key: cord-1002710-m33ha8o9
authors: Beucher, Guillaume; Blondot, Marie-Lise; Celle, Alexis; Pied, Noémie; Recordon-Pinson, Patricia; Esteves, Pauline; Faure, Muriel; Métifiot, Mathieu; Lacomme, Sabrina; Dacheaux, Denis; Robinson, Derrick; Längst, Gernot; Beaufils, Fabien; Lafon, Marie-Edith; Berger, Patrick; Landry, Marc; Malvy, Denis; Trian, Thomas; Andreola, Marie-Line; Wodrich, Harald
title: SARS-CoV-2 transmission via apical syncytia release from primary bronchial epithelia and infectivity restriction in children epithelia
date: 2021-05-28
journal: bioRxiv
DOI: 10.1101/2021.05.28.446159
sha: 9399dd324a450b0b45d3b3829aad73649d3c5bc1
doc_id: 1002710
cord_uid: m33ha8o9

The beta-coronavirus SARS-CoV-2 is at the origin of a persistent worldwide pandemic. SARS-CoV-2 infections initiate in the bronchi of the upper respiratory tract and are able to disseminate to the lower respiratory tract eventually causing acute severe respiratory syndrome with a high degree of mortality in the elderly. Here we use reconstituted primary bronchial epithelia from adult and children donors to follow the infection dynamic following infection with SARS-CoV-2. We show that in bronchial epithelia derived from adult donors, infections initiate in multi-ciliated cells. Then, infection rapidly spread within 24-48h throughout the whole epithelia. Within 3-4 days, large apical syncytia form between multi-ciliated cells and basal cells, which dissipate into the apical lumen. We show that these syncytia are a significant source of the released infectious dose. In stark contrast to these findings, bronchial epithelia reconstituted from children donors are intrinsically more resistant to virus infection and show active restriction of virus spread. This restriction is paired with accelerated release of IFN compared to adult donors. Taken together our findings reveal apical syncytia formation as an underappreciated source of infectious virus for either local dissemination or release into the environment. Furthermore, we provide direct evidence that children bronchial epithelia are more resistant to infection with SARS-CoV-2 providing experimental support for epidemiological observations that SARS-CoV-2 cases’ fatality is linked to age. Significance Statement Bronchial epithelia are the primary target for SARS-CoV-2 infections. Our work uses reconstituted bronchial epithelia from adults and children. We show that infection of adult epithelia with SARS-CoV-2 is rapid and results in the synchronized release of large clusters of infected cells and syncytia into the apical lumen contributing to the released infectious virus dose. Infection of children derived bronchial epithelia revealed an intrinsic resistance to infection and virus spread, probably as a result of a faster onset of interferon secretion. Thus, our data provide direct evidence for the epidemiological observation that children are less susceptible to SARS-CoV-2.

further confirmed by electron microscopy (Fig. S1D) . The presence of well differentiated cilia 152 structures and tight junctions was also confirmed (Fig. S1D ). Next, we determined the localization 153 of ACE2, the primary receptor for SARS-CoV-2 in our model using IF analysis (Fig. S1E, movie S3) . 154

Co-label with antibodies against ACE2 and acetylated tubulin confirmed that ACE2 was expressed 155 in apical multi-ciliated cells as previously reported (4, 35). Moreover, our data showed a 156 prominent exposure of ACE2 on individual cilia reaching into the apical lumen (orange arrows), 157 which suggests facilitated access e.g. for virus coming in through the respiratory tract. 158 159 SARS-CoV-2 monitoring and BE infection 160

Next, BE were inoculated on the apical side with a suspension of a reference SARS-CoV-2 strain 161 (BetaCoV/France/IDF0372/2020) at a multiplicity of infection (MOI) of 0.012. Apical and 162 basolateral compartments were collected 3 days post-infection (dpi) and used to infect Vero E6 163 cells (Fig. 1A) . A cytopathic effect (CPE) was observed in the Vero E6 cell culture as early as 2 days 164 post-infection when inoculated with the apical washes, indicating an effective infection and 165 replication of the virus (Fig. 1A) . When using the basal medium, 3 days of inoculation were 166 necessary to observe a similar CPE (Fig. 1A) . This faster appearance of CPE when using the apical 167 fraction may be correlated to a higher viral titre compared to the basal medium. To ascertain that 168 this CPE is indeed due to viral replication and not a toxic effect from the inoculation, we extracted 169 total RNAs from the Vero E6 supernatant on the next day (4 dpi) and quantified viral RNAs using 170 in-house qRT-PCR targeting the N-gene region. No RNA could be detected in the supernatant of 171 Vero E6 cells inoculated with either the apical or basolateral fractions obtained from non-infected 172 BE (Fig. 1B, control) . In contrast, when using basolateral or the apical fraction from infected BEs, 173 the Vero E6 supernatant contained high level of SARS-CoV-2 RNA, comparable to what is observed 174 with a direct infection of Vero E6 cells infected at a MOI of 0.01 (Fig. 1B) . These data attest that 175 SARS-CoV-2 actively replicates in reconstituted BE and that inoculation from the apical side results 176 in an active infection. To detect virus-infected cells, we generated monoclonal antibodies against 177 the SARS-CoV-2 N nucleocapsid protein using bacterially expressed and purified full-length 178 protein as detailed in the methods section. Hybridoma supernatants were tested using western 179 blot and IF detection through confocal microscopy (Fig. S2 ). Of several positive clones, hybridoma 180 clone 3G9 was selected for this study as it specifically recognized the N protein of SARS-CoV-2 181 ( Fig. S2A ) and detected infected cells in IF staining (Fig. S2B) . To investigate which cell type is the 182 primary target during SARS-CoV-2 infection, fully differentiated epithelia were infected with SARS-183

