key: cord-1029376-3jhka8wl
authors: Zhang, Jialin; Chen, Jianfei; Liu, Ye; Da, Shi; Shi, Hongyan; Zhang, Xin; Liu, Jianbo; Cao, Liyan; Zhu, Xiangdong; Wang, Xiaobo; Ji, Zhaoyang; Feng, Li
title: Pathogenicity of porcine deltacoronavirus (PDCoV) strain NH and immunization of pregnant sows with an inactivated PDCoV vaccine protects 5‐day‐old neonatal piglets from virulent challenge
date: 2019-09-30
journal: Transbound Emerg Dis
DOI: 10.1111/tbed.13369
sha: c58ab09c8c9068b939850a5e78e5c8613dcf4afb
doc_id: 1029376
cord_uid: 3jhka8wl

In this study, the pathogenicity of porcine deltacoronavirus (PDCoV) strain NH (passage 10, P10) was evaluated. We found that PDCoV strain NH is enteropathogenic in 5‐day‐old pigs. Pathogenicity experiments provided a challenge model for studying the protection efficiency of passive immunity. In order to investigate the protective efficacy of passive immunity in newborn piglets, pregnant sows were vaccinated with either a PDCoV‐inactivated vaccine at the Houhai acupoint (n = 5) or DMEM as a negative control (n = 2) using a prime/boost strategy 20 and 40 days before delivery. PDCoV spike (S)‐specific IgG and neutralizing antibody (NA) responses were detected in immunized sows and piglets born to immunized sows. PDCoV spike (S)‐specific sIgA was also detected in the colostrum and milk of immunized sows. Five days post‐farrowing, piglets were orally challenged with PDCoV strain NH (10(5) TCID(50)/piglet). Severe diarrhoea, high levels of viral RNA copies and substantial intestinal villus atrophy were detected in piglets born to unimmunized sows. Only 4 of 31 piglets (12.9%) born to immunized sows in the challenge group displayed mild to moderate diarrhoea, lower viral RNA copies and minor intestinal villi damage compared to piglets born to unimmunized sows post‐challenge. Mock piglets exhibited no typical clinical symptoms. The challenge experiment results indicated that the inactivated PDCoV vaccine exhibited 87.1% protective efficacy in the piglets. These findings suggest that the inactivated PDCoV vaccine has the potential to be an effective vaccine, providing protection against virulent PDCoV.

States Wang, Byrum, & Zhang, 2014) , followed by subsequent outbreaks in Canada (Ojkic et al., 2015) , South Korea (Lee et al., 2016) , Thailand (Janetanakit et al., 2016; Saeng-chuto et al., 2017) and mainland China (Dong et al., 2015) , exhibiting a global distribution trend. Additionally, clinical reports have indicated that PDCoV exhibits enteropathogenicity, causing severe diarrhoea and vomiting in roughly 5-to 10-day-old gnotobiotic and conventional piglets . Pathological damage to the intestine, primarily in the jejunum and ileum, was characterized by intestinal villi atrophy and shortening and was confirmed by the pathogenicity experiments Wang, Hayes, Sarver, Byrum, & Zhang, 2016) . Such changes are clinically difficult to distinguish from the pathological changes caused by the porcine epidemic diarrhoea virus (PEDV) and transmissible gastroenteritis virus (TGEV) (Jung et al., 2016; Zhang, 2016) . PDCoV infections have resulted in great economic losses for the global swine industry. Therefore, fast and effective preventive measures are essential for the prevention and control of PDCoV. Currently, implementing vaccines remain the most effective means of disease control; however, there are no commercial vaccines available for PDCoV.

Due to their immature immune system, neonatal piglets are highly susceptible to viral infection during their first few weeks of life. Studies suggest that passive immunity is the most effective approach for protecting piglets from viral infection (Langel, Paim, Lager, Vlasova, & Saif, 2016; Leidenberger et al., 2017) . Immunized sows can transfer antibodies against enteroviruses (e.g. PEDV, TGEV and porcine rotavirus) to neonatal piglets through their colostrum and milk. The protective efficiency of passive immunization has a high positive correlation with antibody levels in the colostrum and milk (Sestak, Lanza, Park, Weilnau, & Saif, 1996) . Therefore, passive immunity of newborn piglets can be achieved by immunizing sows that produce high levels of neutralizing antibodies (NA) and transfer these antibodies through the colostrum and milk to the nursing piglets, which may be an effective means of controlling viral infection.

