key: cord-1020527-fou2x4uk
authors: Hujer, Andrea M.; Hujer, Kristine M.; Leonard, David A.; Powers, Rachel A.; Wallar, Bradley J.; Mack, Andrew R.; Taracila, Magdalena A.; Rather, Philip N.; Higgins, Paul G.; Prati, Fabio; Caselli, Emilia; Marshall, Steven H.; Clarke, Thomas; Greco, Christopher; Venepally, Pratap; Brinkac, Lauren; Kreiswirth, Barry N.; Fouts, Derrick E.; Bonomo, Robert A.
title: A Comprehensive and Contemporary “Snapshot” of β-lactamases in Carbapenem Resistant Acinetobacter baumannii
date: 2020-10-16
journal: Diagn Microbiol Infect Dis
DOI: 10.1016/j.diagmicrobio.2020.115242
sha: 6865ba73d360f64edbc99e3e3eb61a27c587a04b
doc_id: 1020527
cord_uid: fou2x4uk

Successful treatment of Acinetobacter baumannii infections require early and appropriate antimicrobial therapy. One of the first steps in this process is understanding which β-lactamase (bla) alleles are present and in what combinations. Thus, we performed WGS on 98 carbapenem-resistant A. baumannii (CR Ab). In most isolates, an acquired bla(OXA) carbapenemase was found in addition to the intrinsic bla(OXA) allele. The most commonly found allele was bla(OXA-23) (n=78/98). In some isolates, bla(OXA-23) was found in addition to other carbapenemase alleles: bla(OXA-82) (n=12/78), bla(OXA-72) (n=2/78) and bla(OXA-24/40) (n=1/78). Surprisingly, 20% of isolates carried carbapenemases not routinely assayed for by rapid molecular diagnostic platforms, i.e., bla(OXA-82) and bla(OXA-172); all had ISAba1 elements. In 8 CR Ab, bla(OXA-82) or bla(OXA-172) was the only carbapenemase. Both bla(OXA-24/40) and its variant bla(OXA-72) were each found in 6/98 isolates. The most prevalent ADC variants were bla(ADC-30) (21%), bla(ADC-162) (21%), and bla(ADC-212) (26%). Complete combinations are reported.

Multidrug-resistant (MDR) Acinetobacter baumannii (Ab) pose a significant challenge to modern medicine. The World Health Organization (WHO) categorizes MDR Ab as the "highest priority pathogen" for which antibiotic development is urgently needed (1), and studies that aid our understanding of this organism are certain to have significant impact on this crisis. Currently, very few therapeutic agents exist or are in development that can be used to treat MDR Ab infections, including those of the bloodstream. In efforts to address this persistent dilemma, multiple pharmaceutical companies have undertaken different approaches to enhance our current therapeutic arsenal. These efforts include the development of a novel fluorocycline (eravacycline), siderophore β-lactams (e.g., cefiderocol), and more effective β-lactam βlactamase inhibitors (BL/BLIs) (e.g., sulbactam/ETX2514 and cefepime/WCK4234) (2) (3) (4) (5) (6) (7) (8) . In studies performed to date, these therapeutics are showing significant promise, but the fear is ever present that even these will fall short as universal agents to reliably treat MDR Ab.

-lactamase inhibition is key in preserving efficacy of our current armamentarium of antibiotics against Ab. However, many times the focus of that inhibition is on a single class of lactamase. Clearly, in inhibitor design, we need to take into account all -lactamases occurring in an individual organism, based upon our understanding of currently circulating alleles in isolates.

In addition to OXA carbapenemases that Ab can acquire [e.g. OXA-23 (originally called ARI-1) and OXA-24/40], they possess an intrinsic OXA and AmpC (Acinetobacter Derived Cephalosporinase, ADC) -lactamase, that can confer resistance to carbapenems and cephalosporins, respectively (9) (10) (11) . Therefore, class C and D -lactamases are important targets for intervention as they are the major contributors of -lactam resistance in Ab.

