key: cord-1027402-yck1t3pp
authors: Kozaki, Toshinori; Kimmelblatt, Brian A.; Hamm, Ronda L.; Scott, Jeffrey G.
title: Comparison of two acetylcholinesterase gene cDNAs of the lesser mealworm, Alphitobius diaperinus, in insecticide susceptible and resistant strains
date: 2007-12-28
journal: Arch Insect Biochem Physiol
DOI: 10.1002/arch.20229
sha: ddbc806af55b50754436b1804e2d86eca599a3f2
doc_id: 1027402
cord_uid: yck1t3pp

Two cDNAs encoding different acetylcholinesterase (AChE) genes (AdAce1 and AdAce2) were sequenced and analyzed from the lesser mealworm, Alphitobius diaperinus. Both AdAce1 and AdAce2 were highly similar (95 and 93% amino acid identity, respectively) with the Ace genes of Tribolium castaneum. Both AdAce1 and AdAce2 have the conserved residues characteristic of AChE (catalytic triad, intra‐disulfide bonds, and so on). Partial cDNA sequences of the Alphitobius Ace genes were compared between two tetrachlorvinphos resistant (Kennebec and Waycross) and one susceptible strain of beetles. Several single nucleotide polymorphisms (SNPs) were detected, but only one non‐synonymous mutation was found (A271S in AdAce2). No SNPs were exclusively found in the resistant strains, the A271S mutation does not correspond to any mutations previously reported to alter sensitivity of AChE to organophosphates or carbamates, and the A271S was found only as a heterozygote in one individual from one of the resistant A. diaperinus strains. This suggests that tetrachlorvinphos resistance in the Kennebec and Waycross strains of A. diaperinus is not due to mutations in either AChE gene. The sequences of AdAce1 and AdAce2 provide new information about the evolution of these important genes in insects. Arch Insect Biochem Physiol. © 2007 Wiley‐Liss, Inc.

The lesser mealworm, Alphitobius diaperinus, is a manure-breeding beetle that is the primary structural pest of the poultry industry in the United States (Axtell, 1999; Hinton and Moon, 2003) . The lesser mealworm is also a reservoir of Salmonella typhimurium, Escherichia coli, tapeworms, avian leucosis virus, turkey coronavirus, turkey enterovirus (Avincini and Ueta, 1990; Axtell and Arends, 1990; Despins et al., 1994; Goodwin and Waltman, 1996; McAllister et al., 1996; Watson et al., 2000) , and may serve as a source of Campylobacter contamination of poultry (Bates et al., 2004) . High beetle populations consume significant amounts of bird feed (Savage, 1992) . Under dry conditions in the broiler house, beetles bite the skin of birds resting at night. To prevent these bites, birds will rest for short periods and then move (Despins et al., 1987; Vaughan and Turner, 1984) . This can affect the weight gain of chicks.

Organophosphate and carbamate insecticides have served as effective tools for control of the lesser mealworm, and tetrachlorvinphos continues to be used for this purpose in the United States. However, a recent study indicated that there were some populations of lesser mealworm in which a substantial portion of the population was highly resistant to tetrachlorvinphos (Hamm et al., 2006) . The mechanism responsible for this resistance has not been determined.

Organophosphate and carbamate insecticides exert their toxic effects via inhibition of acetylcholinesterase (AChE). Recent studies have discovered Archives of Insect Biochemistry and Physiology March 2008 that some insect species have a single Ace gene (Drosophila melanogaster and Musca domestica), while many other species have two Ace genes (Culex pipiens, Bombyx mori, Myzus persicae, among others). Beetles (Coleoptera) are the most evolutionarily successful metazoans, contributing 25% of all known animal species, far more than any other taxonomic order. Despite the diversity and economic importance of Coleoptera, Ace genes have been reported from only two beetles: Leptinotarsa decemlineata (Say) (Zhu et al., 1996) and Tribolium castaneum (http://www.hgsc.bcm.tmc/edu/projects/ tribolium/). Evidence has accumulated that indicates a limited number of mutations in Ace are as- Fig. 1 . The nucleotide and deduced amino acid sequences of AdAce1 (Drosophila Ace orthologous) cDNA (Accession no. EU086056). The residues that make intra-disulfide bonds are marked with *, oxianion hole with §, catalytic triad with +, acyl binding site with ¶, and anionic subsite with ‡. The locations of the primers used for genotyping are indicated as **. sociated with resistance (i.e., mutations that code for an organophosphate and/or carbamate insensitive AChE) in insects (Fournier, 2005; Kono and Tomita, 2006; Oh et al., 2006) . In this study we examined if there was one or two Ace genes in A. diaperinus, and if mutations in Ace could be correlated with tetrachlorvinphos resistance.

