l4610). Ten microlitres of in vitro translated proteins were precleared to reduce nonspecific binding with 10 μl of empty glutathione sepharose beads in 100 μl of NETN buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA and 0.5% NP-40) supplemented with complete EDTA-free protease inhibitor cocktail (Roche, 1183617001) for 30 min at 4 °C. This was followed by incubation with purified GST or GST-fusion proteins for 1-2 h at 4 °C. The mixture was washed five times with NETN buffer by centrifugation at 2,500 × g for 2 min followed by addition of 2× SDS gel loading buffer (100 mM Tris pH 7.4, 4% SDS, 20% glycerol, 0.2% bromophenol blue and 200 mM dithiothreitol (DTT) (Sigma, D0632)) and heating for 10 min. The proteins were then resolved by SDS-PAGE and the gel stained with Coomassie Brilliant Blue R-250 dye (ThermoFisher Scientific, 20278) to visualize the GST and GST-fusion proteins. The gel was vacuum-dried and the radioactive signal detected using a Bioimaging analyzer BAS-5000 (Fujifilm). PM damage. PM damage using the detergents digitonin and saponin was performed as previously described 6 . Briefly, 0.05% saponin or 50-200 µg ml −1 digitonin (as indicated) diluted in DMEM-10% FBS (complete medium) was applied to cells at 37 °C for 1 min. Cells were then washed with complete medium and fixed for 3 min after the addition of detergents with 4% PFA in PBS or lysed.

PM damage using SLO was performed with a modified protocol 65 . Cells were washed with Ca 2+ -free HBSS containing 5 mM EGTA at 37 °C before washing twice in Ca 2+ -free HBSS. Reduced SLO (10 mM DTT at room temperature for 5 min) was diluted in Ca 2+ -free HBSS (200 U ml −1 ) and added on target cells for 10 min at 37 °C. Cells were washed in complete medium before being fixed or lysed.

PM damage induced by GBI was performed as previously described 66 . Acid-washed glass beads were gently poured over the cells (~35 mg of beads per well for a 24-well plate). The beads were agitated over the cells for 1 min on a rotator platform at 160 r.p.m. Thirty seconds after GBI, the cells were washed with warm PBS and fixed or lysed.

PM damage induced by the pore-forming FLAG-GSDMD-NT fragment was performed as previously described 67 . Huh7 cells were transfected with 100 ng per 10 5 cells of FLAG-GSDMD-NT plasmid (Addgene, 80951), FLAG-GSDMD (Addgene, 80950) or FLAG-GSDMD-NT-4A (Addgene, 80952) using Lipofectine 2000 in OptiMEM for 2 h. Then, cells were washed in complete medium before assessing PI uptake and cell viability (Live/Dead, Thermo Scientific) at the indicated time points.

PM damage triggered by cleavage of endogenous GSDMD was performed as previously described for BMMs and human cell lines 8, 29 . BMMs were seeded at a density of 3 × 10 4 cells per well in a 96-well plate 1 day before stimulation and grown overnight at 37 °C in 5% CO 2 . The next day, the supernatant was removed and BMMs were primed for 4 h with 50 ng per well of LPS O55:B5. Then, 3 × 10 4 cells were transfected with LPS complexes prepared by mixing 100 µl of OptiMEM with ultrapure LPS O111:B4 (Invivogen) and 0.5 µl of Lipofectamine RNAiMAX (Thermo Scientific). The transfection mixture was incubated for 10 min at room temperature and subsequently added to the cells. Plates were centrifuged at 1,000 r.p.m. for 5 min at 37 °C. BMMs were incubated for the indicated times at 37 °C in 5% CO 2 before measuring PM damage using the PI assay and lactate dehydrogenase (LDH) release in the supernatant (Promega, G1780). For U2OS cells, 2 µg of LPS O111:B4 (Invivogen) was mixed with 2 × 10 6 U2OS cells in 100 µl of Amaxa Nucleofector Kit V buffer (Lonza, VVCA-1003) and electroporated according to the manufacturer's instructions. Cells were then plated in a 96-well plate for 6 h or 17 h before measuring LDH release in the supernatant and performing the PI assay.

PM leakage induced by SARS-CoV-2 ORF3a was performed by transfection of ORF3a (FLAG or GFP tagged in Nter) using Lipofectine 2000 in OptiMEM for 2 h. Then, cells were washed in complete medium before assessing PI uptake the next day. This plasmid was obtained by LR cloning reaction (Gateway, ThermoFisher) in a pDEST-FLAG or a pDEST-GFP vector using pDONR207 SARS-Cov-2 ORF3a (Addgene, 141271).

For the PI assay, cells were incubated with 100 µg ml −1 PI diluted in complete medium for 1 min at 37 °C, 2 min after the addition of saponin or digitonin, 10 min after SLO or 1 min after GBI treatment. After PI incubation, cells were fixed with 4% PFA.

For the Dx-10 staining, cells were incubated for 1 min at 37 °C with 500 µg ml −1 of Dx-10 diluted in complete medium, 2 min after the addition of digitonin and before 4% PFA fixation. PMHAL assay. Huh7 cells were transiently transfected with the HT probe (PEX3-GFP-HT) before digitonin treatment for 1 min. Cells were then washed for 1 min in complete medium before incubation with complete medium containing the HT ligands MIL and/or MPL (1:1,000) for 1 min before 4% PFA fixation and Hoechst staining. For HCM quantification, cells transfected with the PEX3-GFP-HT probe were gated using GFP total cell fluorescence intensity. A mask was then assigned to GFP-positive puncta according to the fluorescence intensity and puncta area. The same threshold was applied to ATG9A WT and ATG9A KO cells. The fluorescence intensity of MIL or MPL colocalizing with GFP-HT puncta masks (GFP + MIL + or GFP + MPL + , respectively) was then assessed.

