key: cord-1008104-masvn1gu
authors: Soria-Guerra, Ruth Elena; Alpuche-Solís, Angel G.; Rosales-Mendoza, Sergio; Moreno-Fierros, Leticia; Bendik, Elise M.; Martínez-González, Luzmila; Korban, Schuyler S.
title: Expression of a multi-epitope DPT fusion protein in transplastomic tobacco plants retains both antigenicity and immunogenicity of all three components of the functional oligomer
date: 2009-03-21
journal: Planta
DOI: 10.1007/s00425-009-0918-2
sha: 4413b2b39dac3c02a0b6b8f0d6b862fa7cf20fb2
doc_id: 1008104
cord_uid: masvn1gu

Expression of genes in plant chloroplasts provides an opportunity for enhanced production of target proteins. We report the introduction and expression of a fusion DPT protein containing immunoprotective exotoxin epitopes of Corynebacterium diphtheriae, Bordetella pertussis, and Clostridium tetani in tobacco chloroplasts. Using biolistic-mediated transformation, a plant-optimized synthetic DPT gene was successfully transferred to tobacco plastomes. Putative transplastomic T0 plants were identified by PCR, and Southern blot analysis confirmed homoplasmy in T1 progeny. ELISA assays demonstrated that the DPT protein retained antigenicity of the three components of the fusion protein. The highest level of expression in these transplastomic plants reached 0.8% of total soluble protein. To assess whether the functional recombinant protein expressed in tobacco plants would induce specific antibodies in test animals, a mice feeding experiment was conducted. For mice orally immunized with freeze-dried transplastomic leaves, production of IgG and IgA antibodies specific to each toxin were detected in serum and mucosal tissues.

Simultaneous vaccination against diphtheria, tetanus, and pertussis using a DPT vaccine during infancy and childhood has markedly reduced the incidence of cases and deaths from each of these serious bacterial diseases (CDC 2006; Kalies et al. 2006; WHO 1999) . Concerns over the safety of whole-cell pertussis vaccines have prompted the development of acellular vaccines that are less likely to provoke adverse reactions as they contain puriWed antigenic components of the causal bacterium Bordetella pertussis. However, current acellular pertussis vaccines must be administered in a series of multiple doses, thereby contributing to their high production costs (CDC 1992; Salmaso et al. 2001; Tan et al. 2005) . Attempts to produce safer, inexpensive, and more eYcient DPT vaccines are underway (Abomoelak et al. 1999; Aminian et al. 2007; Kamachi et al. 2003; Meriste et al. 2006) .

In the last few years, plants have been genetically engineered to express various recombinant biopharmaceuticals (Ma et al. 2005) . Plants can be used as bioreactors for the production of appropriately safe and inexpensive vaccines, and contribute to reduced costs associated with vaccine transportation and storage (Giddings et al. 2000; Koya et al. 2005; La et al. 2007 ). Plant-based vaccine production has been reported in several plant species, including potato (Mason et al. 1996) , tobacco (Liu et al. 2005; Mason et al. 1992; Zhang et al. 2006 ), tomato (McGarvey et al. 1995 Sandhu et al. 2000) , lettuce (Kapusta et al. 1999) , carrot (Marquet-Blouin et al. 2003; Rosales-Mendoza et al. 2007) , and alfalfa (Dong et al. 2005 ), among others. Feeding studies conducted in animals (Huang et al. 2001; Rosales-Mendoza et al. 2008; Thanavala et al. 1995) and humans (Tacket et al. 1998 (Tacket et al. , 2000 have demonstrated that candidate vaccines produced in plants are eVective in eliciting protective immune responses. This vaccine production approach will also have a positive impact on public health measures in developing countries that lack of proper refrigeration systems for storage of traditional vaccines. As plant-based vaccines are administered orally, these vaccines avoid the use of injections, thus eliminating discomfort and more importantly the risk of disease transmission via re-use of contaminated syringes and needles Richter et al. 2000) .