With these goals in mind, we performed whole genome sequencing (WGS) on 98 carbapenem-resistant Ab isolates (CR Ab, resistant to doripenem, imipenem, and meropenem) (12) and assessed the various -lactamase combinations contained therein. This WGS database, and others like it, will be important in providing context to future work in the area of -lactamase inhibitor design and provides a comprehensive "snapshot" of recently circulating -lactamase genes (bla genes) in CR Ab. A better understanding of how to treat infections caused by opportunistic organisms like Ab will potentially be crucial in the fight for patients in the ICU on ventilators that are at an increased risk of hospital-acquired and ventilator-associated pneumonia caused by CR Ab. As CR Ab is a leading cause of hospital-acquired pneumonia, and also reported to be a pathogen of community-acquired Gram-negative pneumonia (13) (14) (15) (16) (17) (18) (19) . This could be especially significant during the COVID-19 pandemic (15) .

This group of isolates was used in the Primers III study and a description of the isolates can be found there (12, 20, 21) . In short, the isolates used in this study consisted of 94 carbapenem resistant Ab collected between 2007 and 2013 from a six-hospital healthcare system in Northeast Ohio: including five community hospitals and a facility serving as both as a longterm care unit and a long-term acute care hospital. Four additional Ab were collected from patients at the Walter Reed Army Medical Center between March 2003 and February 2005. All

Ab clinical isolates in this study displayed an MDR phenotype and were resistant to all carbapenems tested.

The genomes of all Ab clinical isolates were sequenced using paired-end NexteraXT libraries by Illumina NextSeq (2x150bp) to ~100-fold coverage. Reads were assembled using SPAdes (22) , annotated using NCBI's Prokaryotic Genome Annotation Pipeline (23) and deposited in the NCBI SRA and GenBank WGS repositories (BioProjects PRJNA384060 and PRJNA384065). In addition, the DNA sequence for each isolate was analyzed using ResFinder at the Center for Genomic Epidemiology website. -lactamase genes were manually extracted if not a 100% match with 100% coverage of a known -lactamase gene.

For PCR analysis of ISAba1 upstream of bla OXA-82 and bla OXA-172 , the following primer set was used: 5' TGGATTGCACTTCATCTTGG 3' (OXA-51) and 5' CACGAATGCAGAAGTTG 3' (ISAba1) (24, 25) . This combination of primers produces an approximate 1,200 bp product when ISAba1 is proximal to the bla OXAs .

From the WGS data, the combination of β-lactamases found in each isolate was determined, along with the Pasteur and Oxford Multilocus Sequence Types (MLSTs) (26, 27) .

This was done for each of the 98 CR Ab. The predominant Pasteur sequence type was the ST2 group, which are also known as international clonal lineage 2 (IC2). There were 79 CR Ab that were ST2, and 19 that were non-ST2 according to the Pasteur Scheme. Using the Oxford scheme ST1626 and ST1631 accounted for 40 and 23 isolates, respectively. Table 1 summarizes the combination of -lactamases found in this collection, as well as which STs they were found in.

In most isolates, an acquired bla OXA carbapenemase was found in addition to the intrinsic or chromosomal bla OXA allele. However, in 18 ST2 isolates, the intrinsic bla OXA acquired a single point mutation that converted bla OXA-66 (the variant associated with IC2 isolates) to bla OXA-82 (Table 1) (28) . bla OXA-82 was also found as the sole carbapenemase allele in 6% of isolates. In addition, bla OXA-172 was found in two ST1088 isolates. Both OXA-82 (OXA-66 variant with L167V), and OXA-172 (OXA-66 variant with I129V and W222L) are carbapenemases (28) (29) (30) , and were found in combination with ISAba1 upstream of the bla OXA gene as evidenced by PCR analysis.