To monitor endocytosis, we used DQ-Red BSA as a fluid phase tracer. Cells were incubated with 10 µg ml −1 of DQ-Red BSA diluted in complete medium for 2 min at 37 °C after digitonin treatment. Endocytosis was stopped by 4% PFA fixation. Bimolecular fluorescence complementation assay. HeLa cells were transiently transfected with pDEST-VN ALIX and pDEST-VC ATG9A followed by analysis of Venus fluorescence by HCM and confocal microscopy.

Cell surface biotinylation. ATG9A cell surface biotinylation was performed as previously described 23 , with an adapted protocol suitable for the analysis of proteins during PM damage 66 . HEK293T cells transiently expressing GFP-ATG9A were treated with PM-damaging agents (digitonin, SLO or GBI) or EBSS for 1 h. Cells were rinsed twice with ice-cold PBS 2+ (PBS containing 1 mM MgCl 2 and 0.1 mM CaCl 2 ) and were subsequently incubated with freshly prepared ice-cold 0.4 mM maleimide-PEG 2 -biotin (ThermoFisher Scientifc) in PBS (1 mM MgCl 2 , 2 mM CaCl 2 , 150 mM NaCl) for 60 min at 4 °C with gentle agitation. Unreacted maleimide-PEG 2 -biotin was then quenched by washing the cells twice with ice-cold quenching buffer (PBS, 1 mM MgCl 2 , 0.1 mM CaCl 2 and 100 mM glycine) for 20 min at 4 °C. Cells were subsequently rinsed twice with ice-cold PBS 2+ and scraped into NP-40 buffer (50 mM Tris-HCl, pH 8, 150 mM NaCl, 1% NP-40 and supplemented with protease inhibitor cocktails). After 30 min on ice, lysates were cleared by centrifugation at 16,000 × g for 10 min at 4 °C, and the protein concentration was determined using a BCA protein assay (Pierce). A total of 4 mg of protein was incubated with 3 μg of GFP antibody overnight at 4 °C. The immune complexes were captured with Dynabeads (ThermoFisher Scientific). The Dynabeads were wash with PBS three times and bound proteins were eluted with 2× Laemmli sample buffer (Bio-Rad) before analysis by immunoblotting using a HRP-conjugated streptavidin antibody. hEGF treatment. Cells were washed three times with pre-warmed PBS and serum-starved with DMEM containing 0.1% FBS for HeLa cells or serum-free DMEM for U2OS cells. After 24 h of starvation, cells were stimulated for 30 min with hEGF in DMEM (50 ng ml −1 for HeLa cells and 100 ng ml −1 for U2OS cells). NEM treatment. NEM treatment was performed as previously described 68 . Cells were washed twice in PBS supplemented with 0.1 mM CaCl 2 and 0.1 mM MgCl 2 (PBS + ) and then treated in PBS + on ice either with 1 mM NEM for 15 min followed by quenching with 2 mM DTT for 15 min, or with 1 mM NEM plus 2 mM DTT for 30 min. Finally, cells were washed in PBS + and incubated in complete medium for 30 min at 37 °C before inducing PM damage.

Extracellular vesicle enrichment and analysis. ATG9A Huh7-KO and their parental ATG9A Huh7-WT cells were treated with 100 µg ml −1 digitonin diluted in OptiMEM for 1 min. Cells were washed twice with OptiMEM and the supernatant containing the released extracellular vesicle (EVs) was collected 5 min after digitonin addition. EVs were isolated using Total exosome isolation reagent (ThermoFisher Scientific) according to the manufacturer's instructions. The obtained cell pellets were suspended in 100 µl of PBS and analysed by immunoblotting or in a nanoparticle tracking instrument.

Nanoparticle tracking analysis. Isolated EVs (as described above) from the ATG9A Huh7-KO and their parental ATG9A Huh7-WT cell culture supernatants were diluted in PBS and used for nanoparticle tracking analysis using a Nanosight NS300 instrument (NanoSight), followed by evaluation using the Nanoparticle Tracking Analysis (NTA) software. Conditions were as follows: camera type, sCMOS; detection threshold, 2; recording for 800 frames at 25 frames per s. PM damage by mycobacteria. Mtb Erdman (Erdman) culture was prepared by thawing a frozen stock aliquot and grown in 7H9 Middlebrook liquid medium supplemented with oleic acid, albumin, dextrose and catalase (OADC; Becton Dickinson), 0.5% glycerol and 0.05% Tween-80. Cultures were grown at 37 °C. ATG9A Huh7-KO and their parental ATG9A Huh7-WT cells were co-incubated with Mtb Erdman at a multiplicity of infection (m.o.i.) of 5 or 10 (or BCG at m.o.i. of 10) for 1 h followed by PI staining (100 µg ml −1 in complete medium) and fixation in 4% PFA for 1 h to analyse PM permeability by HCM.

HCM. Cells in 96-well plates were treated as indicated in each experiment before fixing in 4% PFA. Cells were then permeabilized with 0.1% saponin in 3% BSA for 30 min followed by incubation with primary antibodies overnight at 4 °C and secondary antibodies for 1 h at room temperature. HCM with automated image acquisition and quantification was carried out using a Cellomics HCS scanner and iDEV software (ThermoFisher Scientific). Automated epifluorescence image collection was performed using a minimum of 500 cells per well and ≥5 wells per sample. Epifluorescence images were machine analysed using preset scanning parameters and object mask definitions. Hoechst 33342 staining was used for autofocus and to automatically define cellular outlines based on background staining of the cytoplasm. Primary objects (cells, regions of interests (ROIs) or targets) were algorithm-defined for shape/segmentation, maximum/minimum average intensity, total area and total intensity minimum and maximum limits to automatically identify puncta or other profiles within valid primary objects. Nuclei were defined as a ROI for PI staining. All data collection, processing (object, ROI and target mask assignments) and analyses were computer-driven independently of human operators.