Plastid transformation provides an alternative strategy for expressing foreign genes in plants and oVers several advantages over nuclear plant expression systems (Chargelegue et al. 2001; Sala et al. 2003) . These advantages include higher levels of foreign protein accumulation, site-speciWc integration of transgenes, and transgene containment due to maternal transmission of plastids thus alleviating environmental concerns over gene Xow (Maliga 2003; Daniell et al. 2005) . Moreover, the destination of a protein inXuences both its stability and modiWcation (Drakakaki et al. 2006) . To date, many antigenic proteins have been expressed in chloroplasts, such as the cholera toxin B subunit (Daniell et al. 2001) , anthrax protective antigen (Koya et al. 2005) , tetanus toxin fragment C (Tregoning et al. 2003) , Escherichia coli K99 Wmbrial subunit antigen (Garg et al. 2007) , and the spike (S) protein of the severe acute respiratory syndrome coronavirus (SARS-CoV) . Recently in our laboratory, a fusion protein of the heat labile toxin B subunit (LTB) of the enterotoxigenic Escherichia coli along with the heat stable toxin (ST) fusion protein (LTB-ST) has been expressed in transplastomic tobacco plants, and demonstrated its immunogenic characteristic in tested mice (Rosales-Mendoza et al. 2009 ).

Previously, we have expressed an antigenic polypeptide containing epitopes of diphtheria, pertussis, and tetanus exotoxins in tomato plants via nuclear transformation ). Following analysis of transgenic tomato plants, it has been demonstrated that the DPT transgene is integrated into the genome, transcribed, properly translated, and accumulating at levels of 0.006% of total soluble protein (TSP) ). In addi-tion, we have demonstrated that three doses of 270 mg each of freeze-dried tomato triggers speciWc immune responses in mice (Soria-Guerra et al., unpublished) . These studies suggest that the DPT could be used as a viable multicomponent DPT subunit vaccine. However, low levels of expression of the DPT protein in tomato plants render this plant-based candidate vaccine less desirable for commercial use as an oral vaccine. In this study, we report on the transfer and expression of the DPT fusion gene, re-designed for expression in tobacco chloroplasts. Recovery of transplastomic T1 tobacco plants accumulating high levels of the recombinant DPT fusion protein is reported. The antigenicity of all three components of the DPT fusion protein is also conWrmed in these transplastomic tobacco plants by ELISA assays. Following oral feeding of freeze-dried transplastomic tobacco leaves in test mice, immunogenic responses are observed.

As previously described, a multi-epitope DPT fusion protein was selected as the target for plastid expression in tobacco plants ). This fusion protein contains six immunoprotective exotoxin epitopes of Corynebacterium diphtheriae, Bordetella pertussis, and Clostridium tetani. A synthetic gene encoding for the DPT fusion protein is designed for optimal expression in tobacco plastome based on codon usage in plants. The 600-bp sequence includes a ribosome binding site and XbaI and XhoI restriction sites at the 5Ј and 3Ј ends, respectively. This gene has been synthesized by GenScript Corp. (Piscataway, NJ), and no changes were made in the amino acid sequence for the toxin subunits, linkers, and adjuvants, except for the deletion of the SEKDEL sequence. The two adjuvant-coding sequences of the heavy chain tetanus toxin were added near the C-terminal.

For plastid transformation, the plasmid pBic was used; it was derived from the chloroplast transformation vector pKCZ (kindly provided by Dr. Hans-Ulrich Koop). This vector is designed for integration of foreign genes into an MunI restriction site between trnN-GUU and trnR-ACG in the inverted repeat region of the chloroplast genome (Zou et al. 2003) . Several modiWcations have been made to the pKCZ vector in order to express the DPT and aadA genes as bicistrons under the control of the plastid 16S rRNA promoter (Prrn). First, a synthetic plastid 16S-rRN-promoter (Prrn) fused to the 5Ј-UTR of gene 10 from the bacteriophage T7 (T7G10) was prepared using synthetic oligonucleotides. The 5Ј-UTR region of this promoter was ligated to the pKCZ vector at restriction sites NheI and BglII of the pKCZ-UTR. Then, the vector pKCZ-UTR was digested with SpeI and NheI in order to delete the aadA expression cassette, and self-ligated to generate pKCZ-UTRdel. An aadA expression cassette was released from the pKCZ vector by SmaI-EcoRV digestion, and cloned downstream of the Prrn-UTR at AfeI and PmlI sites of pKCZ-UTRdel to generate the pBic vector. The DPT coding sequence was subcloned into the pBic vector digested with XbaI and XhoI restriction enzymes. The resulting plasmid was named pBic-DPT (Fig. 1a) . A positive clone was selected following restriction analysis and sequenced. All cloning and analysis procedures were performed following standard protocols (Sambrook et al. 1989) . DNA for plastid transformation was prepared using the Qiagen Plasmid Midi Kit (Qiagen, Valencia, CA).