Three strains of lesser mealworm were used. The Denmark-S (susceptible) strain was obtained from Saturnia (Bjerringbrovej 48 2610 Rødovre, Denmark). Two strains (from Kennebec, Co., ME, and Waycross, GA) that contain high proportions of tetrachlorvinphos resistant individuals (Hamm et al., 2006) were also used. A. diaperinus colonies were maintained at 28°C with 60-70% RH, and provided a diet of cracked corn:wheat bran (95:5) ad libitum. Adult beetles from the Kennebec and Waycross strains were exposed to tetrachlorvinphos using a residual contact bioassay method as described previously (Hamm et al., 2006) . Beetles that survived exposure to a concentration of tetrachlorvinphos that was 350-fold greater than the susceptible strain LC 99 for 48 hr (i.e. resistant individuals) were used in genotyping.

Five Denmark-S adult beetles (84 mg) were used to isolate mRNA using a QuickPrep Micro mRNA purification kit (GE Healthcare, Waukesha, WI,), and cDNA was synthesized with 500 ng of mRNA using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). A fragment that encoded the Ace cDNA, orthologous Drosophila Ace (Fournier et al., 1989) , was amplified by S11ACE (TAYGAR-TAYTTYCCiGGiTT), S1iACE (GARATGTGGAAYCCi-AAYAC), and AS17ACE (CCiCCiCCRTAiAYCCA). A fragment that encoded the Ace-paralogous gene was amplified using DL3 (GCiACiATGTGGA AYCCiAA) and DR98 (GGYTTiCCiGTYTTiGCRAA) with the following thermal cycler program 95°C for 3 min, 35 cycles (95°C for 30 sec, 40°C for 30 sec, 72°C for 1.5 min) and a final extension at 72°C for 7 min. We obtained a fragment of 151 bp for the Drosophila Ace orthologous gene and a fragment of 825 bp for the paralogous gene. Gene specific primers for 5′-and 3′-RACE were designed based on these sequences. RACE was performed using the BD SMART RACE cDNA amplification kit (BD Biosciences, Mountain View, CA).

To compare the Ace alleles in the susceptible and tetrachlorvinphos-resistant beetles, the Ace cDNAs were sequenced from individual beetles. The mRNA was prepared using a PolyATract System 1000 (Promega, Madison, WI), and was concentrated with a Microcon YM-100 (Millipore, Billerica, MA). One fourth of the mRNA from a beetle was used in the RT-PCR (50°C for 30 sec, 94°C for 2 min, 40 cycles (95°C for 30 sec, 50°C 30 sec, and 72°C for 1 min) using the SuperScript III One-Step RT-PCR System and Platinum Taq (Invitrogen). Gene-specific primers, S54AdAce (AAGCTGCCCAATTCTTGCTA), S84AdAce (TCT-ACCTCAACATCTGGGTGCCTCAGC), and AS53AdAce (AAGCTAGGGCCATCCTTTTC) were used for the amplification of the Drosophila Ace-orthologous gene. Primers S44AdAce (GCTGAACACCACCAC-CATGC), S43AdAce (GACACGGTGTTCGGGGACTT), and AS51AdAce (GCGAACTCGTTGACGTTACA) were used to amplify the Drosophila Ace paralogous gene. DNA sequencing was performed with S84AdAce and AS53AdAce for the Drosophila Ace orthologous gene and with S43AdAce and AS51AdAce for the paralogous gene at the Cornell Biotechnology Resource Center.

We obtained the nearly complete ORFs for AdAce1 and AdAce2 (Figs. 1 and 2) . Both genes show a high similarity (95 and 93% amino acid identity, respectively) with the predicted Ace genes of T. castaneum (XP_970774.1, XP_973462.1) . Kyte-Doolittle hydropathy plots indicated the C-terminal of both AdAce1 and AdAce2 were hydrophobic (data not shown), and thus potentially exchanged for glycolipids.