TIRF dSTORM super-resolution imaging and analysis. Super-resolution imaging by dSTORM TIRF microscopy and data analyses were done as previously described 69 . HeLa cells transiently transfected with FLAG-ATG9A and MyrPalm-EGFP were plated on 25-mm round no. 1.5 coverslips (Warner Instruments) coated with poly-l-lysine solution (Sigma-Aldrich) and allowed to adhere overnight. After two-step fixation (first step (0.6% PFA, 0.1% glutaraldehyde (GA), 0.1% saponin) for 60 s; second step (4% PFA, 0.2% GA) for 3 h), cells were washed with 1× PBS twice and incubated with 0.1% NaBH 4 for 5 min. After two washes with PBS, cells were incubated with 10 mM Tris-HCl, pH 7.5 for 5 min and blocked with 5% BSA containing 0.05% saponin for 15 min. After a wash with PBS, cells were incubated with anti-FLAG antibody overnight at 4 °C and washed with PBS three times followed by labelling with Alexa Fluor 647 (A21245, Invitrogen). The coverslip was mounted on an Attofluor cell chamber (A-7816, ThermoFisher Scientific) with 1.1 ml of imaging buffer (50 mM Tris-HCl, pH 8, 10 mM NaCl, 10% glucose, 168.8 U ml −1 glucose oxidase (Sigma), 1,404 U ml −1 catalase (Sigma) and 20 mM 2-aminoethanethiol). The chamber was sealed by placing an additional coverslip over the chamber, and the oxygen-scavenging reaction in the Imaging buffer was allowed to proceed for 20 min at room temperature before starting imaging.

Imaging was performed using a custom-built TIRF illuminating fluorescence microscope controlled by custom-written software (https://github.com/LidkeLab/ matlab-instrument-control) in Matlab (MathWorks). The samples were loaded on a x-y-z piezo stage (Mad City Labs, Nano-LPS100) mounted on a manual x-y translator. Images were recorded on an iXon 897 electron-multiplying charge coupled (EMCCD) camera (Andor Technologies). The EMCCD gain was set to 100, and 256 × 256 pixel frames were collected with a pixel resolution of 0.1078 µm. A 642-nm laser (collimated from a laser diode, HL6366DG, Thorlabs) was used for sample excitation. The laser was coupled to a multi-mode fibre (P1-488PM-FC-2, Thorlabs) and focused onto the back focal plane of the objective lens (UAPON ×150 OTIRF, Olympus America). Optimal laser penetration depth was achieved by adjusting the TIRF angle, translating the laser beam away from the optical axis along the back focal plane of the objective. Sample excitation was done through a quad-band dichroic and filter set (LF405/488/561/635-A; Semrock). The fluorescence emission path included a band-pass filter (685/45, Brightline) and a quadband optical filter (Photometrics, QV2-SQ) with four filter sets (600/37, 525/45, 685/40 and 445/45, Brightline).

When imaging the first signal, for each target cell, a brightfield reference image was saved in addition to the x-y stage position coordinates. The 642-nm laser was used at ∼1 kW cm −2 to take 20 sets of 2,000 frames (a total of 40,000) at 60 Hz. After imaging all target cells, the imaging buffer was replaced with PBS, the residual fluorescence was photobleached and quenched with NaBH 4 and the preparation washed twice with PBS. Before the second round of imaging, cells were blocked for 30 min, labelled with anti-GFP antibody coupled with Alexa Fluor 647 (A-31852, ThermoFisher Scientifc) at 1:500 for 1 h and washed with PBS three times. Before the second round of imaging, each target cell was located and realigned using the saved brightfield reference image as described in ref. 70 .

Data were analysed via a two-dimensional (2D) localization algorithm based on maximum likelihood estimation 71 . The localized emitters were filtered through thresholds of maximum background photon counts of 200, minimum photon counts per frame per emitter of 250 and a data model hypothesis test 72 with a minimum P value of 0.01. The accepted emitters were used to reconstruct the super-resolution image. Each emitter was represented by a 2D Gaussian function with σx and σy equal to the localization precisions, which were calculated from the Cramér-Rao Lower Bound (CRLB). Clustering analysis was performed with a Matlab code using clustering tools (http://stmc.health.unm. edu/tools-and-data/). ROIs were selected from the image. Clustering was then performed separately for each label in each ROI, using the density-based DBSCAN algorithm choosing a maximal nearest neighbour distance of 40 nm and requiring clusters to contain at least 5 observations. In all cases, most observations for each label in each ROI formed a single cluster. Cluster boundaries were produced via the Matlab "boundary" function, from which inter-label cluster distances were computed.

Photodamage and time-lapse imaging. For laser-induced PM damage, Huh7 cells transiently transfected with GFP-ATG9A using Lipofectamine 2000 were plated in a chambered coverslip (μ-Slide 8 well, ibiTreat, 80826) and allowed to adhere overnight. Cells were maintained at 37 °C with a supply of 5% CO 2 . Cells were incubated with medium containing 160 μg ml −1 PI immediately before photodamage. Photodamage and associated time-lapse acquisitions were performed with a Leica TCS SP8 confocal microscope equipped with a 405 laser (100 mW, set at 100%, 50 iterations) to induce PM damage. The acquisition was performed with a ×63/1.4 NA oil-immersion apochromat objective and the resulting images (1 image per 0.8 s) were processed with Leica software LAS AF, Adobe After Effects and Adobe Premiere Pro.

TIRF microscopy. TIRF microscopy images were obtained using a ×100/1.49 NA oil-immersion objective and a TIRF module built-in Eclipse TI-E inverted microscope (Nikon Instruments). A 488-nm laser and a 543-nm laser were used for excitation, and emission signals were filtered with 528 ± 19-nm and 617 ± 36-nm band-pass filters for Alexa Fluor 488 and Alexa Fluor 555 imaging, respectively. Images were collected by a QuantEM 512SC imaging camera (Photometrics) operated with NIS-Elements software (Nikon Instruments). For puncta counting, images were converted to binary images by thresholding using ImageJ (National Institutes of Health).

