key: cord-1025809-kc8j8h5e
authors: Moniruzzaman, M.; Hossain, Mohammad Uzzal; Islam, M. Nazrul; Rahman, M. Hadisur; Ahmed, Irfan; Rahman, Tahia Anan; Bhattacharjee, Arittra; Amin, M. Ruhul; Rashed, Asif; Keya, Chaman Ara; Das, Keshob Chandra; Salimullah, M.
title: Coding-Complete Genome Sequence of SARS-CoV-2 Isolate from Bangladesh by Sanger Sequencing
date: 2020-07-09
journal: Microbiol Resour Announc
DOI: 10.1128/mra.00626-20
sha: 60c0b14d37c9a73e5ef1dcf7bf3e087e85e64935
doc_id: 1025809
cord_uid: kc8j8h5e

A coding-complete genome sequence of a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) isolate was revealed. The sample for the virus was isolated from a female patient from Dhaka, Bangladesh, suffering from coronavirus disease-2019 (COVID-19).

S evere acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a member of the Coronaviridae family and Betacoronavirus genus, is the causative agent of pandemic coronavirus disease-2019 . In Bangladesh, the rate of positive cases and the death toll from COVID-19 are increasing at an alarming rate (https://corona.gov.bd/). To understand the genomic characteristics of SARS-CoV-2 in Bangladesh, several isolates have been sequenced and deposited in GISAID (https://www.gisaid.org/). However, those isolates have been sequenced using a next-generation sequencing platform, except for the one we are reporting. In this study, we sequenced the viral genome by Sanger sequencing technology, which is a gold standard method and is necessary for thorough genomic analysis (1) .

The isolate (SARS-CoV-2/human/BGD/NIB_01/2020) was collected from an oropharyngeal specimen on 11 May 2020. The patient was a 28-year-old saleswoman who tested positive (via reverse transcriptase PCR [RT-PCR]) for COVID-19 with symptoms of cough, mild fever, and throat congestion. (all applicable international, national, and/or institutional guidelines for the care and use of animals were followed; ethical approval number NIBREC2020-01). The viral RNA was extracted directly from the patient's specimen using the PureLink viral RNA/DNA minikit (Invitrogen). The viral RNA was then converted into cDNA using a SuperScript VILO cDNA synthesis kit (Invitrogen).

To cover the whole genome of the virus, 48 pairs of primers were designed by following two conditions: (i) their sequence is conserved among all the available SARS-CoV-2 isolates, and (ii) the terminal of the amplicons will overlap the adjacent amplicon (Table 1) . These primers underwent PCR and generated 96 amplicons, which were visualized using 1.5% agarose gel electrophoresis. The PCR products were then purified using the PureLink PCR purification kit (Thermo Fisher Scientific, USA). These purified amplicons were finally sequenced with 2ϫ coverage using the Sanger dideoxy method by "ABI 3500" with a BigDye Terminator version 3.1 cycle sequencing kit (Applied Biosystems, USA).

The raw reads were assembled using DNA Sequence Assembler version 4 (2013) Forward CTCTACGTGTTGAGGCTTTT 720 9

Reverse CATCCGTAATAGGACCTTTGT  130  10  Forward  TTGTGCTAGTGAGTACACTG  760  10  Reverse  AATGTCTCCTACAACTTCGG  150  11  Forward  TGATGTACTGAAGTCAGAGG  737  11  Reverse  AATAGCCTTCTCTGTAACCAG  90  12  Forward  TTCTTTAATCTACTCAACCGC  706  12  Reverse  CTGTAGTGACAAGTCTCTCG  118  13  Forward  ATGCTAATGGAGGTAAAGGC  701  13  Reverse  ACAACTATCGCCAGTAACTTC  115  14  Forward  CTTTTATTTCAGCAGCTCGG  714  14  Reverse  GTGCGTAATATCGTGCCA  133  15  Forward  GCTGATTTTGACACATGGTT  812  15  Reverse  GGTAAGAATGAGTAAACTGGTG  196  16  Forward  CCTATTGGTGCTTTGGACATA  727  16  Reverse  AACCCTCAACTTTACCAGATG  146  17  Forward  CTTGTTGTCATCTCGCAAAG  767  17  Reverse  TCGATTGAGAAACCACCTGT  112  18  Forward  TTGTTGACAGGCAAACAGC  770  18  Reverse  ACCATCATCATACACAGTTCT  121  19  Forward  TGACATGGTTGGATATGGTTG  794  19  Reverse  GTTTATGTCTACAGCACCCT  172  20  Forward  AATTGTGGGCTCAATGTGT  787  20  Reverse  GCAACAGGACTAAGCTCATTA  155  21  Forward  GGAAATCCAACAGGTTGTAGA  795  21  Reverse  ACAGGGTCATTAGCACAAGT  90  22  Forward  GTTGCCACATAGATCATCCAA  790  22  Reverse  AACAATACCAGCATTTCGC  233  23  Forward  GCAGACCTCGTCTATGCTTT  813  23  Reverse  GCACGTAGTGCGTTTATCT  147  24  Forward  CCACTTCAGAGAGCTAGGTG  782  24  Reverse  GTGAGGGTTTTCTACATCACT  114  25  Forward  ATTGAAATCAATAGCCGCCA  775  25  Reverse  ATCTGGGTAAGGAAGGTACA  117  26  Forward  GTCTGAAGCAAAATGTTGGA  805  26  Reverse  GAGTCTTTCAGTACAGGTGTT  142  27  Forward  TGTGTGCTAATGGACAAGTT  784  27  Reverse  TCAAAACACTCTACACGAGC  132  28  Forward  CTTCTGCTCGCATAGTGTAT  769  28  Reverse  CAAGAGTGAGCTGTTTCAGT  191  29  Forward  AATAGGCGTGGTAAGAGAAT  790  29  Reverse  GTACATAAGTGGTATGAGGTGT  139  30  Forward  AGCTAGGTTTTTCTACAGGTG  756  30  Reverse  CTTTGTCACTACAAGGCTGT  152  31  Forward  GTAGAAAGGTTCAACACATGG  733  31  Reverse  ATAGAAACTGGTACTTCACCC  144  32  Forward  GCTTTAGCTTGTGGGTTTAC  808  32 Reverse The assembled viral genome consists of a single-stranded positive (ϩ) RNA that is 29,724 nucleotides long. The NCBI BLASTN program (3) showed that the genome was mostly similar to SARS-CoV-2/human/BGD/CHRF_0001/2020 (GenBank accession number MT476385.1). From NCBI, the FASTA sequences of 7 mostly similar genomes from Bangladesh, India, Sri Lanka, and the United States were taken along with the reference genome. Another 16 genomes of SARS-CoV-2 that were isolated in Bangladesh were collected from GISAID (https://www.gisaid.org/). The genomes were aligned with MAFFT version 7 using default parameters (4). The phylogenetic tree was constructed using FastTree version 2.1.10 (5) through the Galaxy platform (6) . Here, the tree was built by nucleotide alignment using the generalized time-reversable model (GTR) plus the CAT nucleotide evolution model (GTRϩCAT). The tree was visualized using iTOL (7) , where the tree structure was rerooted on the position of reference isolate SARS-CoV-2 Wuhan-Hu-1.

