key: cord-1032323-eir7qova
authors: Bedotto, Marielle; Fournier, Pierre-Edouard; Houhamdi, Linda; Levasseur, Anthony; Delerce, Jeremy; Pinault, Lucile; Padane, Abdou; Chamieh, Amanda; Tissot-Dupont, Hervé; Brouqui, Philippe; Sokhna, Cheikh; Azar, Eid; Saile, Rachid; Mboup, Souleymane; Bitam, Idir; Colson, Philippe; Raoult, Didier
title: Implementation of an in-house real-time reverse transcription-PCR assay for the rapid detection of the SARS-CoV-2 Marseille-4 variant
date: 2021-03-31
journal: J Clin Virol
DOI: 10.1016/j.jcv.2021.104814
sha: 2c8c6bc1b16f1a5c8abcfe728c7971369237990e
doc_id: 1032323
cord_uid: eir7qova

INTRODUCTION: The SARS-CoV-2 pandemic has been associated with the occurrence since summer 2020 of several viral variants that overlapped or succeeded each other in time. Those of current concern harbor mutations within the spike receptor binding domain (RBD) that may be associated with viral escape to immune responses. In our geographical area a viral variant we named Marseille-4 harbors a S477 N substitution in this RBD. MATERIALS AND METHODS: We aimed to implement an in-house one-step real-time reverse transcription-PCR (qPCR) assay with a hydrolysis probe that specifically detects the SARS-CoV-2 Marseille-4 variant. RESULTS: All 6 cDNA samples from Marseille-4 variant strains identified in our institute by genome next-generation sequencing (NGS) tested positive using our Marseille-4 specific qPCR, whereas all 32 cDNA samples from other variants tested negative. In addition, 39/42 (93%) respiratory samples identified by NGS as containing a Marseille-4 variant strain and 0/26 samples identified as containing non-Marseille-4 variant strains were positive. Finally, 2,018/3,960 patients SARS-CoV-2-diagnosed in our institute, 10/277 (3.6%) respiratory samples collected in Algeria, and none of 207 respiratory samples collected in Senegal, Morocco, or Lebanon tested positive using our Marseille-4 specific qPCR. DISCUSSION: Our in-house qPCR system was found reliable to detect specifically the Marseille-4 variant and allowed estimating it is involved in more than half of our SARS-CoV-2 diagnoses since December 2020. Such approach allows the real-time surveillance of SARS-CoV-2 variants, which is warranted to monitor and assess their epidemiological and clinical characterics based on comprehensive sets of data.

We aimed to implement an in-house one-step real-time reverse transcription-PCR (qPCR) assay with a hydrolysis probe that specifically detects the SARS-CoV-2 Marseille-4 variant. Discussion. Our in-house qPCR system was found reliable to detect specifically the Marseille-4 variant and allowed estimating it is involved in more than half of our SARS-CoV-2 diagnoses since December 2020. Such approach allows the real-time surveillance of SARS-CoV-2 variants, which is warranted to monitor and assess their epidemiological and clinical characterics based on comprehensive sets of data. 

Since the onset of the SARS-CoV-2 pandemic in December 2019 in China, almost 100 million cases have been reported worldwide as on January 28 th , 2021 (https://www.ecdc.europa.eu/en/covid-19-pandemic). This has been associated with the J o u r n a l P r e -p r o o f occurrence since summer 2020 of several viral variants that overlapped or succeeded each other in time [1] [2] [3] . Those of current concern harbor mutations within the spike glycoprotein, particularly within the spike receptor binding domain (RBD) that leads to viral entry into host cells by binding to the ACE2 receptor ( Figure 1 ) [4] . Such SARS-CoV-2 variants include the 20I/501Y.V1 [3] , 20H/501Y.V2 [5] , and 20J/501Y.V3 [6] strains that harbor a N501Y substitution in the spike RBD and were reported in the UK and in South Africa, as highly transmissible, and in Brazil, respectively. In our geographical area we detected 10 viral variants since June 2020 [1] . One of them, we named Marseille-4, harbors a S477N substitution in the spike RBD that has been associated with an improved binding affinity to ACE2 [6] and a broad resistance to monoclonal neutralizing antibodies [7] . It predominates in Marseille since August 2020, has been reported to spread in Europe since early summer and was classified as the Nextstrain 20A.EU2 lineage [1, 2] . The continuous emergence of new SARS-CoV-2 variants, including some of substantial concern regarding their transmissibility and their possible ability to evade immune responses [8] [9] [10] , warrants to set up strategies for their detection and surveillance. SARS-CoV-2 incidence is currently substantial in several countries including France, and in our institute we for instance diagnose >100 new cases daily. Therefore, alternative strategies to sequencing are useful for variant screening. We aimed to implement an in-house one-step real-time reverse transcription-PCR (qPCR) assay that specifically detects the SARS-CoV-2 Marseille-4 variant.

SARS-CoV-2 genomes from our institute sequence database and from the GISAID database (https://www.gisaid.org/ [11] ) were used to design a primer pair and a hydrolysis probe. These sequences target a fragment of the nsp4 gene that contains nucleotide position 

Our in-house qPCR system was found reliable to detect specifically the Marseille-4 variant and allowed estimating it is involved in more than half of our SARS-CoV-2 diagnoses since December 2020. This assay is currently routinely used in our clinical microbiology and virology laboratory to screen systematically all samples found SARS-CoV-2-positive using the first-line qPCR diagnosis assay, which allows the real-time classification of viral strains in about half of the diagnoses (Figure 2 ). In case of negativity of this Marseille-4 specific qPCR, samples are tested using alternative qPCR assays that are specific to other variants that circulate at a lower incidence level than the Marseille-4 variant, or they are submitted to nextgeneration sequencing in case of cycle threshold value (Ct) <18 with the SARS-CoV-2 qPCR diagnosis test [1, 12] . Such approach based on qPCR assays targeting specifically SARS-CoV-2 variants allows their real-time surveillance, which is warranted to monitor and assess their epidemiological and clinical characterics based on comprehensive sets of data. In addition, in-house qPCR assays can be implemented rapidly, easily and at low cost on various 

The authors have no conflicts of interest to declare. Funding sources had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation, review, or approval of the manuscript.

This study has been approved by the ethics committee of our institution (N°2020-029). 

Emergence and outcome of the SARS-CoV-2 "Marseille-4" variant

Emergence and spread of a SARS-CoV-2 variant through Europe in the summer of

Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom

Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein

Emergence of a SARS-CoV-2 variant of concern with mutations in spike glycoprotein

SARS-CoV-2 receptor binding mutations and antibody-mediated immunity

Identification of SARS-CoV-2 spike mutations that attenuate monoclonal and serum antibody neutralization

Confirmed Reinfection with SARS-CoV-2 Variant VOC-202012/01

Evidence of SARS-CoV-2 reinfection with a different genotype

Reinfection with SARS-CoV-2: Implications for vaccines

Data, disease and diplomacy: GISAID's innovative contribution to global health

Rapid Scanning Electron Microscopy Detection and Sequencing of Severe Acute Respiratory Syndrome Coronavirus 2 and Other Respiratory Viruses

Systematic testing of RNA extracts obtained from nasopharyngeal samples of patients newly-diagnosed with SARS-CoV-2 was implemented in our institute from January 1st, 2021 using our Marseille-4 specific qPCR assay. TABLE Table 1. Primers and probe of the Marseille-4 variant-specific qPCR Name Sequence

Probe (6FAM-labelled): Pro_IHU_ C4_5_MBP CCTTATTTCATTCACTGTACTCTG 9

This manuscript text has been edited by a native English speaker.