PM tension measurement. ATG9A Huh7-WT or ATG9A Huh7-KO cells were spread at around 70% confluence on a 8-well glass bottom microslides (Ibidi, 80826) and grown in DMEM medium supplemented with 10% FBS for 24 h. The medium was replaced with the same medium containing 2 μM of Flipper-TR probe (SC020, Spirochrome) and kept for at least 30 min before imaging. FLIM imaging was performed using a Leica TCS SP8 SMD microscope equipped with a time-correlated single-photon counting module from PicoQuant58. Excitation was performed using a pulsed 470-nm laser (PicoQuant, LDH-D-C-470) operating at 40 MHz, and the emission signal was collected through a 600/50-nm bandpass filter using a MPD-SPAD detector (Micro Photon Devices-Single Photon Avalanche Diode) and a TimeHarp 260 PICO board (PicoQuant). SymPhoTime software (PicoQuant) was then used to fit fluorescence decay data (from full images) to a dual exponential model. Cell fixation, DAB reaction, embedding and EM analyses. HEK293T APEX2-ATG9A cells were treated with DAB (oxidation reaction) as previously described 73 . Alternatively, HEK293T APEX2-ATG9A cells were exposed to 50 µg ml −1 of digitonin for 1 min before fixing and DAB treatment. Briefly, an equal volume of double strength fixative (4% GA in 0.1 M sodium cacodylate buffer, pH 7.4) was added to the cells for 20 min at room temperature before fixing the cells with one volume of single strength fixative (2% GA in 0.1 M sodium cacodylate buffer, pH 7.4) at 4 °C for 1 h. After 5 washes with cacodylate buffer (pH 7.4) followed by 5 washes in PBS, a filtered solution of 0.5 mg ml −1 DAB (Sigma) in PBS was mixed (10,0000:3) with 30% H 2 O 2 (Sigma) and added to the cells for 7 min. The DAB oxidation reaction was monitored using a brightfield microscope and stopped by rinsing the cells 3 times with PBS for 5 min. Cells were then processed for EM by embedding them in EPON resin as previously described 74 . Ultra-thin 70-nm sections were cut using a Leica EM UC7 ultramicrotome (Leica Microsystems) and collected on 150 formvar-mesh copper grids. Cell sections were examined using a CM100bio TEM (FEI). The quantification of ATG9A at the PM was performed on APEX2-ATG9A-positive cell profiles per condition in the following way: the entire length of the PM as well as the sections of the PM stained with DAB in each cell profile were measured with the ImageJ software. The average percentage of the PM positive for APEX2-ATG9A in 45 randomly selected cell profiles were analysed.

HEK293T APEX2-ATG9A cells were incubated in 500 µM biotin-phenol (AdipoGen) in complete medium before inducing PM damage. For digitonin treatment, 100 µg ml −1 digitonin diluted in complete medium was added on the cells for 1 min. Cells were washed once in complete medium before adding back biotin-phenol medium. For SLO treatment, cells were washed at 37 °C with Ca 2+ -free HBSS containing 5 mM EGTA followed by two more washes in Ca 2+ -free HBSS. SLO was reduced by 10 mM DTT 5 min at room temperature before dilution in Ca 2+ -free HBSS (200 U ml −1 ) and added on target cells for 10 min at 37 °C. Cells were then washed once in complete medium before adding biotin-phenol medium. For GBI treatment, ~1.6 g of beads were gently poured on the 10-cm petri dish containing the cells. The beads were agitated over the cells for 1 min on a rotator platform at 160 r.p.m. A 1-min pulse with 1 mM H 2 O 2 at room temperature was stopped with quenching buffer (10 mM sodium ascorbate, 10 mM sodium azide and 5 mM Trolox in PBS). All samples were washed twice with quenching buffer, and twice with PBS.

For LC-MS/MS analysis, cell pellets were lysed in 500 µl ice-cold lysis buffer (6 M urea, 0.3 M NaCl, 1 mM EDTA, 1 mM EGTA, 10 mM sodium ascorbate, 10 mM sodium azide, 5 mM Trolox, 1% glycerol and 25 mm Tris-HCl, pH 7.5) for 30 min by gentle pipetting. Lysates were clarified by centrifugation and protein concentrations were determined using Pierce 660 nm protein assay reagent. Streptavidin-coated magnetic beads (Pierce) were washed with lysis buffer. A total of 1 mg of each sample was mixed with 100 µl of streptavidin beads. The suspensions were gently rotated at 4 °C overnight to bind biotinylated proteins. The flow-through after enrichment was removed and the beads were washed in sequence with 1 ml IP buffer (150 mM NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100) twice; 1 ml 1 M KCl; 1 ml of 50 mM Na 2 CO 3 ; 1 ml 2 M urea in 20 mM Tris HCl, pH 8.0; and 1 ml IP buffer. Biotinylated proteins were eluted, and 10% of the sample processed for immunoblotting and 90% of the sample processed for MS.

Scientific Q Exactive Plus Orbitrap mass spectrometer in conjunction Proxeon Easy-nLC II HPLC (Thermo Scientific) and Proxeon nanospray source. The digested peptides were loaded onto a 100 µm × 25 mm Magic C18 100 Å 5U reverse-phase trap where they were desalted online before being separated using a 75 µm × 150 mm Magic C18 200 Å 3U reverse-phase column. Peptides were eluted using a 140-min gradient with a flow rate of 300 nl min −1 . A MS survey scan was obtained for the m/z range 350-1,600, and MS/MS spectra were acquired using a top 15 method, where the top 15 ions in the MS spectra were subjected to high energy collisional dissociation. An isolation mass window of 1.6 m/z was for the precursor ion selection, and a normalized collision energy of 27% was used for fragmentation. A 15-s duration was used for the dynamic exclusion.

MS data processing and analysis. Tandem mass spectra were extracted by Proteome Discoverer v.2.2. Charge state deconvolution and deisotoping were not performed. All MS/MS samples were analysed using X! Tandem (The GPM, thegpm.org; version X! Tandem Alanine (2017. 2.1.4) ). X! Tandem was set up to search the UniProt Human proteome database plus 110 common laboratory contaminants and an equal number of decoy sequences (147,936 entries total) assuming the digestion enzyme trypsin. X! Tandem was searched with a fragment ion mass tolerance of 20 ppm and a parent ion tolerance of 20 ppm. Glu->pyro-Glu of the N terminus, ammonia-loss of the N terminus, gln->pyro-Glu of the N terminus, deamidated of asparagine and glutamine, oxidation of methionine and tryptophan and dioxidation of methionine and tryptophan were specified in X! Tandem as variable modifications.