In this study, a challenge model was established and the results indicated that PDCoV strain NH (P10) is pathogenic to 5-day-old specific pathogen-free (SPF) piglets. Then, an inactivated PDCoV vaccine was prepared and the immune responses and protective efficiency of the inactivated PDCoV vaccine in pregnant sows was evaluated. After two doses of the vaccine, pregnant sows produced strong IgG and NA responses specific to PDCoV S proteins. High levels of IgG antibodies and NA were also detected in the serum of neonatal piglets born to immunized sows, which suggests that the antibodies were successfully transferred through the colostrum and milk. Five-day-old piglets were challenged with virulent PDCoV to assess the protective efficacy of the vaccine, and the findings indicated that the inactivated PDCoV vaccine provided 87.1% protective efficacy.

PDCoV strain NH was isolated from PDCoV-positive specimens with LLC-PK cells (ATCC ® CL-101™), and plaques were purified twice.

PDCoV strain NH was continuously passaged in swine testis (ST) cells in DMEM containing 10 μg/ml tosylsulfonyl phenylalanyl chloromethyl ketone (TPCK)-trypsin (Invitrogen). At 36 hr post-infection, both the supernatant and cells were harvested, titrated and stored at −70°C for future analyses. The titre of PDCoV strain NH (10th passage, P10) was 10 5 TCID 50 /mL, which was used for the challenge experiment. The inactivated PDCoV vaccine was prepared using the 15th generation of viruses due to its low mutation rate and similar antigenicity compared to the parent virus. Viral culture supernatants were inactivated with beta-propiolactone containing aluminium hydroxide adjuvant at a 1:1 ratio in order to prepare the inactivated PDCoV vaccine.

Ten 5-day-old SPF piglets were confirmed negative for PDCoV, PEDV, TEGV and RPV by virus-specific PCR. Pigs were maintained in germ-free isolation units of the animal facility located at the Harbin Veterinary Research Institute under standard conditions prescribed by the Institutional Guidelines. Piglets were fed suckling piglet formula every 3 hr. Six of the 10 SPF piglets (piglets #245, #246, #248, #241, #242 and #249) were assigned to the PDCoV-inoculation group, which were orally inoculated with the PDCoV strain NH (P10) (10 4 TCID 50 /pig). The remaining 4 piglets (piglets #244, #247, #251 and #252) were orally inoculated with volume-matched virus-negative culture medium and served as the negative control group. The clinical signs of vomiting and diarrhoea were evaluated every 12 hr. The level of diarrhoea severity was scored for each piglet using the following criteria: 0 = no vomiting or diarrhoea; 1 = mild; 2 = moderate; 3 = severe. Faecal swabs were collected for detecting viral RNA. Duplicate tissues for the duodenum, jejunum, ileum, caecum, colon and rectum were collected for viral RNA detection and histological examinations.

Seven sows were confirmed to be negative for PDCoV, PEDV, TEGV and RPV using virus-specific PCR and a serum neutralization test.

All of the sows were randomly assigned to 2 experimental groups:

(1) the immunization group (PDCoV-inactivated vaccine; n = 5); or (2) the control group (DMEM; n = 2). Sows from the immunization group were immunized with 3 ml inactivated PDCoV vaccine (PDCoV strain NH P15, equivalent to 10 × 10 5 TCID 50 ) at the Houhai acupoint (a concave part between the anus and tail). Vaccination in the Houhai acupoint was found to be helpful for inducing humoral and mucosal immune responses (Li et al., 2018; Liu, Tan, Wan, Zuo, & Liu, 1998) . All of the sows were immunized 40 days prior to delivery, and a booster was administered 20 days before delivery. Sows from the control group were immunized with 3 ml DMEM as described above (Table 1) . Serum was collected from sows 0 (prior to the first immunization), 20, 40, 47, 54 and 61 days post-immunization. Serum samples were inactivated at 56°C for 30 min and stored at −70°C for future analyses. Milk was collected from the sows 1-5 days post-farrowing.