Tobacco (Nicotiana tabacum cv. Petit Havana) seedlings were grown aseptically on Murashige and Skoog (MS) medium for 3-5 weeks. DNA was coated onto 0.6 m gold particles, and bombarded onto fully expanded leaves using the PDS-1000/He (Bio-Rad, Hercules, CA) biolistic delivery system as previously described (Daniell et al. 2001) . Following bombardment, leaves were incubated for 48 h in the dark at 25°C. Then, leaves were cut into small sections (»5 mm £ 5 mm), and cultured with the abaxial side in contact with the RMOP medium (Svab and Maliga 1993) and containing 500 mg/L spectinomycin. After 6-8 weeks, leaves from putative transplastomic shoots on selection medium were cut into small sections (0.2 cm 2 ), and placed on a selection medium for the next round of selection. Following three selection rounds, spectinomycin-resistant shoots were transferred onto fresh MS medium containing 500 mg/L spectinomycin for rooting. Whole plants were transferred to soil, acclimatized, and grown in the greenhouse to maturity. After blooming, seeds were collected, subject to surface sterilization and germinated on MS media containing spectinomycin.

Total DNA in T0 plants was extracted from putative transplastomic and non-transformed tobacco leaves using the DNAeasy™ Plant Mini Kit (Qiagen Inc., Valencia, CA). For PCR analysis, a 50 l reaction mixture containing 250 ng DNA, 1.5 mM magnesium chloride, 2.5 U Taq DNA polymerase, 1 mM dNTPs, and 1 M of each of forward and reverse primers was used. The forward primer 1F (5Ј ggtatgattctaggccaccagagg) and reverse primer 2R (5Ј gagcggctattcaagatgtgaagc) were used to amplify the DPT gene. Primers 3P (5Ј gctcccccgccgtcgttcaatgaga) and 4T (5Ј gcatctaagtagtaagcccaccccaagatg) were used to detect integration of the expression cassette into the tobacco plastome. The PCR protocol included an initial denaturation step at 94°C for 3 min followed by 35 cycles of denaturation, annealing, and extension steps of 30 s at 94°C, 60 s at 55°C, and 2 min at 72°C, respectively. PCR products were analyzed on 1% agarose gels. PCR-positive lines were transferred to the greenhouse for plant growth and seed production. T1 seeds were harvested and germinated on a medium containing 500 mg/L spectinomycin.

Southern blot analysis was performed in T1 progeny as previously described (Sambrook et al. 1989) . Fifty micrograms of total genomic DNA from leaves of each transformed and Fig. 1 a Schematic diagram of the plastid transformation vector harboring the synthesized DPT gene. This gene is under the control of the Prrn promoter; moreover, the 5Ј-UTR of phage T7 gene 10 contains a GGAGG ribosome binding site. This gene is inserted at the trnR/trnN insertion site into the tobacco chloroplast genome. RbcL 3, 3Ј untranslated region of the rbcL gene; aadA, spectinomycin resistance gene. 1F and 2R correspond to primers used for the detection of the DPT gene; while, 3P and 4T, primers used to detect transplastomic lines. b PCR analysis of plants using 1F and 2R primers for the DPT gene. A speciWc 0.6-kb PCR band was detected in putative transplastomic tobacco plants (1-4 correspond to lines B3, C1, D3, and E1), but it was absent in wild-type tobacco (Wt). c T0 mature plants transferred to soil and grown in the greenhouse exhibiting normal phenotypes. d T1 seeds germinating on a medium containing 500 mg/L spectinomycin together along with wild-type (Wt). e PCR analysis using primers 3P and 4T; a 2 kb product is ampliWed from transplastomic plants (1-2 correspond to lines B3 and E1) which is absent in the wild-type (Wt) e wild-type plants was digested with HindIII, XbaI, and SacI electrophoresed on a 1% agarose gel, and blotted onto a Hybond N membrane (Amersham-Pharmacia Biotech, Piscataway, NJ). The DPT fusion gene and a fragment of the trnN region were used as probes, generated using the DIG-DNA labeling mixture (Boehringer Mannheim, Germany). The probe was hybridized with the membrane and resolved using the CSPD substrate for alkaline phosphatase according to the manufacturer's protocol.