Scaffold (v.Scaffold_4.9.0, Proteome Software) was used to validate MS/MS-based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 98.0% probability by the Scaffold Local false discovery rate (FDR) algorithm. Peptide identifications were also required to exceed specific database search engine thresholds. X! Tandem identifications required at least −log(E-value) of 2. Protein identifications were accepted if they could be established at greater than 5.0% probability to achieve an FDR less than 5.0% and contained at least 1 identified peptide. This resulted in a peptide decoy FDR of 0.7% and a protein decoy FDR of 0.66%. Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony. Proteins sharing significant peptide evidence were grouped into clusters. Raw data and Scaffold results are available from the MassIVE proteomics repository (MSV000084519) and Proteome Exchange PXD016084.

BioWeB assay: APEX2 labelling and streptavidin enrichment for immunoblotting analyses. HEK293T APEX2-ATG9A cells were treated as described above for LC-MS/MS analysis. Cells were lysed in 500 µl ice-cold NP-40 buffer for 30 min on ice. Lysates were clarified by centrifugation and protein concentrations were determined using Pierce 660-nm protein assay reagent. One milligram of each sample was mixed with 100 µl of streptavidin magnetic beads (Pierce). The suspensions were gently rotated at 4 °C overnight to bind biotinylated proteins. The flow-through after enrichment was removed and the beads were washed in sequence with 1 ml IP buffer twice; 1 ml 1 M KCl; 1 ml of 50 mM Na 2 CO 3 ; 1 ml 2 M urea in 20 mM Tris-HCl, pH8; and 1 ml IP buffer. Biotinylated proteins were eluted with 2× Laemmli sample buffer (Bio-Rad) and subjected to immunoblot analysis.

Statistics and reproducibility. Data in this paper are presented as the mean ± s.e.m. (n ≥ 3). Data were analysed with either analysis of variance (ANOVA) with Dunnett's, Tukey's or Sidak's HSD post hoc test, or unpaired Student's t-test using GraphPad Prism v.7 to determine statistical significance. No statistical methods were used to predetermine the sample sizes. The number of independent samples and any statistical tests used are indicated in the figure legends, and all the replicates reproduced the shown findings. The experiments were repeated at least three times wherever representative results are shown.

Reporting Summary. Further information on research design is available in the Nature Research Reporting Summary linked to this article.

MS raw data and Scaffold results have been deposited in the MassIVE proteomics repository (MSV000084519) (https://massive.ucsd.edu) and Proteome Xchange with the primary accession code PXD016084 (http://www.proteomexchange.org). Source data are provided with this paper. All other data supporting the findings of this study are available from the corresponding author on reasonable request.

Super-resolution TIRF imaging was performed using a custom-built TIRF illuminating fluorescence microscope controlled by custom-written software (https://github.com/LidkeLab/matlab-instrument-control) in Matlab (MathWorks). 

For all statistical analyses, confirm that the following items are present in the figure legend, table legend, main text, or Methods section.

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement A statement on whether measurements were taken from distinct samples or whether the same sample was measured repeatedly

The statistical test(s) used AND whether they are one-or two-sided Only common tests should be described solely by name; describe more complex techniques in the Methods section.

A description of all covariates tested A description of any assumptions or corrections, such as tests of normality and adjustment for multiple comparisons A full description of the statistical parameters including central tendency (e.g. means) or other basic estimates (e.g. regression coefficient) AND variation (e.g. standard deviation) or associated estimates of uncertainty (e.g. confidence intervals)

For null hypothesis testing, the test statistic (e.g. F, t, r) with confidence intervals, effect sizes, degrees of freedom and P value noted For manuscripts utilizing custom algorithms or software that are central to the research but not yet described in published literature, software must be made available to editors and reviewers. We strongly encourage code deposition in a community repository (e.g. GitHub). See the Nature Research guidelines for submitting code & software for further information.

Policy information about availability of data All manuscripts must include a data availability statement. This statement should provide the following information, where applicable:

-Accession codes, unique identifiers, or web links for publicly available datasets -A list of figures that have associated raw data -A description of any restrictions on data availability Raw data, and Scaffold results are available from the MassIVE proteomics repository (MSV000084519) and Proteome Exchange PXD016084. The mass spectrometry data were analyzed by searching the Uniprot Human proteome database.

Diverse cellular roles of autophagy

Biological functions of autophagy genes: a disease perspective

Cellular functions and molecular mechanisms of the ESCRT membrane-scission machinery

ESCRTs are everywhere

The ESCRT-machinery: closing holes and expanding roles

ESCRT machinery is required for plasma membrane repair

Mechanism of Ca 2+ -triggered ESCRT assembly and regulation of cell membrane repair

ESCRT-dependent membrane repair negatively regulates pyroptosis downstream of GSDMD activation

ESCRT-III acts downstream of MLKL to regulate necroptotic cell death and its consequences

Autophagy-independent functions of the autophagy machinery

Autophagy in human diseases

Autophagy in inflammation, infection, and immunometabolism

Watch what you (self-) eat: autophagic mechanisms that modulate metabolism

ATG2 transports lipids to promote autophagosome biogenesis

The autophagic membrane tether ATG2A transfers lipids between membranes

Atg9 is a lipid scramblase that mediates autophagosomal membrane expansion

Structure, lipid scrambling activity and role in autophagosome formation of ATG9A

Autophagosome maturation: an epic journey from the ER to lysosomes

Structure of human ATG9A, the only transmembrane protein of the core autophagy machinery

Atg9 establishes Atg2-dependent contact sites between the endoplasmic reticulum and phagophores

Starvation and ULK1-dependent cycling of mammalian Atg9 between the TGN and endosomes

TBC1D14 regulates autophagosome formation via Rab11-and ULK1-positive recycling endosomes