Three 5-day-old piglets from each PDCoV-vaccinated gilts or mock gilts were permitted to continue drinking breast milk in order to detect the level of serum antibodies in piglets, while the other piglets were separated from the sows and housed in the experimental animal centre. Separated piglets were fed suckling piglet formula every 3 hr.

Newborn piglets (2 or 4 piglets from each sow were set as the control group) derived from PDCoV-vaccinated gilts or mock gilts were challenged orally with 10 5 TCID 50 of PDCoV strain NH (P10). The clinical signs of vomiting and diarrhoea were evaluated daily. Diarrhoea severity was scored for each piglet using the following criteria: 0 = no vomiting or diarrhoea; 1 = mild; 2 = moderate; 3 = severe. Faecal swabs were collected for the detection of viral RNA. Serum was collected from the breastfed piglets 5, 12, 19 and 26 days post-birth.

The study protocol was approved by the Institutional Animal Care and Use Committee of the Harbin Veterinary Research Institute.

Faecal swabs were centrifuged at 5,000×g for 10 min at 4°C, and 140 μl supernatant was collected for viral RNA extraction. Viral RNA was extracted using a QIAamp ® Viral RNA mini kit (QIAGEN, Hilden, Germany) following the manufacturer's instructions. One hundred mg tissue samples from each piglet were ground in liquid nitrogen, and the total RNA was extracted using an RNAiso Plus kit (Takara, Kusatsu, Japan) following the manufacturer's instructions.

RNA was then used to perform real-time (RT)-qPCR using specific primers and probes (PDCoV-N-F: CGCTTAACTCCGCCATCAA;

PDCoV-N-R: TCTGGTGTAACGCAGCCAGTA; PDCoV-N-probe: FAM-CCCGTTGAAAACC-MGB) as previously described with minor modifications (Ma et al., 2015) . Briefly, 2 μl RNA was used in a 20 μl PCR reaction system using a One Step PrimeScript™ RT-PCR kit (Takara, Kusatsu, Japan) in a LightCycler 480 (Roche Applied Science, IN, USA) under the following conditions: one cycle at 95°C for 5 min and 95°C for 10 s, followed by 40 cycles at 95°C for 5 s and 60°C for 20 s.

The duodenum, jejunum, ileum, caecum, colon and rectum tissues were cut into 10-μm-thick sections, mounted onto glass slides and blocked with 5% non-fat dry milk in PBS for 60 min at 37°C. Then, slides were incubated for 60 min with a mouse polyclonal anti-PDCoV S antibody followed by incubation with an Alexa Fluor ® 680 Donkey Anti-Mouse IgG (Sigma-Aldrich, MO, USA) for 60 min.

Nuclei were stained with DAPI, and samples were observed with an inverted fluorescence microscope.

Tissues from intestinal tissues were fixed in formalin for 48 hr and embedded in paraffin wax following standard methods. IHC detection of PDCoV antigens was performed using an anti-PDCoV-N monoclonal antibody prepared in the laboratory followed by an incubation period with horseradish peroxidase (HRP)-conjugated sheep anti-mouse IgG (Sigma-Aldrich) for 40 min at room temperature. Reactions were developed with 3,3'-diaminobenzidine (DAB).

Distilled water was used to finish staining and stained with haematoxylin (HE). Dehydration, clearing and mounting were conducted with neutral gums.