By far, the most commonly found acquired OXA carbapenemase allele was bla OXA-23 (Table 1) (10) . This bla gene was detected in 78 of the 98 CR isolates. In 81% (n=63/78) of the isolates containing bla OXA-23 , it was the only carbapenemase present. However, in some isolates it was found in addition to other carbapenemase alleles, i.e. in addition to bla OXA-82 (n=12/78), bla OXA-72 (n=2/78) and bla OXA-24/40 (n=1/78). The carbapenemase genes bla OXA-24/40 (9) and its variant bla OXA-72 were each found in 6/98 isolates (both alone and in combination with bla OXA-23 ), but never found together in a single isolate (Table 1) . While the bla OXA-58 allele (31) was found in 2 isolates as the sole carbapenemase gene. (Tables 1 and 2 ) (32) . Also, of note, bla ADC-33 and bla ADC-219 (ADC-33 with G222D) were found in 8/98 isolates (33) . Other ADC variants (21/98) were found in all but 2 isolates (Table 1) . Numbering of the amino acids in the ADC variants is based on the SANC numbering scheme (34) .

Many combinations of -lactamases were found in individual isolates. However, certain combinations were more frequent than others. The three most frequently found combinations were: OXA-23/OXA-66/ADC-162 with or without TEM-1 (n=21); OXA-23/OXA-66/ADC-212 (n=21); and OXA-23/OXA-66/ADC-30 with or without TEM-1 (n=10) ( Table 1 ). The high prevalence of OXA-66 reflects the prevalence of ST2 isolates circulating in hospitals (35) (36) (37) .

The current prevalence of multidrug-and pandrug-resistant strains of Ab, combined with the lack of new antibiotics, underscores the critical need for the development of novel therapeutic strategies to combat this pathogen. The end goal of studies like this is to facilitate the design of inhibitors that target the most prevalent combinations of β-lactamases occurring in circulating CR Ab, and the first step in this process is to determine which -lactamase alleles are present in contemporary isolates.

Building upon our work with PRIMERS III, an evaluation of rapid molecular diagnostics to identify carbapenem susceptibility and resistance in Acinetobacter spp. (12) , our group performed an extensive analysis of the WGS of 98 CR Ab strains used in that study, with particular attention being paid to the β-lactamase combinations contained within each isolate.

Based on these results: Table 1 summarizes β-lactamase alleles present; Table 2 describes the new ADCs in this collection, Table 3 presents what is already known about the key properties and structure/function basis of the OXA carbapenemases and ADC β-lactamases found herein, and Table 4 compares various rapid molecular diagnostic (RMD) platforms' ability to detect the carbapenemases found in this collection, as determined from the platform's product literature.

OXA-23 has been shown to be a major driver of carbapenem resistance in Ab, and OXA-24/40, an enzyme similar to OXA-23 in structure and specificity, is also extensively found. Both are acquired high affinity carbapenemases that have a common structural feature thought to be primarily responsible for this property. This structural feature is a hydrophobic bridge of two residues that stretches across the top of the active site (Table 3 ) (38) (39) (40) (41) (42) . It is important to note that both of these acquired carbapenemase genes are found on highly transmissible mobile genetic elements, and are particularly worrisome from an infection control standpoint, because not only can horizontal transmission of these common resistance elements occur between Acinetobacter strains and plasmids, but also interspecies plasmid transfer can occur (43) .