Calmodulin modulates the interaction between IQGAP1 and Cdc42. Identification of IQGAP1 by nanoelectrospray tandem mass spectrometry

IQGAP1 promotes cell motility and invasion

IQGAP1: a key regulator of adhesion and migration

ATG9A is overexpressed in triple negative breast cancer and its in vitro extinction leads to the inhibition of pro-cancer phenotypes

Mitochondrial Rab GAPs govern autophagosome biogenesis during mitophagy

AP-4 mediates export of ATG9A from the trans-Golgi network to promote autophagosome formation

Plasma membrane damage causes NLRP3 activation and pyroptosis during Mycobacterium tuberculosis infection

β-coronaviruses use lysosomes for egress instead of the biosynthetic secretory pathway

Atg9a deficiency causes axon-specific lesions including neuronal circuit dysgenesis

Improved vectors and genome-wide libraries for CRISPR screening

Repair of injured plasma membrane by rapid Ca 2+ -dependent endocytosis

A plasma membrane wound proteome: reversible externalization of intracellular proteins following reparable mechanical damage

Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores

A novel tetanus neurotoxin-insensitive vesicle-associated membrane protein in SNARE complexes of the apical plasma membrane of epithelial cells

Sequential super-resolution imaging using DNA strand displacement

Sequential superresolution imaging of multiple targets using a single fluorophore

Fast, single-molecule localization that achieves theoretically minimum uncertainty

Simultaneous multiple-emitter fitting for single molecule super-resolution imaging

Electron microscopy using the genetically encoded APEX2 tag in cultured mammalian cells

Ultrastructural characterization of membrane rearrangements induced by porcine epidemic diarrhea virus infection

Sample size was determined to be adequate based on the magnitude and consistency of measurable differences between groups. For all experiments, we followed the routine practice in the similar studying fields. Experiments were independently repeated at least three times as indicated in the manuscript

Data exclusions No data were excluded

Replication Each experiment was conducted with biological replicates and repeated multiple times. The reproducibility of the experimental findings were verified by performing at least two more independent experiments

Microscopic images were acquired randomly and for high content microscopy were collected and analyzed in operator-independent machine/computer-driven acquisition and data analysis mode. No randomization of mice was done for BMMs. They were age and sex-matched whenever possible

Blinding The investigators were not blinded during the experiments and outcome assessment because all the data were conducted based on random sampling. The high content microscopy data were acquired and analyzed in an operator-independent mode, no blinding was needed. Reporting for specific materials

We require information from authors about some types of materials, experimental systems and methods used in many studies. Here, indicate whether each material, system or method listed is relevant to your study

:1000 for WB) from Sigma Aldrich; beta-actin (C4) (1:1000 for WB), c-myc (sc-40) (1:500 for WB), HA-probe (12CA5) (1:1000 for WB) from Santa Cruz Biotechnology

Validation Antibodies for Western blotting and immunofluorescence were validated with the use of positive and negative controls (knockouts, knockdowns and through the use of control cell lines), and following manufacturer's protocol: -anti GFP (ab290) has been validated by western blot and immunofluorescence from cells expressing transiently GFP-tagged plasmids in this study and over 2000 other publications referenced in the manufacturer's webiste

(ab1299) has been validated by immunofluorescence as the labeling was showing a Golgi apparatus localization. This antibody has been also validated by others as in DOI

-anti TSG101 (ab83) has been validated by knockdown in this paper. This antibody has also been validated by knockdown

-anti IQGAP1 (CST #20648) has been validated by KD using western blot in this paper. -anti FLAG M2 (Sigma F1804) has been validated by western blot and immunofluorescence using cells transiently transfected with FLAG-tagged plasmids in this study and previously used for IP/WB

?requestFrom=search) -anti c-myc (SCB, sc-40) was validated by western blot from cells expressing transiently c-myc-tagged plasmids in this study

-AP) has been KO validated by western blot in this study but also KD validated by others (DOI: 10.1096/ fj.202000657R) -ATG2B (Proteintech, 25155-1-AP) has been KO validated by western blot in this study but also KD validated in DOI: 10.1096/ fj.202000657R and KO

Proteintech, 10477-1-AP) has been KD validated by western blot in this study. It has also been KD validated by others such as

MCF-7 ATG9A WT and KO cells were a gift from Marja Jäättelä. The parental MCF-7 cells were from Marja Jäättelä. U2OS ATG2A, ATG2B and ATG9A KO were a gift from Fulvio Reggiori. Parental U2OS cells were a kind gift from Prof

Authentication None of the cell lines were authenticated

Mycoplasma contamination Cells were tested negative for mycoplasma contamination

The authors declare no competing interests.

Extended data is available for this paper at https://doi.org/10.1038/s41556-021-00706-w.

The online version contains supplementary material available at https://doi.org/10.1038/s41556-021-00706-w.Correspondence and requests for materials should be addressed to V.D.Reprints and permissions information is available at www.nature.com/reprints. 