The cDNA sequence of AdAce1 (the Drosophila Ace orthologous gene, EU086056) was 2,123 bp;

Archives of Insect Biochemistry and Physiology March 2008 encoding 636 amino acid resides of an immature AChE (Fig. 1) . The deduced amino acid sequence had the characteristic features of AChE, including the residues for the intra-molecular disulphide bonds (C110(67)-C137(94), C312(254)-C329(265), C465(402)-C582(521)), catalytic triad (S260(200), E389(327), H503(400)), protein dimerisation (C602), anionic subsite (W127(86)), oxianion hole (G172(118), G173(119), A261(201), and acyl binding site (W293(233), F352(290), F393(329)) (number in parentheses indicates the corresponding amino acid in Torpedo AChE). We could not unambiguously identify the translation start site because no stop codon was found in frame in the 5′ upstream region. If this transcript is similar in size to the Ace gene in the Colorado potato beetle, L. decemlineata (Zhu and Clark, 1995) , it will be more than 13 kb in size. However, AdAce1 has an initiation codon that is identical to the one tentatively identified in L. decemlineata. Given that AdAce1 does not have any of the mutations associated with organophosphate and/or carbamate resistance in Drosophila (Mutero et al., 1994) , Lucilia cuprina (Chen et al., 2001) , or M. domestica AChEs (Kim et al., 2003; Kozaki et al., 2001; Walsh et al., 2001) , we conclude that AdAce1 encodes an organophosphate-sensitive AChE (characterized by M126, V205, G287, F352, and G390). This is consistent with the Denmark-S strain being insecticide susceptible.

We sequenced 1,895 bp encoding 591 amino acids of AdAce2 (the D. melanogaster Ace paralogous AChE, EU086057) (Fig. 2) . As also found for AdAce1, Fig. 4 . Alignment of the deduced amino acid sequences from the Drosophila Ace orthologous genes in Coleoptera. Ad, Tc, and Ld represent A. diaperinus, T. castaneum, and L. decemlineata, respectively. Archives of Insect Biochemistry and Physiology March 2008 the residues for the intramolecular disulphide bonds (C76(67)-C103(94), C275(254)-C295(265), C410(402)-C532(521)), catalytic triad (S208(200), E334(327), H448(440)), protein dimerisation (C558) anionic subsite (W93(86)), oxianion hole (G126(118), G127(119), A209(201)), and acyl binding site (W241(233), F298(290), F338(331)) were found in AdAce2. We were unable to complete the 5′-RACE for AdAce2, although we tried multiple variations of the protocol given by the manufacturer, including increased or decreased cation concentration, increasing the viscosity of the reaction mix by BSA or by using an alternative cation (Mg2 + to Mn 2+ ). The alignment of this gene with the Drosophila Ace paralogous AChEs showed that, as expected for an insecticide-susceptible strain, beetles from the Denmark-S strain had an organophosphate and carbamate sensitive type.

A partial cDNA, covering the amino acid residues found to be responsible for insecticide resistance in other species, was sequenced from individual adults for both Alphitobius Ace genes to ascertain if resistance was due to a change in one or both genes. If resistance was due to a mutation in AdAce1 or AdAce2, all resistant individuals should have a unique allele (i.e., different from the susceptible strain).

The Drosophila Ace orthologous gene, AdAce1, was sequenced from two susceptible Denmark-S, four Waycross (tetrachlorvinphos-resistant), and two Kennebec (tetrachlorvinphos-resistant) adults. The deduced amino acid sequences from all individuals were the same. There were six synonymous polymorphisms detected (data not shown).

The Ace paralogous gene, AdAce2, was sequenced from three susceptible (Denmark-S), five Waycross (tetrachlorvinphos-resistant), and five Kennebec (tetrachlorvinphos-resistant) adults. The sequences from all individuals were highly similar. One of the Denmark-S and one of the Waycross beetles had a A271(261)S mutation (detected as a heterozygote in both individuals). There were an additional 10 synonymous polymorphisms identified (data not shown). Given that neither AdAce1 nor Fig. 5 . Alignments of the deduced amino acid sequences from the Drosophila Ace paralogous genes in Coleoptera. Ad and Tc represent A. diaperinus and T. castaneum, respectively.