The extracellular domain of the PDCoV spike gene was amplified and cloned into the pCAGG vector with a C-terminal flag tag. Recombinant S protein was expressed in 293T cells, purified using anti-DYKDDDDK G1 Affinity Resin (GenScript: L00432-1) and used as the coating antigens. PDCoV S-specific IgG, IgA and sIgA antibody responses elicited by immunization with the inactivated vaccine were assessed by an indirect enzyme-linked immunosorbent assay (ELISA). Optimal assay conditions (i.e. antigen coating concentration, serum and sow milk dilutions, and secondary dilutions) were determined by a checkerboard titration. Optimal coating concentrations for IgG, IgA and sIgA were 0.28, 0.28 and 0.07 μg/ml, respectively. Next, 96-well polystyrene microplates were coated with the optimal antigen in a bicarbonate/carbonate coating buffer overnight. Plates were washed three times with PBST (PBS with 0.05% Tween 20) and blocked with 5% non-fat dry milk at 37°C for 2 hr. Plates were washed 3 times with PBST, diluted in either serum or sow milk (1:100, 100 μl/well) and incubated at 37°C for 1 hr followed by incubation with a streptavidin-HRP-conjugated IgG or IgA antibody (1:10,000) at 37°C for 1 hr. After washing 3 times with PBST, a mouse anti-Fc fragment of sIgA molecule antibody (1:10,000) TA B L E 1 Immune procedure collected then confirmed by an immunofluorescence assay (IFA) in order to determine the cut-off value.

The levels of sow and piglet serum neutralizing antibodies were determined using PDCoV strain NH (P10) with a virus neutralization test (VNT). In order to perform the assay, serum was heated at 56°C

for 30 min for complement inactivation. Next, 100 μL of twofold serially diluted serum was mixed with 100 μl DMEM containing 100 

Data were analysed by Student's t test. A threshold of p < .05 was considered to be significant. The antibody levels of the piglets are presented as box and whisker plots created with GraphPad Prism v7.

Values are reported as the mean ± standard deviation (SD). 

Gilts were immunized twice with the inactivated PDCoV vaccine.

After eating colostrum for 5 days, piglets were divided into the challenge group, mock group and monitoring group in each sow 

The passive transfer of antibodies from immunized sows to piglets through their colostrum and milk was detected with an S-specific ELISA. A high level of S-specific IgG was detected in the serum of piglets born to immunized sows 5 days post-farrowing (Figure 3a ). 

In order to assess the protective effect of the vaccine, 5-day-old piglets (31 total) born to immunized sows and 5-day-old piglets (14 total) born to unimmunized sows were challenged with a high dose (10 5 TCID 50 ) of PDCoV strain NH (P10). Piglets (12 total) born to immunized sows and 5-day-old piglets born to unimmunized sows (4 total) were used as controls. Piglets were monitored, and clinical symptoms were scored according to their level of diarrhoea (Table 3) .

Six piglets exhibited mild to moderate diarrhoea, in which the symptoms of four piglets from the challenge group and 2 piglets from the mock group born to immunized group were due to indigestion.

Following oral inoculation with PDCoV, two piglets born to immunized sows #72 (1/5) and #56 (1/7) exhibited mild diarrhoea 2 days TA B L E 3 Pathogenicity of PDCoV in piglets No obvious clinical symptoms were observed in the mock piglets from each group.

The piglet faecal specimens were collected daily, and RNA was extracted in order to detect viral RNA copies by RT-qPCR. PDCoV RNA copies were detected in four piglets born to sows #68, #100 and #56, and low levels of viral RNA were detected in 1 piglet ( Based on PCR data from the faeces and intestinal tissues, 4 of 31 pigs from the vaccinated sows were evidently infected after virus challenge. Therefore, the passive immunity obtained from immunized sows induced 87.1% protection against highly pathogenic PDCoV challenge.

In the present study, the pathogenicity of PDCoV strain NH isolated in 2014 was assessed. The results suggest that the virus was enteropathogenic in 5-day-old SPF pigs. A challenge model to study the protective passive immunity in neonatal piglets was conducted. The protective efficacy of passive immunity elicited by the inactivated PDCoV vaccine against challenge with a highly pathogenic virulent strain in neonatal piglets born to immunized sows was investigated.