Extended Data Fig. 1 | ATG9A protects different cell lines against plasma membrane damage. a, HCM image examples (white masks, algorithm-defined cell boundaries; yellow masks, computer-identified PI + nuclei) of PM permeabilization (saponin (Sap) and streptolysin O (SLO)) in ATG9A Huh7-WT and ATG9A Huh7-KO cells. Scale bars, 10 µm. b,c, HCM complementation analysis of PM permeabilization sensitivity (Dig) in ATG9A Huh7-KO transfected with b, GFP or GFP-ATG9A or c, FLAG-ATG9A increasing concentrations. PI + cells quantified after gating on GFP + or FLAG + cells (HCM, mean± SEM, n=5 (b), n=6 (c) biologically independent samples, two-way ANOVA Sidak's test (b) or unpaired t test (c). d, Example of HCM images of ATG9A Huh7-WT and ATG9A Huh7-KO cells. PMHAL assay (Dig). Yellow masks, computer-identified GFP-MIL + puncta. Scale bars, 10 µm. e,f, HCM PMHAL analysis of ATG9A Huh7-WT and ATG9A Huh7-KO cells (Dig, MPL staining). e, Yellow masks, computer-identified GFP-MPL + puncta. Scale bars, 10 µm. f, Graph, HCM PMHAL quantification of GFP-MPL + puncta/cell (mean±SEM, n=5 biologically independent samples, two-way ANOVA Sidak's test). g, HCM analysis of PM permeabilization (FITC-Dextran-10k -Dx-10) in ATG9A Huh7-WT and ATG9A Huh7-KO cells upon PM damage (Dig). Data, % of cells positive for Dx-10 (mean±SEM, n=5 biologically independent samples, two-way ANOVA Sidak's test). h, HCM analysis of the endocytic pathway (DQ-Red BSA) in ATG9A Huh7-WT and ATG9A Huh7-KO cells upon PM damage (Dig). Data, number of DQ-Red BSA profiles/cell (mean±SEM, n=5 biologically independent samples, two-way ANOVA Sidak's test). i, HCM quantification of the overlap area between GFP-Rab5 (WT or Q79L mutant) and LBPA in ATG9A Huh7-WT and ATG9A Huh7-KO cells. Data, mean±SEM; n=6 biologically independent samples, two-way ANOVA Sidak's test. j, Confocal images of LBPA (red) in ATG9A Huh7-WT and ATG9A Huh7-KO cells transiently expressing GFP-Rab5 (WT or Q79L, green). Scale bars, 10 µm. k,l, Analysis of PM tension in ATG9A Huh7-WT and ATG9A Huh7-KO cells using the Flipper-TR ® probe (Fluorescence lifetime microscopy, FLIM). k, Representative images of the average fluorescence lifetime of Flipper-TR ® . Color scale from 2 to 6 ns. Scale bars, 10 µm. l, quantification of the average lifetime of Flipper-TR from full images (mean±SEM, n=5 independent images, unpaired t test). m, HCM analysis of calcein + cells (Live/Dead TM 30 min staining prior to Dig treatment) in ATG9A Huh7-WT and ATG9A Huh7-KO cells (washed with 5 mM EGTA and incubated in a Ca 2+ -free HBSS medium with (+) or without (-) added 3.6 mM Ca 2+ ). Data, % of cells positive for calcein (mean±SEM; n=5 biologically independent samples, two-way ANOVA Sidak's test). 

Extended Data Fig. 3 | Plasma membrane damage induces ATG9A translocation to PM. a, Confocal images of FLAG-ATG9A (red) localization to PM (MyrPalm-EGFP, green) during its damage (SLO, GBI or Sap) in HeLa cells. Scale bars, 10 µm. b, Quantification (super resolution TIRF) of the distance between FLAG-ATG9A and MyrPalm-EGFP clusters before and after PM damage (Dig). c, Cell surface biotinylation analysis of ATG9A in HEK293T cells transiently expressing GFP-ATG9A (Starvation, EBSS or PM damage: Dig, SLO or GBI). GFP-ATG9A (IP anti GFP) analyzed by Streptavidin-HRP immunoblotting. One of 3 biologically independent experiments. d, TIRF microscopy images of FLAG-ATG9A (red) recruitment to PM (MyrPalm-EGFP, green) upon Dig in cells pretreated with NEM or DTT, as indicated. Scale bars, 5 µm. e,f, Quantification of ATG9A recruitment to PM in TIRF field upon Dig and/or NEM treatment. e, FLAG-ATG9A fluorescence intensity and f, ratio of FLAG-ATG9A puncta intensity with fluorescence intensity in TIRF field. Data, mean±SEM; n=10 biologically independent cells, unpaired t test. g, HCM analysis of PM permeabilization (PI, Dig) in ATG9A Huh7-WT and ATG9A Huh7-KO cells pre-treated with NEM or DTT as indicated. Data, % of cells positive for PI (mean±SEM, n=6 biologically independent samples, unpaired t test). h, Schematic of the stable cell line HEK293T APEX2-ATG9A constructed in HEK293T Flp-In cells, expressing integrated FLAG-APEX2-ATG9A inducible by tetracycline. i-n, HEK293T APEX2-ATG9A cells were exposed (j-n) or not (i) to Dig. i and j, overviews. k-n, magnification of areas showing deposits of diaminobenzidine (APEX2 activity product of APEX2-ATG9A) without or with adjacent diaminobenzidine-positive vesicles/tubulo-vesicular structures. E, endosome; N, Nucleus; PM, plasma membrane; white arrowheads highlight regions of the PM where APEX2-ATG9A is concentrated. Scale bars, 1 µm (i, j, n), 250 nm (Panels k-m). o, Schematic summary of the findings in Extended Data 

Extended Data Fig. 4 | ATG9A translocation to plasma membrane protects cells from PM damage. a, Examples of HCM images of HeLa cells expressing GFP-ATG9A WT or GFP-ATG9A Y8F (green) subjected to PI staining (red) after Dig treatment. Red masks, computer-identified PI + nuclei on GFP + cells. Scale bars, 10 µm. b, Confocal images of ATG9A localization in HeLa cells expressing FLAG-ATG9A (red) and MyrPalm-EGFP (green), serum-starved for 24 h, and then stimulated with hEGF for 30 min. Non-starved cells: full media (FM) used as control. Scale bars, 10 µm. c, HCM quantification of PM permeabilization (PI, Dig) in HeLa cells expressing GFP-ATG9A, serum-starved and stimulated with hEGF. Data, % of GFP + cells that are PI + (mean±SEM; n=5 biologically independent samples, two-way ANOVA Sidak's test). d, HCM analysis of PM permeabilization (PI, Dig) in ATG9A U2OS-WT and ATG9A U2OS-KO cells serum-starved for 24 h, and then stimulated with hEGF for 30 min. Non-starved cells: full media (FM) used as control. Data, % of cells positive for PI (mean±SEM, n=5 biologically independent samples, two-way ANOVA Tukey's test). e, Schematic summary of the findings in Fig. 3f,g. f 