For Western blot analysis, protein samples were separated by SDS-PAGE using 4-20% pre-cast polyacrylamide electrophoresis gels (NuSep Inc., Austell, GA). Proteins were blotted onto BioTrace PVDF membrane using a Mini Trans Blot TM electrophoretic transfer cell (Bio-Rad). Membranes were incubated overnight at 4°C in 10 ml of either 1:1,000 dilution of a rabbit anti-tetanus toxin (Ab34890, Abcam, Cambridge MA) or 1:5,000 dilution of a goat anti-diphtheria toxin (US Biological, Swampscott, MA). After washing, membranes were incubated for 1 h in a 1:10,000 dilution of either an anti-rabbit IgG or anti-goat IgG conjugated with horseradish peroxidase (Sigma A5420). The antibody binding signal was detected with a Lumi-light Western Blotting Substrate (Roche Co., Mannheim, Germany) according to the manufacturer's protocol.

Total soluble proteins (TSP) were extracted from leaves of transplastomic and non-transformed T1 plants according to Kang et al. (2003) . Protein concentration was determined by the Bradford protein assay reagent kit (Bio-Rad). For ELISA assays, 50 ng TSPs were loaded into a 96-well microtiter plate (Immulux™ HB, Dynex Technologies, Germany) diluted in bicarbonate buVer (15 mM Na 2 CO 3 , 35 mM NaHCO 3 ; pH 9.6) in a 100 l volume, and incubated overnight at 4°C. After washing with PBST and blocking with 5% nonfat dry milk, the plate was incubated with goat anti-diphtheria toxin (US Biological, Swampscott, MA), mouse anti-Bordetella pertussis toxin (Abcam, Cambridge, MA), or rabbit anti-tetanus toxin (Ab34890, Abcam, Cambridge MA) antibodies diluted 1:1,000 (100 l per well). As secondary antibodies, anti-goat IgG alkaline phosphatase conjugate (Sigma A4187), anti-mouse IgG alkaline phosphatase conjugate (Sigma A1902), or anti-rabbit IgG alkaline phosphatase conjugate (Sigma A3687) were used. Following incubation with 100 l p-nitrophenyl phosphate liquid substrate (Sigma N7653) per well for 30 min at room temperature, reactions were stopped with 1 N HCl, and optical density was determined at 450 nm using an ELISA microplate reader (MRX Revelation, Dynex Technologies). For each assay, a standard curve was included, and a tetanus toxoid (NIBSC 02/126), at levels of 0.5, 1.5, 2.5, and 5 ng, was used for quantiWcation of the tetanus toxoid.

Male BALB/c mice, 12-to 14-week-old, (Harlan Sprague Dawley, Inc., Indianapolis, IN) were used for evaluation of the immune response against DPT protein. All animals were handled according to federal regulations for animal experimentation and care (NOM-062-ZOO-1999, Ministry of Agriculture, Mexico), and approved by the Institutional Animal Care and Use Committee.

Mice were immunized via oral route delivery with 50 mg of freeze-dried tobacco powder from E1 line containing 12.25, 21.5, and 5 g of tobacco-derived diphtheria, tetanus, and pertussis exotoxin epitopes, respectively. Positive and negative controls included DPT toxoids [diphtheria toxoid (NIBSC 02/176), tetanus toxoid (NIBSC 02/126), or pertussis toxoid (NIBSC 66/303)] and 50 mg of wild-typetobacco material, respectively. Each test group contained Wve animals for which three oral doses were administered on days 1, 7, and 14. Tobacco powder was hydrated in 0.5 ml water, and the suspension was administered to test animals via the intragastric route. Mice were fasted overnight prior to immunization. The animals were sacriWced on day 21 to collect serum samples and intestinal Xuids.

Serum samples were obtained from blood extracted by cardiac puncture from ether-anesthetized mice. Fluids from the gut were collected, and contents of the small and large intestines were Xushed out with 5 mL of cold RPMI 1640 medium. Then, 500 l of 10 mM p-hydroxymercuribenzoate (dissolved in 150 mM Tris-base) was added. Samples were centrifuged at 4°C for 10 min at 12,000g, their supernatants were immediately frozen, and stored at ¡70°C until assay.