Results revealed that immunization with an inactivated PDCoV vaccine could produce a strong antibody response in pregnant sows after the second vaccination 20 days before delivery. High S-specific IgG antibody and NA responses were observed in the serum of sows post-farrowing. Interestingly, a high level of S-specific sIgA was detected in colostrum and milk, although it lasted for only a short period of time. Previous studies have indicated that sIgA was produced in the mammary gland by antibody-secreting cells and the recruitment of antibody-secreting cells into the mammary gland contribute to the production of sIgA (Wilson & Butcher, 2004) . Therefore, it has been suggested that the oral route appears to be the most effective method for eliciting a strong sIgA response when vaccinating sows (Gerdts & Zakhartchouk, 2017) . However, the findings of this study suggest that vaccination with an inactivated vaccine by injection at the Houhai acupoint in pregnant sows could also induce a strong sIgA response in the colostrum, which may subsequently provide protection for piglets against virulent challenge. Results also confirmed that vaccination at the Houhai acupoint could induce a mucosal immune response (Liu et al., 1998) . The duration of antibody persistence until the end of the experiment was monitored, and the results indicated that a strong positive correlation existed between the IgG antibody and NA responses in the serum of immunized sows.

The S-specific IgA antibody response was also detected with an ELISA; however, the results indicated that the serum, colostrum and milk of sows failed to produce an IgA response after immunization with an inactivated PDCoV vaccine.

Transferring antibodies (i.e. sIgA, IgG and IgM) from the sows to the piglets through the colostrum and milk has been considered to be the primary mechanism of protection mediated by passive immunity (Poonsuk et al., 2016; Saif & Bohl, 1983; Salmon, Berri, Gerdts, & Meurens, 2009 ). The IgG antibodies were absorbed by the piglets within the first 24-48 hr of life through the colostrum. In this study, a high level of IgG antibodies was detected in the serum of piglets and, more importantly, such levels displayed longterm persistence (~10 days) although piglets stopped consuming milk from immunized sows. These results suggest that IgG from the serum of sows could be absorbed into the serum of piglets through colostrum. The level of IgG antibodies in the serum of piglets (31 piglets, 10 days post-challenge) did not increase, which was due to the existing maternal antibodies in the serum of piglets interfering with an active immune response to infection. No S-specific sIgA antibodies were observed in the serum of piglets, which indicated that the function of sIgA was limited to the enteric cavity rather than the serum. The challenge assay suggested that antibodies transferred from sows through their colostrum and milk could provide protection for piglets. Four piglets born to immunized sows displayed diarrhoea post-inoculation with PDCoV strain NH, and viral RNA copies were detected in the faeces. However, compared to the mock group, the four piglets exhibited mild to moderate diarrhoea (no severe diarrhoea) and lower viral RNA copies in the faeces and intestinal tissues. Low PDCoV antigen levels were also detected in the jejunum and ileum by IHC, and minor intestinal villi damage was observed by HE staining. Collectively, these results suggest that the antibodies from sows could provide the 4 piglets with partial, but not complete, protection.

Previous studies on the passive immunity of TGEV suggest that viral inoculation by different routes induce different immunoglobulin isotypes (Bohl & Saif, 1975) . The production of IgA in the milk of TGEV antibodies was associated with an intestinal infection, while the production of IgG was associated with parenteral antigenic stimulation. This study also indicated that the IgG response in serum, colostrum and milk was predominantly detected after pregnant sows were inoculated with virulent TGEV by intramammary injections. Moreover, the passive immunity protection was good (0% mortality and morbidity) in 3-and 4-day-old newborn piglets born to immunized sows post-challenge. However, morbidity was 100% 11 days post-farrowing with 0% mortality after TGEV challenge. These results suggest that within the first week, IgG antibodies in colostrum and milk of immunized sows could provide protection for piglets against TGEV virulent challenge. In this study, IgA antibodies were not detected in serum, colostrum or milk of immunized sows. The immunoglobulin in the antibodies was predominantly IgG, and although the piglets were no longer receiving anti-PDCoV IgG antibodies from the milk, IgG lasted ~10 days in the serum of piglets. Because of this, the immune protection response observed in PDCoV-challenged piglets born to inactivated PDCoV-vaccinated mothers was likely due to circulating anti-PDCoV IgG antibodies that were passively transferred through colostrum rather than anti-PDCoV IgA antibodies from milk, as observed previously in PEDV research (Poonsuk et al., 2016) .