CoV-2 at a MOI of 0.01 for 1 h from the apical side after which the viral suspension was removed. 184

Epithelia were fixed 24h post-infection in 4% paraformaldehyde (PFA) and processed for IF 185 analysis using SARS-CoV-2-N specific antibodies. We successfully detected infected cells in the BE 186 (green signal Fig. 1C-E) . Specific co-label of Muc5A showed that goblet cells were not infected 187 (magenta signal, Fig. 1C , movie S4). Similarly, no co-localization could be observed between the 188 SARS-CoV-2 N protein and CytK5 showing that basal cells were not infected either (Fig. 1D , movie 189 S5). Conversely, the signal arising for the N protein staining was systematically associated with 190 strong labelling for acetylated tubulin, a specific marker for multi-ciliated cells (orange arrow, Fig.  191 1E, movie S6). This is consistent with previous reports that apical multi-ciliated cells are the 192 primary target cells for SARS-CoV-2 infection (4, 28, 36). In addition, all BEs were co-labelled with 193 fluorescent phalloidin to mark cell boundaries for 3D imaging of the entire epithelial depth. 194

Infected cells were exclusively located at the apical surface of the BE (Fig. 1C To better understand how SARS-CoV-2 spreads in the epithelium after initial infection of multi-201 ciliated cells, we infected BEs from four individual adult donors (A1 to A4, Table 1 ) and monitored 202 them over the course of 7 days. Low magnification images obtained using IF microscopy showed 203 that N protein could be detected within 24h of infection in a small number of cells ( Fig. 2A) . 204

Nonetheless, the signal number and intensity increased drastically from the 2 dpi time-point and 205 tended to decrease slightly towards the end of the observation period ( Fig. 2A) . Similar results 206 were obtained with the other two donors suggesting rapid onset of viral replication and spread 207 (not shown). We quantified the number of N-positive signals at low resolution for each donor 208 confirming that the number of infected cells strongly increased within two to three days of the 209 initial infection, reaching a maximum around day four, and consistently decreased somewhat on 210 the seventh day for all donors (Fig. 2B ). Of note, much larger N protein associated signals could 211 be observed at the peak of the infection. These larger structures were co-labelled with cytokeratin 212 5, the marker for basal cells (see arrows in Fig. 2A ). This observation started on the third day but 213 was most prominent on the fourth day and was observed for all donors. Therefore, we also 214 quantified the size of the N protein associated signals over time (Fig. 2C) . The analysis revealed a 215 statistically significant average increase in signal size between the third and fourth day for all four 216 donors. In parallel to the imaging analysis, release of newly produced viruses into the apical mucus 217 was quantified by qRT-PCR (Fig. 2D ). For all four donors, the viral RNA copy number correlated 218 with the observed cellular N protein labelling with a fast increase from day 2 reaching a plateau 219 between 3 and 4 dpi. Altogether, these data suggested that apical SARS-CoV-2 inoculation of BEs 220 resulted in efficient infection and subsequent progeny production and release into the apical 221 lumen. 222 223

Using high-resolution microscopy, we observed that larger N-positive signals corresponded to 225 multinucleated cellular structures reminiscent of syncytia. These syncytia could be found in all 226 regions of the epithelia (Fig. 3) and their formation at day 4 was common to all four donors tested. 227

In contrast, we did not observe any syncytia formation in non-infected control epithelia. were between 46 and 63 years old (table 1) , which puts them statistically into a medium/high risk 286 group to develop severe COVID-19 symptoms. In contrast, several reports have indicated that 287 children are much less susceptible to severe forms of COVID-19, while their role in spreading virus 288 infections is controversially discussed (37, 38). To investigate whether SARS-CoV-2 infects BEs 289 differently depending on the age of donors, we prepared epithelia through expansion and 290 differentiation of bronchial epithelial cells obtained from children ( Table 1) that have undergone  291 bronchial fibroscopy for chronic bronchopathy (child C1) or bronchiectasis (children C2 and C3). 292