ELISA assays of epitope-speciWc antibodies Responses in serum and intestinal Xuids were determined by an indirect enzyme-linked immunosorbent assay (ELISA). BrieXy, 96-well plates were coated with either 0.5 limit of Xocculation (Lf)/ml diphtheria toxoid (NIBSC 02/ 176), 0.5 Lf/ml (NIBSC 02/126) tetanus toxoid, or 0.23 international unit (UI)/ml (NIBSC 66/303) pertussis toxoid, and with 100 l per well of bicarbonate-carbonate buVer (15 mM Na 2 CO 3 , 35 mM NaHCO 3 , pH 9.6) for 2 h at 37°C. Plates were washed, and then blocked with 5% nonfat dry milk in PBS (100 mM NaCl, 10 mM Na 2 HPO 4 , 3 mM KH 2 PO 4 , pH 7.2). The serum was diluted 1:10 in PBST (0.05% v/v Tween-20 in PBS). Intestinal Xuid samples were diluted 1:2 in 5% nonfat milk dissolved in PBST, added to wells of sensitized plates, and incubated overnight at 4°C. The following antibodies were used as secondary antibodies: biotinylated goat anti-mouse IgG, IgA, IgG1, or IgG2a (Zymed Laboratories, San Francisco, CA). Plates were incubated for 1 h at 37°C and then washed with PBST. A conjugated horseradish peroxidase-streptavidin was added to each well, and plates were incubated for 1 h at room temperature. After washing, plates were incubated at room temperature with 100 l volume of a substrate solution (0.5 mg/ml o-phenylenodiamine, 0.01% H 2 O 2 , 50 mM citrate buVer, pH 5.2). Following color development (15 min), the reaction was stopped with 25 l of 2.5 M H 2 SO4. SpeciWc antibody levels were expressed as corresponding optical density values, and measured at 492 nm (A492) using a Multiskan Ascent (Thermo Electron Corporation, Waltham, MA) microplate reader.

ELISA data correspond to the geometric means of n = 5 mice per group and representative of duplicate experiments, and error bars correspond to standard deviations. Statistical signiWcance of diVerences (P < 0.05) was determined using analysis of variance.

The sequence of the plant-optimized synthetic gene encoding the DPT recombinant polypeptide, containing immunoprotective epitopes of tetanus, pertussis, and diphtheria exotoxins along with coding sequences of two adjuvants of the heavy chain tetanus toxin, was optimized as per codon bias for tobacco genes. Following optimization, the GC content was 37%, and although 76% of the codons were changed, the original amino acid sequence of the wild-type bacterial genes was maintained. The gene was synthesized by GenScript, and both mRNA processing and destabilizing motifs were avoided. The DPT gene was inserted into the plastid expression cassette of the pBic vector as described in "Materials and methods".

The plasmid pBic-DPT utilizes tobacco plastid genome sequences spanning the trnR-ACG and trnN-GUU regions to target the gene of interest into the chloroplast genome by double homologous recombination. The promoter is derived from the strong -70-type plastid rRNA operon promoter (Prrn) linked to the 5Ј untranslated region (UTR) of the T7 phage gene 10 (T7g10). The selectable marker gene aadA provides spectinomycin resistance for selecting stable transformants, and the plastid rbcL 3Ј untranslated region is involved in mRNA stability (Fig. 1a) .

The pBic-DPT construct was introduced into tobacco leaf tissues by microprojectile bombardment, and callus was observed on explants after 7-8 weeks on selection medium. After approximately 6 months, those plantlets regenerated in the third round of spectinomycin selection were allowed to root.

Presence of the transgene in T0 transformed plants was determined by PCR screening using primers speciWc (1F and 2R) for the DPT transgene. A 0.6-kb PCR-speciWc band was ampliWed in all four putative transplastomic plants, but it was absent in wild-type tobacco plants (Fig. 1b) . PCR-positive plants were transferred to pots containing soil mix, and grown in the greenhouse until maturity (Fig. 1c) . Among these four T0 lines, designated as B3, C1, D3, and E1, three plants, including B3, C1, and E1, were fertile and produced seeds. To check for stability of the DPT transgene, seeds from both wild-type (Wt) and the three fertile transformed lines were surface-sterilized, and allowed to germinate on a 500 mg/L spectinomycin-containing medium. All Wt seeds failed to germinate; while, T1 seeds of transformed lines E1 and B3 readily germinated on the spectinomycin containing medium (Fig. 1d) . Seeds of C1 line become bleached under spectinomycin selection and were deemed non-transformed.

PCR reactions were also carried out to assay for presence of the expression cassette using primers Xanking the native chloroplast genome, those adjacent to the site of integration (4T), and the Prrn promoter (3P) (Fig. 1a) . The detection of a 2 kb PCR product in all four putative transplastomic plants conWrmed presence of the expression cassette in the chloroplast genome (Fig. 1e) .