Of note, we have identified OXA variants in this collection with substitutions that expand their substrate profile. OXA-82 is one such variant, a L167V substitution in OXA-66 greatly enhances the hydrolytic efficiency of that enzyme towards carbapenems (Table 3 ) (28, 29) . In most isolates, an acquired bla OXA carbapenemase allele was found in addition to the intrinsic or chromosomal bla OXA allele. However, in 18 isolates it appears that the intrinsic bla OXA-66 was converted by mutation to bla OXA-82 . Another such variant in this collection was OXA-172, found in two ST1088 isolates. It also appears to have evolved from bla OXA-66 , as no other intrinsic bla OXA was found, and it differs from OXA-66 by two substitutions, I129V and W222L. It has been shown that these substitutions result in tighter binding of the enzyme to doripenem and imipenem. In fact, OXA-172 displayed carbapenem K S values comparable to those of OXA-23 and OXA-24/40 (30) . ISAba1 was found upstream of bla OXA-82 and bla OXA-172 (both intrinsic bla OXAs ), as previously reported in other isolates; this is of utmost importance, as the presence of this insertion element is necessary for a clinically CR phenotype, because these bla OXAs are weak carbapenemases and the IS element provides a strong promoter for overexpression (28, 44) . Also of note, the wild-type OXA-66 does not display the carbapenemase activity of its point mutation derivative OXA-82 (28) . Lastly, OXA-72, which is OXA-24/40 with a G224D substitution, was present in 6 isolates. OXA-72 retains its carbapenemase activity and has been associated with numerous outbreaks (45) (46) (47) (48) .

It is an extremely troubling finding that 20% of isolates contained bla OXA-82 and bla carbapenemase genes, as currently available rapid molecular diagnostic platforms do not assay for these resistance determinants, nor do they detect the presence of ISAba1insertion elements upstream of the genes. It is important to keep in mind that without the IS element upstream, these bla OXAs , including bla OXA-23 , do not confer carbapenem resistance. Even WGS can miss ISAba1associated bla genes due to the ISAba1insertion sequences being present in multiple locations of the chromosome and plasmids, leading to misassembles and fragmented contigs when only using short Illumina reads. It has been our experience, that besides closing genomes by inclusion of long reads, standard PCR amplifications are needed to accurately determine the ISAba1 positions relative to a gene of interest, such as bla OXA-82 and bla OXA-172 (28, 44) . Table 4 compares the ability of various RMD platforms to detect the carbapenemase genes found in this collection of Ab isolates. As can be seen, none of the currently available platforms are able to detect bla OXA-82 and bla OXA-172 . BioFire Film Array, Xpert® Carba-R Assay, and Acuitas AMR Gene Panel do not even detect bla OXA-23 , which was by far the most commonly found OXA carbapenemase allele (80% of isolates).

Acinetobacter spp., that are responsible for resistance to penicillins, cephalosporins, and BL/BLI combinations (11) . Being among the first laboratories to recognize the importance of this βlactamase, our early work showed that ADC-7 β-lactamase demonstrates a remarkably high turnover rate for first-generation cephalosporins and relatively low affinity for the commercially available BLIs (11).

The ADC allele most commonly found in this collection was bla ADC-212 (n=25/98 isolates). It encoded an ADC-25-like -lactamase with the following substitutions: A200D, P219L, and an Ala219a insertion between P219L and A220 (SANC numbering) ( Table 2) . ADC-Ω loop) hydrolyzes ceftazidime, cefepime, and aztreonam, but not carbapenems (33) . We speculate that for ADC-212, the Ala219a (between P219L and A220) might confer an extendedspectrum resistance phenotype similar to ADC-33 (Tables 2 and 3 ). In efforts to understand the importance of these substitutions in the larger context of structure-activity relationships, we generated preliminary data that suggests the alanine insertion between P219L and A220 in the Ω loop increases ceftazidime MICs from 16 mg/L to greater than 512 mg/L (unpublished data).

Other studies of ADC variants found within this collection demonstrate that subtle changes in the active site can lead to alterations in substrate turnover. ADC-30 was shown to contribute to sulbactam resistance when overexpressed in Ab (32) . Within our collection, bla ADC-30 (n= 21/98 isolates) and bla ADC-162 (n= 21/98 isolates) were also frequently found. ADC-162 is ADC-30 with an A220E substitution in the Ω loop region. Additionally, ADC-56 present in some of our clinical isolates, is a variant of ADC-30 containing a single mutation at R148Q that confers the ability to hydrolyze cefepime (Table 3 ) (49) . Even more worrisome is ADC-68, an ADC that has gained the ability to hydrolyze carbapenems. ADC-68 was not identified in this study, but is worthy of mention given its carbapenemase activity (50) .