Extended Data Fig. 9 | Analysis of additional ATG9A interactors and ATG9A M33 mutant in defense against PM damage. a, Confirmation by immunoblotting of CRISPR-Cas9 in ATG2A U2OS-KO cells. One of 3 independent experiments. b, Confirmation by immunoblotting of CRISPR-Cas9 in ATG2B U2OS-KO cells. One of 3 independent experiments. c, Graph, HCM quantification of PM permeabilization (PI, Dig) in ATG2A U2OS-KO , ATG2B U2OS-KO and ATG9A U2OS-KO cells. Data, % of total cells that are PI + cells (mean±SEM; n=3 biologically independent samples, two-way ANOVA Sidak's test). d,e, HCM quantification of PM permeabilization (PI, d) and cell viability (LDH release in the supernatant, e) in ATG2A U2OS-KO , ATG2B U2OS-KO and ATG9A U2OS-KO cells after LPS electroporation. Data, % of total cells that are PI + cells (d, HCM; e, % LDH release quantified, mean±SEM; n=6 biologically independent samples, unpaired t test). f, Confirmation by immunoblotting of PI4KB KD in HeLa cells (one of 3 independent experiments). g, Graph, HCM quantification of PM permeabilization (PI, Dig) in PI4KB KD cells. Data, % of total cells that are PI + cells (mean±SEM; n=5 biologically independent samples, two-way ANOVA Sidak's test). h, HCM complementation analysis of PM permeabilization sensitivity (Dig) in ATG9A Huh7-KO transfected with ATG9A-FLAG (WT or M33 scramblase mutant). PI + cells quantified after gating on FLAG + cells (HCM, mean± SEM, n=6 biologically independent samples, unpaired t test). i, Immunoblot confirmation of Rab7 KD in HeLa cells. One of 3 biologically independent experiments. j, HCM quantification of PM permeabilization (PI, Dig) in HeLa cells after Rab7 KD. Data, % of cells positive for PI (mean±SEM; n=6 biologically independent samples, two-way ANOVA Sidak's test). k, CoIP (anti-GFP) analysis of FLAG-ATG9A and GFP-AP2M1 interaction during PM damage (Dig, HEK293T, one of 3 independent experiments). l, CoIP (anti-GFP) analysis of FLAG-ATG9A and GFP-AP4M1 interaction during PM damage (Dig, HEK293T, one of 3 independent experiments). m, Bimolecular fluorescence complementation assay schematic for analysis of ALIX and ATG9A association with split Venus fluorescent protein. ALIX and ATG9A were respectively fused with the N-terminal (VN ALIX ) and C-terminal (VC ATG9A ) fragments of Venus and expressed in HeLa cells. Venus fluorescence corresponding to ALIX and ATG9A association was then assessed by HCM and confocal microscopy. n, Confocal images of ATG9A and ALIX association using the bimolecular fluorescence complementation assay (VN ALIX +VC ATG9A =green) during PM damage (Dig). GM130 (Golgi staining, red). Scale bars, 10 µm. o, p, HCM quantification of (o) ATG9A and ALIX association and (p) their overlap with PM using the bimolecular fluorescence complementation assay, during PM damage (Dig). HeLa cells transiently expressing VN ALIX and VC ATG9A were labelled with cell outline/plasma membrane stain CellMask reagent. Data, HCM quantification of (o) Venus puncta and (p) the overlap area between Venus puncta and CellMask (mean±SEM; n=5 biologically independent samples, one-way ANOVA Dunnett's test). q, HCM quantification of cytosolic PI staining in ATG9A Huh7-WT and ATG9A Huh7-KO cells without damage (mean±SEM; n=6 biologically independent samples, unpaired t test).

Extended Data Fig. 10 | Analyses of ATG9A-dependent processes during PM damage. a, Time-lapse confocal images of GFP-ATG9A (magenta hot) and propidium iodide (blue) upon laser-induced PM damage (ROI, yellow rectangle). Insets, ATG9A distribution at site of PM damage. Green ROI (2'10") indicate organization of GFP-ATG9A bordering with damaged areas. Scale bar, 10 µm. b, Example images (Dig) obtained from videos during nanoparticle tracking analysis. c, Particle distribution ("D"-values) in the supernatant of ATG9A Huh7-WT and ATG9A Huh7-KO cells (Dig). D10, D50 and D90 values reflect the diameter of the particles, whereby 10%, 50% or 90% of all particles is below the size indicated on the y-axis. Data, mean±SEM; n=5 biologically independent samples, two-way ANOVA Sidak's test. d, Immunoblotting analysis of enriched extracellular vesicles (EVs) present in the supernatants of ATG9A Huh7-WT and ATG9A Huh7-KO cells (Dig) expressing GFP or MyrPalm-EGFP and immunoblotted for GFP and CD63 (one of 3 independent experiments). e, Example of HCM images showing PM permeabilization (PI) of ATG9A Huh7-WT and ATG9A Huh7-KO cells exposed to virulent Mycobacterium tuberculosis Erdman; mutliplicity of infection (MOI; bacteria to cells ratio) 0 (Ctrl), 5 or 10. red masks, computer-identified PI + nuclei. Scale bars, 10 µm. f, HCM quantification of PM permeabilization (PI) in ATG9A Huh7-WT and ATG9A Huh7-KO cells exposed to a nonvirulent derivative of M. tuberculosis subspecies bovis (BCG), mutliplicity of infection (MOI) 0 (Ctrl) or 10. Data, % of cells positive for PI (mean±SEM; n=6 biologically independent samples, two-way ANOVA Sidak's test). g, Example of HCM images relative to f. Scale bars, 10 µm.Commonly misidentified lines (See ICLAC register) No cell lines used are listed in the database of commonly misidentified cell lines.

Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research Laboratory animals Atg9afl/fl LysM-Cre mice (males or females, 3 weeks old) were used in this study to produce Bone Marrow-derived macrophages isolated from femurs.

The study did not involved wild animals.Field-collected samples The study did not involve samples collected from the field.

Experiments were conducted in accordance with the guidelines and a protocol approved by the University of New Mexico, Albuquerque, Institutional Animal Care and Use Committee.Note that full information on the approval of the study protocol must also be provided in the manuscript.