Transgene integration and homoplasmy were also conWrmed in T1 plants, lines B3 and E1 by Southern blot analysis. Total DNA from leaves was isolated from nontransformed and putative transplastomic plants and digested with HindIII, XbaI and SacI. The plastid genome organization of transplastomic tobacco using pBic-DPT and nontransformed tobacco is shown in Fig. 2a and b . When DNA was digested with HindIII, a 1.9 kb fragment was detected in spectinomycin-resistant plants, while a 1.1 kb fragment was detected in non-transformed plants (Fig. 2c) . When DNA was digested with XbaI, a 2 kb fragment was detected in spectinomycin-resistant lines; while, a 20 kb fragment was detected in non-transformed plants (Fig. 2d) using a DIGlabeled fragment of the trnN gene. The presence of a 1.8 kb hybridizing band in transformed lines when DNA was digested with Sac I using a DIG-labeled DPT probe further conWrmed the integration of the DPT transgene (Fig. 2e) . These results veriWed that the transgene was inserted within the intergenic region between trnN and trnR genes and con-Wrmed homoplasmy in both B3 and E1 lines.

The DPT protein was detected by speciWc antibodies against DPT toxoids using Western blotting and ELISA assays for TSP extracted from three plants of T1 transplastomic line E1, non-transformed plants, and positive controls (toxoids). A single band of the expected size, 17 KDa, was detected in T1 plants of line E1 using polyclonal antibodies against either tetanus toxid (Fig. 3a) or anti-diphtheria toxoid (Fig. 3b) .

Chloroplast-produced DPT protein showed signiWcant high readings for all three ELISA assays using polyclonal antibodies against the three DPT toxoids. Anti-tetanus toxin assays showed the highest signal, and followed by the antidiphtheria assay (Fig. 3c) . Although signals were weak, signiWcant readings were detected for the anti-Bordetella pertussis toxin assay (Fig. 3c) . It is likely that the pertussis moiety was either not properly displayed or not as well-displayed as those for the other two toxins. All these Wndings suggested that native epitopes of the three bacterial components present in the DPT polypeptide were conserved, and were properly displayed. Based on the ELISA assays, protein quantiWcation was carried out by comparing absorbance readings of plant samples with known quantities of the tetanus toxoid. The linear standard curve was used to estimate the amount of the DPT protein present in the transgenic lines. The accumulation of the recombinant DPT protein in three plants derived from transplastomic line E1 was up to 24.5 g per 100 mg of leaf tissue, and approximately accounting for 0.8% of TSP (Fig. 3d) .

To evaluate immune responses of the recombinant DPT protein produced, we proceeded to feed mice with transplastomic tobacco leaves. Mice were inoculated orally with 50 mg of freeze-dried leaves, collected from the transplastomic E1 line (T-E1), in three doses. Mice fed transplastomic tobacco expressing DPT elicited signiWcant serum IgG antibody responses to tetanus, diphtheria, and pertussis moieties, and similar to those elicited by the positive DPT(+) group (Fig. 4a) . While, mice fed wild-type tobacco (Wt) had the lowest IgG responses (P < 0.05) (Fig. 4a) . SigniWcant speciWc IgA antibody levels were detected in intestinal tissues (Fig. 4b) , but no signiWcant IgG antibody responses were detected (Fig. 4c) . Similar high levels of speciWc IgA responses were induced in mice immunized with E1 tobacco leaves. SpeciWc serum anti-DPT IgG1 (Fig. 5a) and IgG2a (Fig. 5b) antibodies were elicited in mice immunized with the tobacco-derived DPT. Overall, a higher IgG1 than IgG2a antibody response was detected. This suggested that a humoral immune response, rather than a cellular-mediated response, was predominantly elicited. Altogether, the above Wndings indicated that oral delivery of tobacco-derived DPT was immunogenic in test animals.

The diphtheria, pertussis, and tetanus (DPT) vaccine is widely used for vaccination of infants and children worldwide. Although its eYcacy is well documented, it is expensive due to the production process which involves both scale-up production and puriWcation of recombinant proteins from three diVerent bacteria. In order to reduce side eVects, a few attempts have been made to produce a multicomponent recombinant DPT vaccine. Boucher et al. (1994) engineered a fusion protein comprising a fragment of the tetanus toxin and the C180 peptide of the S1 subunit of the pertussis toxin (Barbieri et al. 1992) . The resulting chimeric protein displayed the protective epitopes of both components. Recently, Aminian et al. (2007) reported on the expression of a fusion protein comprised of the immunoprotective S1 fragment of the pertussis toxin, the fulllength nontoxic diphtheria toxin, and the C fragment of the tetanus toxin. The resulting polypeptide appeared to conserve the native epitopes. However, for all these approaches, bacterial fermentation and puriWcation steps were required to purify the recombinant protein, thereby contributing to the high cost of production.