In conclusion, we believe that bla OXA-82 and bla OXA-172 are currently underappreciated as causative agents of, and contributors to, carbapenem resistance in Ab, as they were present in 20% of the CR Ab. Additionally, we anticipate that focusing our efforts of inhibition on targeting the various combinations of β-lactamases found in currently circulating, clinical isolates of Ab will enable us to truly assess whether newly synthesized inhibitors will be effective in the clinic. Our innovative approach considers all the β-lactamases occurring in a single organism based on the WGS combinations observed in this contemporary group of isolates from the US. Inhibitors need to effectively inhibit all of these β-lactamases simultaneously, and it is critical to counter bacterial resistance caused by the expansion and expression of multiple -lactamases. We believe this a possibility, and that the impact of these studies may have broader implications for other bacterial pathogens. 

High-affinity carbapenemases Similar bridge residues in OXA-24/40 (Y112 and M223) and OXA-23 (F110 and M221) suggest that both use the same mechanism to achieve tight substrate binding in order to compensate for a slow turnover rate of carbapenems, thus resulting in clinical resistance. Structural analyses of OXA-24/40, with and without doripenem bound, revealed that the hydrophobic bridge across the top of the active site helps hold onto carbapenems that possess extended nonpolar side chains. However, penicillins that possess bulky side chains are sterically prohibited in the active site. 

ADC-162 Not determined ADC-30 with A220E, which is a substitution in the Ω loop region.

Cefepime resistance ADC-30 with an R148Q substitution. Molecular modeling demonstrated that the R148Q substitution in ADC-56 disrupts hydrogen bonds with Q267, E272, and I291 providing the H-10 helix more flexibility, likely allowing for better binding and turnover of cefepime.

ADC-33

Increased hydrolysis of ceftazidime, cefepime, and aztreonam

In ADC-33, an alanine insertion allowed for the hydrolysis of ceftazidime, cefepime, and aztreonam at high levels.

ADC-219 Not determined ADC-33 with G222D, which is a substitution in the Ω loop region.

Not determined ADC-25 with A200D/P219L and an alanine insertion between P219L and A220. In ADC-212, the P219L followed by an alanine insertion might confer the same phenotype as in ADC-33. 

Cefiderocol: a novel siderophore cephalosporin

ETX2514 is a broad-spectrum beta-lactamase inhibitor for the treatment of drug-resistant Gram-negative bacteria including Acinetobacter baumannii

Vitro Antibacterial Properties of Cefiderocol, a Novel Siderophore Cephalosporin, against Gram-Negative Bacteria

WCK 4234, a novel diazabicyclooctane potentiating carbapenems against Enterobacteriaceae, Pseudomonas and Acinetobacter with class A, C and D beta-lactamases

Strategic Approaches to Overcome Resistance against Gram-Negative Pathogens Using beta-Lactamase Inhibitors and beta-Lactam Enhancers: Activity of Three Novel Diazabicyclooctanes WCK 5153, Zidebactam (WCK 5107), and WCK 4234

Reversibility of Covalent, Broad-Spectrum Serine beta-Lactamase Inhibition by the Diazabicyclooctenone ETX2514

Review of Eravacycline, a Novel Fluorocycline Antibacterial Agent

OXA-24, a novel class D beta-lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain

Sequence analysis of ARI-1, a novel OXA beta-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92

Identification of a new allelic variant of the Acinetobacter baumannii cephalosporinase, ADC-7 betalactamase: defining a unique family of class C enzymes

Informing Antibiotic Treatment Decisions: Evaluating Rapid Molecular Diagnostics To Identify Susceptibility and Resistance to Carbapenems against Acinetobacter spp. in PRIMERS III

High prevalence of multidrug-resistant nonfermenters in hospital-acquired pneumonia in Asia

Multidrug Resistant Gram-Negative Bacteria in Community-Acquired Pneumonia

Clinical and virological data of the first cases of COVID-19 in Europe: a case series