Manure breeding insects responsible for cestodiasis in caged layer hens

Poultry integrated pest management: status and future

Ecology and management of arthropod pests of poultry

Relationship of Campylobacter isolated from poultry and from darkling beetles in New Zealand

The acetylcholinesterase gene and organophosphorus resistance in the Australian sheep blowfly, Lucilia cuprina

Transmission of enteric pathogens of turkeys by darkling beetle larvae (Alphitobius diaperinus)

Construction profiles of high rise caged layer houses in association with insulation damage caused by the lesser mealworm, Alphitobius diaperinus (Panzer) in Virginia

Mutations of acetylcholinesterase which confer insecticide resistance in insect populations

Drosophila melanogaster acetylcholinesterase gene structure, evolution and mutations

Transmission of Eimeria, viruses, and bacteria to chicks: Darkling beetles (Alphitobius diaperinus) as vectors of pathogens

Resistance to cyfluthrin and tetrachlorvinphos in the lesser Archives of Insect Biochemistry and Physiology

Alphitobius diaperinus, collected from the eastern United States

Arthropod populations in highrise caged-layer houses after three manure cleanout treatments

Cloning, mutagenesis, and expression of the acetylcholinesterase gene from a strain of Musca domestica; the change from a drug-resistant to a sensitive enzyme

Amino acid substitutions conferring insecticide insensitivity in Ace-paralogous acetylcholinesterase

Fenitroxon insensitive acetylcholinesterases of the housefly, Musca domestica, associated with point mutations

Reservoir competence of Alphitobius diaperinus (Coleoptera: Tenebrionidae) for Escherichia coli (Enterobacteriales: Enterobacteriaciae)

Resistanceassociated point mutations in insecticide-insensitive acetylcholinesterase

Expression of the Ace-paralogous acetylcholinesterase of Culex tritaeniorhynchus with an amino acid substitution conferring insecticide insensitivity in baculovirus-insect cell system

Reducing darkling beetles

Residual and topical toxicity of various insecticides to the lesser mealworm (Coleoptera: Tenebrionidae)

Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance

Limited transmission of turkey coronavirus (TCV) in young turkeys by adult lesser mealworms, Alphitobius diaperinus Panzer (Tenebrionidae)

Comparisons of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and resistant strains of Colorado potato beetle

A point mutation of acetylcholinesterase associated with azinphosmethyl resistance and reduced fitness in Colorado potato beetle

We thank D.A. Rutz for the beetles and C. Leichter, J. Briddell, and C. Reasor for technical as-sistance. The Daljit S. and Elaine Sarkaria Professorship and a research fellowship (to T.K.) from the Japanese Society for the Promotion of Science for Young Scientists supported this project.

AdAce2 were different between resistant and susceptible beetles, we conclude that the mechanism of tetrachlorvinphos resistance in these strains of A. diaperinus is not due to mutations in the Ace genes (i.e., is not an altered acetylcholinesterase).Alignments of the deduced amino acid sequences from the Drosophila Ace orthologous and paralogous genes in Coleoptera are shown in Figures 4 and 5, respectively. As expected, the Ace orthologous sequences of the two Tenebrionidae, A. diaperinus and T. castaneum, were more similar to each other than to the Leptinotarsa decemlineata (Fig. 4) . These three coleopteran sequences differed primarily at the N-and C-terminal regions, but showed expected conservation at most functionally important residues. Similarly, the Ace paralogous sequences from A. diaperinus and T. castaneum were highly similar, with the greatest number of differences found in the C-terminal region (Fig. 5) .The phylogenic tree of the Arthropod AChEs (Fig. 3) shows there are two major groups, with the Acari AChEs being intermediates. Each group is further divided into the subgroups, primarily by Order. AdAce1 and AdAce2 clustered with the other Coleoptera genes in both. This is consistent with the idea that beetles have two Ace genes. The mutations related to organophosphate resistance were first studied in D. melanogaster and M. domestica. However, studies of Drosophila Ace orthologous genes failed to identify mutations responsible for organophosphate resistance in other species. Subsequently, mutations in the Drosophila Ace paralogous genes were found to be associated with the resistance in some mosquitoes. The increasing number of insect genome sequences reveal that the ancestral condition, at least in Pterygota, is two copies of Ace. It also appears that mutations on the Drosophila and Musca Ace paralogous genes are more important than the mutations on the Drosophila orthologous genes, in terms of conferring organophosphate resistance, at least in many species.