To date, several important human diseases have been targeted for plant-based vaccine development that will contribute to a safe as well as inexpensive vaccine production system (Korban et al. 2002) . Recently, a novel polypeptide containing the DPT immunoprotective exotoxin epitopes has been designed and used to demonstrate expression of this fusion protein in transgenic tomato plants ). The tomato-derived DPT polypeptide was recognized by antibodies directed against diphtheria, pertussis, and tetanus toxins; however, expression levels in tomato lines were low, t0.01% TSP .

In this study, attempts were made to enhance the expression of the DPT polypeptide in tobacco plants via plastid transformation. A synthetic gene encoding for the DPT polypeptide was designed in order to optimize its expression in tobacco chloroplasts. Following microprojectile bombardment with the DPT gene construct and after several cycles of selection, several putative transformants were obtained. PCR analysis of four T0 plants demonstrated presence of the DPT transgene. Moreover, presence of the transgene, speciWc site integration, and homoplasmy were conWrmed in the T1 progeny. Western blots and ELISA assays conWrmed that the tobacco-derived DPT protein was recognized by speciWc antibodies against each of diphtheria, pertussis, and tetanus toxins. This also suggested that the three components present in the DPT polypeptide properly displayed the native epitopes. Protein quantitation using ELISA analysis revealed a DPT protein content of 0.8% of TSP. This DPT level was approximately 110-fold higher than that detected previously in our transgenic tomato plants derived via nuclear transformation ).

Using transplastomic technologies, Herz et al. (2005) indicated that expression levels of up to 6-10% of TSP could be obtained. In another report, expression of the tetanus fragment C toxin in chloroplast transformed plants reached 10-25% of TSP content (Tregoning et al. 2005) . In this study, the DPT transgene was expressed under the control of the Prrn promoter and the 5Ј-UTR T7G10, reported to mediate high expression in plastids (Kuroda and Maliga 2001a) . The relatively low DPT content obtained in transplastomic tobacco plants in this study might be attributed to several factors. Among these, it is likely that the sequence immediately downstream of the start codon, which has been associated with translation eYciency, might contribute to low levels of expression (Kuroda and Maliga 2001b) . Several reports indicated that the amount of recombinant proteins expressed in chloroplasts was lower than 1% of TSP (Maliga 2004) . For example, Lee et al. (2006) reported levels of 0.002-0.004% of TSP of the viral capsid protein antigen against Epstein-Barr virus expressed in tobacco plastids. They suggested that this low level of protein accumulation was likely due to post-transcriptional events and protein stability. Herz et al. (2005) reported that expression levels in plastids were very much dependent on the vector, promoter, and translational control element(s), among others. Therefore, these various factors might have contributed to the low levels of expression observed in this study. Mice feeding studies were conducted using freeze-dried tobacco leaves of transplastomic line E1, expressing DPT. Results suggested that the recombinant DPT protein induced speciWc systemic and mucosal antibody responses in vaccinated mice. To determine whether eVective protective immunity was induced, it will be necessary to assess animal responses and survival to lethal challenge with each of the exotoxins. Moreover, future research would involve targeting the transfer of the DPT transgene into edible crops such as lettuce or carrot that have been recently successfully transformed via plastid transformation (Kanamoto et al. 2006; Kumar et al. 2004 ).

In conclusion, we have successfully expressed the multi-epitope DPT polypeptide in transplastomic tobacco plants at levels higher than those reported in transgenic tomato plants. This further demonstrated successful transformation of plastids with a fusion protein of complex oligemeric structures that remain functional and retain their antigenicities. Moreover, this candidate plant-based vaccine was immunogenic via oral route delivery in mice. This model system would allow for the development of new experimental DPT subunit vaccines having several advantages, including safe and eVective production and delivery, reduced side eVects, and low cost of production.

Humoral and cellular immune responses in mice immunized with recombinant Mycobacterium bovis bacillus Calmette-Guérin producing a pertussis toxin-tetanus toxin hybrid protein

Expression and puriWcation of a trivalent pertussis toxin-diphtheria toxin-tetanus toxin fusion protein in Escherichia coli

Construction of a diphtheria toxin a fragment-c180 peptide fusion protein which elicits a neutralizing antibody response against diphtheria toxin and pertussis toxin

Neutralizing antibodies and immunoprotection against pertussis and tetanus obtained by use of a recombinant pertussis toxin-tetanus toxin fusion protein

Update to supplementary ACIP statement. Recommendations of the Advisory Committee on Immunization Practices (ACIP)