The global prevalence of multidrug-resistance among Acinetobacter baumannii causing hospitalacquired and ventilator-associated pneumonia and its associated mortality: A systematic review and meta-analysis

Ventilatorassociated pneumonia due to extensive drug-resistant Acinetobacter baumannii: risk factors, clinical features, and outcomes

Severe Community-Acquired Pneumonia due to Acinetobacter baumannii in North America: Case Report and Review of the Literature

Clinical and Pathophysiological Overview of Acinetobacter Infections: a Century of Challenges

Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center

Carbapenem-resistant Acinetobacter baumannii and Klebsiella pneumoniae across a hospital system: impact of post-acute care facilities on dissemination

SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing

NCBI prokaryotic genome annotation pipeline

Is ISAba-1 customized for Acinetobacter?

Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp

Development of a multilocus sequence typing scheme for characterization of clinical isolates of Acinetobacter baumannii

The population structure of Acinetobacter baumannii: expanding multiresistant clones from an ancestral susceptible genetic pool

Conversion of OXA-66 into OXA-82 in clinical Acinetobacter baumannii isolates and association with altered carbapenem susceptibility

Common clinical substitutions enhance the carbapenemase activity of OXA-51-like class D beta-lactamases from Acinetobacter spp

Clinical Variants of the Native Class D beta-Lactamase of Acinetobacter baumannii Pose an Emerging Threat through Increased Hydrolytic Activity against Carbapenems

OXA-58, a novel class D {beta}-lactamase involved in resistance to carbapenems in Acinetobacter baumannii

Contribution of Acinetobacter-derived cephalosporinase-30 to sulbactam resistance in Acinetobacter baumannii

Extended-spectrum cephalosporinase in Acinetobacter baumannii

A standard numbering scheme for class C beta-lactamases

Rapid Replacement of Acinetobacter baumannii Strains Accompanied by Changes in Lipooligosaccharide Loci and Resistance Gene Repertoire

New insights into dissemination and variation of the health care-associated pathogen Acinetobacter baumannii from genomic analysis

Genome dynamics of multidrug-resistant Acinetobacter baumannii during infection and treatment

Structures of the class D Carbapenemases OXA-23 and OXA-146: mechanistic basis of activity against carbapenems, extended-spectrum cephalosporins, and aztreonam

Crystal structure of the carbapenemase OXA-24 reveals insights into the mechanism of carbapenem hydrolysis

Structures of the class D carbapenemase OXA-24 from Acinetobacter baumannii in complex with doripenem

Structural basis for carbapenemase activity of the OXA-23 betalactamase from Acinetobacter baumannii

Role of the Hydrophobic Bridge in the Carbapenemase Activity of Class D beta-Lactamases

Role of common blaOXA-24/OXA-40-carrying platforms and plasmids in the spread of OXA-24/OXA-40 among Acinetobacter species clinical isolates

Association between beta-lactamaseencoding bla(OXA-51) variants and DiversiLab rep-PCR-based typing of Acinetobacter baumannii isolates

Two sequential outbreaks caused by multidrug-resistant Acinetobacter baumannii isolates producing OXA-58 or OXA-72 oxacillinase in an intensive care unit in France

Clonal spread of carbapenem-resistant OXA-72-positive Acinetobacter baumannii in a Croatian university hospital

Wide dissemination of OXA-type carbapenemases in clinical Acinetobacter spp. isolates from South Korea

Diversity of carbapenem resistance mechanisms in Acinetobacter baumannii from a Taiwan hospital: spread of plasmid-borne OXA-72 carbapenemase

Extended-spectrum AmpC cephalosporinase in Acinetobacter baumannii: ADC-56 confers resistance to cefepime

Structure of ADC-68, a novel carbapenem-hydrolyzing class C extended-spectrum beta-lactamase isolated from Acinetobacter baumannii

Evolution to carbapenem-hydrolyzing activity in noncarbapenemase class D betalactamase OXA-10 by rational protein design