The sIgA and IgG in colostrum and milk consumed by piglets for 1-2 days post-birth survived and were maintained until challenged to some extent in the gut. In the intestinal environment of piglets born to immunized sows, VNT antibodies might neutralize PDCoV in gut and only a small amount of the virus might remain under the minimal infectious doses that could infect piglets (Poonsuk et al., 2016) . Another possible reason for this result may be due to the antibody-dependent cell-mediated cytotoxicity (ADCC) effect, which promotes cell-mediated immune responses against PDCoV, as previously studied in PEDV (Casadevall & Pirofski, 2003) .

In summary, the findings of the present study demonstrate that immunizing sows twice with an inactivated PDCoV vaccine could induce IgG, sIgA and NA responses. Piglets born to immunized sows could obtain protective antibodies by ingesting colostrum and milk.

Moreover, high levels of IgG antibodies and NA responses were detected in serum, which protected the piglets against virulent PDCoV challenge.

Passive immunity in transmissible gastroenteritis of swine: Immunoglobulin characteristics of antibodies in milk after inoculating virus by different routes

Antibody-mediated regulation of cellular immunity and the inflammatory response

Pathogenicity and pathogenesis of a United States porcine deltacoronavirus cell culture isolate in 5-day-old neonatal piglets

Porcine deltacoronavirus in mainland China

Vaccines for porcine epidemic diarrhea virus and other swine coronaviruses

Porcine deltacoronavirus

Pathogenicity of 2 porcine deltacoronavirus strains in gnotobiotic pigs

Porcine deltacoronavirus infection: Etiology, cell culture for virus isolation and propagation, molecular epidemiology and pathogenesis

Porcine epidemic diarrhea virus infection: Etiology, epidemiology, pathogenesis and immunoprophylaxis

Lactogenic immunity and vaccines for porcine epidemic diarrhea virus (PEDV): Historical and current concepts

Detection and phylogenetic analysis of porcine deltacoronavirus in Korean swine farms

Virulence of current German PEDV strains in suckling pigs and investigation of protective effects of maternally derived antibodies

A flagellin-adjuvanted PED subunit vaccine improved protective efficiency against PEDV variant challenge in pigs

Spinal segment distribution of neural innervation related to houhai acupoint and compared with zusanli and dazhui acupoints in domestic chicken

Origin, evolution, and virulence of porcine deltacoronaviruses in the United States

The first case of porcine epidemic diarrhea in Canada

Does Circulating Antibody Play a Role in the Protection of Piglets against Porcine Epidemic Diarrhea Virus?

Different lineage of porcine deltacoronavirus in Thailand, Vietnam and Lao PDR in 2015

Passive immunity to transmissible gastroenteritis virus: Intramammary viral inoculation of sows

Humoral and cellular factors of maternal immunity in swine

Contribution of passive immunity to porcine respiratory coronavirus to protection against transmissible gastroenteritis virus challenge exposure in suckling pigs

Newly emerged porcine deltacoronavirus associated with diarrhoea in swine in China: Identification, prevalence and full-length genome sequence analysis

Detection and genetic characterization of deltacoronavirus in pigs

Porcine deltacoronavirus: Histological lesions and genetic characterization

CCL28 controls immunoglobulin (Ig) A plasma cell accumulation in the lactating mammary gland and IgA antibody transfer to the neonate

Discovery of seven novel mammalian and avian coronaviruses in Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus

Porcine deltacoronavirus: Overview of infection dynamics, diagnostic methods, prevalence and genetic evolution

Pathogenicity of porcine deltacoronavirus (PDCoV) strain NH and immunization of pregnant sows with an inactivated PDCoV vaccine protects 5-day-old neonatal piglets from virulent challenge

The authors declare that there is no conflict of interest.

The study's protocol was approved by the Institutional Animal Care and Use Committee of the Harbin Veterinary Research Institute.This study does not contain research with human participants performed by any of the authors.

https://orcid.org/0000-0003-4123-0892