Preventing tetanus, diphtheria, and pertussis among adults: use of tetanus toxoid, reduced diphtheria toxoid and acellular pertussis vaccine

Transgenic plants for vaccine production: expectations and limitations

Expression of the native cholera toxin B subunit gene and assembly as functional oligomers in transgenic tobacco chloroplasts

Chloroplast genetic engineering to improve agronomic traits

Oral immunization with pBsVP6 transgenic alfalfa protects mice against rotavirus infection

Intracellular fate of a recombinant protein is tissue dependent

Chloroplast targeting of FanC, the major antigenic subunit of Escherichia coli K99 Wmbriae, in transgenic soybean

Transgenic plants as factories for biopharmaceuticals

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression

Plantderived measles virus hemagglutinin protein induces neutralizing antibodies in mice

The use of combination vaccines has improved timeliness of vaccination in children

DNA vaccine encoding pertussis toxin S1 subunit induces protection against Bordetella pertussis in mice

EYcient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids

Expression of the B subunit of E. coli heat-labile enterotoxin in the chloroplasts of plants and its characterization

A plant-derived edible vaccine against hepatitis B virus

Foods as production and delivery vehicles for human vaccines

Plant-based vaccine: mice immunized with chloroplast-derived anthrax protective antigen survive anthrax lethal toxin challenge

Plastid-expressed betaine aldehyde dehydrogenase gene in carrot cultured cells, roots, and leaves confers enhanced salt tolerance

Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs

Sequences downstream of the translation initiation codon are important determinants of translation eYciency in chloroplasts

Edible vaccines: current status and future

Expression of viral capsid protein antigen against Epstein-Barr Virus in plastids of Nicotiana tabacum cv

Accumulation of recombinant SARS-CoV spike protein in plant cytosol and chloroplasts indicate potential for development of plant-derived oral vaccines

Expression of human papillomavirus type 16 L1 protein in transgenic tobacco plants

Plant-derived pharmaceuticals-the road forward

Progress towards commercialization of plastid transformation technology

Plastid transformation in higher plants

Neutralizing immunogenicity of transgenic carrot (Daucus carota L.)-derived measles virus hemagglutinin

Expression of hepatitis B surface antigen in transgenic plants

Expression of Norwalk virus capsid protein in transgenic tobacco and protein and its oral immunogenicity in mice

Expression of the rabies virus glycoprotein in transgenic tomatoes

Safety and immunogenicity of a primary course and booster dose of a combined diphtheria, tetanus, acellular pertussis, hepatitis B and inactivated poliovirus vaccine

Production of hepatitis B surface antigen in transgenic plants for oral immunization

Expression of Escherichia coli heat-labile enterotoxin b subunit (LTB) in carrot (Daucus carota L.)

Ingestion of transgenic carrots expressing the Escherichia coli heat-labile enterotoxin B subunit protects mice against cholera toxin challenge

Expression of an Escherichia coli antigenic fusion protein comprising the heat labile toxin B subunit and the heat stable toxin and its assembly as a functional oligomer in transplastomic tobacco plants

Vaccine antigen production in transgenic plants: strategies, gene constructs and perspectives

Sustained eYcacy during the Wrst 6 years of life of 3-component acellular pertussis vaccines administered in infancy: the Italian experience

Molecular cloning: a laboratory manual

Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response

Transgenic tomatoes express an antigenic polypeptide containing epitopes of the diphtheria, pertussis and tetanus exotoxins, encoded by a synthetic gene

High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene

Immunogenicity in humans of a recombinant bacterial antigen delivered in a transgenic potato

Human immune responses to a novel Norwalk virus vaccine delivered in transgenic potatoes

Epidemiology of pertussis

Immunogenicity of transgenic plant-derived hepatitis B surface antigen

Expression of tetanus toxin fragment C in tobacco chloroplasts

Protection against tetanus toxin using a plant-based vaccine

Informal consultation on the control of pertussis with whole cell and acellular vaccines

Expression and characterization of Helicobacter pylori heat-shock protein A (HspA) protein in transgenic tobacco (Nicotiana tabacum) plants

The stem-loop region of the tobacco psbA 5'UTR is an important determinant of mRNA stability and translation eYciency

Acknowledgments This research was partially supported by a grant received from the CONACYT project 56980, CONACYT University of Illinois Joint Research Program, and CONACYT scholarships 172307 and 165946 to support graduate studies of Ruth Soria-Guerra and Sergio Rosales-Mendoza, respectively. Funding support was also received from the Simon F. Guggenheim Memorial Foundation (for SSK).