The genome has 8 nucleotide differences from the closest isolate. Interestingly, except for isolate SARS-CoV-2/human/BGD/CHRF0001/2020, the other strains of SARS-CoV-2 from Bangladesh showed separate clades and distant genetic relations. The tree also demonstrated that our viral genome and three isolates from the United States share an ancestor (Fig. 1) .

Data availability. The complete nucleotide sequence of this SARS-CoV-2 isolate (SARS-CoV-2/human/BGD/NIB_01/2020) has been deposited in GenBank under the accession number MT509958. CAAGAATTTAAACCCAGGAG  758  33  Reverse  GCATCAGAGACAAAGTCATT  155  34  Forward  CACATTAACATTAGCTGTACCC  781  34  Reverse  TGACTAGAGACTAGTGGCA  182  35  Forward  AAGGGGTACTGCTGTTATGT  775  35  Reverse  TTAATAGGCGTGTGCTTAGA  116  36  Forward  TCAGCCTTTTCTTATGGACC  794  36  Reverse  TCCAAGCTATAACGCAGC  104  37  Forward  TTAGAGGTGATGAAGTCAGA  760  37  Reverse  TGTTCAGCCCCTATTAAACA  149  38  Forward  TAACCAGGTTGCTGTTCTTT  797  38  Reverse  CAATCATTTCATCTGTGAGCA  191  39  Forward  CAGATCCATCAAAACCAAGC  771  39  Reverse  GCAAGAAGACTACACCATGA  137  40  Forward  TCAGAGCTTCTGCTAATCTTG  759  40  Reverse  GTAATTTGACTCCTTTGAGC  137  41  Forward  TTGCCATAGTAATGGTGACA  798  41  Reverse  AGCTGGTAATAGTCTGAAGTG  120  42  Forward  GCACAACAAGTCCTATTTCT  784  42  Reverse  CCATAACAGCCAGAGGAAAA  170  43  Forward  GCAGATTCCAACGGTACT  707  43  Reverse  TAGTAACCTGAAAGTCAACG  117  44  Forward  GCTACAGGATTGGCAACTAT  785  44  Reverse  TTTCATGTTCGTTTAGGCGT  174  45  Forward  CACTTTGCTTCACACTCAAA  791  45  Reverse  TCTGGACTGCTATTGGTGTT  180  46  Forward  CAGATTCAACTGGCAGTAAC  793  46  Reverse  TTTCCTTGGGTTTGTTCTGG  187  47  Forward  CTGCTTGACAGATTGAACCA  698  47  Reverse  CTTGTGCTATGTAGTTACGAGA  242  48  Forward  ATGAAACTCAAGCCTTACCG  518  48 Reverse CCTTTCGTGCAGGTCAATA

Nextgeneration sequencing technologies and their application to the study and control of bacterial infections

EMBOSS: the European Molecular Biology Open Software Suite

A greedy algorithm for aligning DNA sequences

MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization

FastTree 2: approximately maximumlikelihood trees for large alignments

The Galaxy platform for accessible, reproducible and collaborative biomedical analyses

Interactive Tree of Life (iTOL) v4: recent updates and new developments

Nucleotide alignment and the GTRϩCAT nucleotide evolution model was applied to construct the tree. The tree was visualized using i-TOL. Here, the x axis represents the tree scale. A scale bar with a 0.0001 value is given on the top. The genome

We are grateful to the Ministry of Science and Technology for its extensive support during this research work.This study was funded by the National Institute of Biotechnology, Ministry of Science and Technology, government of the People's Republic of Bangladesh.