Fully differentiated epithelia from children showed the same cellular arrangement (epithelial 293 cells, basal cells, goblet cells) and physiological properties (cilia beating, mucus production) as 294 adult derived epithelia. A kinetic experiment was performed to compare the SARS-CoV-2 infection 295 dynamics in BEs derived from children (C1 to C3) or from adult donors (A5 and A6). The BEs were 296 fixed at 1, 2, 3, 4 and 7 d.p.i. with a non-infected control for each donor run in parallel and fixed 297 at day 7. Individual epithelia were fixed and processed for IF analysis using antibodies against 298 cytokeratin 5, SARS-CoV-2 N-protein and counterstained with fluorescently labelled phalloidin 299 and DAPI. As observed before (Fig. 2) , infecting BEs from adult donors at a MOI of 0.012 resulted 300 in a fast increase in the presence of infected cells (within 48h) and the formation of a significant 301 amount of syncytia on the fourth day (A6, Fig. S3A ). In sharp contrast, all child derived epithelia 302 showed a remarkable resistance to virus infection (Fig. S3 B-D) . Of note, virus spread differed 303 significantly in BE originating from the individual child donor. A slow but substantial increase in 304 infected cells over time was observed in BE derived from donor C1 (Fig. S3B ). In comparison, BE 305 derived from C2 did not support substantially increase of the number of infected cells after the 306 initial appearance of positive cells (Fig. S3C ) and BE derived from the last donor, C3, only ever 307 showed very few infected cells, reminiscent of an abortive infection (Fig. S3D ). Low magnification 308 imaging of the entire epithelia showed that initial infections in BE from donor C1 were limited to 309 few cells. The N-protein associated signal seemed to grow over time into foci of infection that 310 further enlarged by infecting surrounding cells at the periphery ( Fig. 5A ). Quantifying the total number of infected cells in each epithelium 325 confirmed our observation (Fig. 5D) . In contrast to the adult control, no significant differences in 326 signal size was observed between day three and day four for either of the children derived 327 epithelia (Fig. 5E) . Still, the average signal size appeared larger likely due to clustering of infected 328 cells (Fig. 5E ). For all three children derived epithelia and the adult control we also measured the 329 accumulation of SARS-CoV-2 in the apical lumen using quantitative PCR (Fig. 5F ). The quantities 330 of released virus over time accurately reflected the spread of infection observed by IF and 331 quantification of infected cells. Taken together our analysis clearly demonstrated that epithelia 332 from children were less susceptible to SARS-CoV-2 and exhibited an intrinsic resistance towards 333 virus infection and/or spread. One possible explanation for this intrinsic resistance of children BE 334 could be differences in IFN response (39, 40) or morphological differences (41). Accordingly, we 335 compared the accumulation of interferon l 1/3 and measured the concentration in BE medium 336 from adults and children in response to SARS-CoV-2 infection (Fig. 5G) . We did not find interferon 337 First, the overall viral production was very low in BE of children compared to adults, which is 414 reflecting the slower kinetic in the onset of virus production over time. In agreement with the 415 virus quantification, child epithelia showed a remarkable resistance to virus infection as very few 416 infected cells were observed. Rather than rapidly spreading throughout the entire epithelia, as 417 observed for adults, the infected cells in children form cluster or foci of infected cells. From these 418 foci, the infection slowly spread into the surrounding bystander cells. Yet, syncytia formation was 419 also observed, at least in one child, suggesting that the fusion of basal cells with multi-ciliated 420 cells was not restricted to adult infected BE. However, the number of syncytia was much lower 421 than in adults reflecting the low virus spread. The obvious difference in susceptibility to SARS-422

CoV-2 infection between adults and children, which we observed in the BE model is in agreement 423 with the reduced epidemiological infection rate described for children and strong discrepancy in 424 death rate between children and adults/elderly (24, 25). A very recent study using nasal BE also 425 showed differences in the susceptibility to SARS-CoV-2 infection between adults and children (32). 426

The reason for this intrinsic difference between adults and children BE is unknown. One possible 427 explanation could be an age-related variation in the expression or accessibility of the primary viral 428 receptors (ACE2 and TMPRSS2) (48). We show that children BE Future studies will be required to study the exact mechanism behind the differences in IFN 440 response that we observed. Taken together our data clearly demonstrate that BE from children 

Bronchial epithelial cell culture was established from bronchial brushings or lung resection 478 performed between the third and fifth bronchial generation from patients undergoing elective 479 surgery as previously described (34). Bronchial epithelium explants were cultured using 480

PneumaCult Ex medium (Stemcell, Vancouver, Canada) for expansion of basal epithelial cells at 481 37°C in 5% CO 2 . Then, 10 5 basal cells were grown on cell culture inserts (Corning, New York, NY) 482 within the air-liquid interface for 21 days using PneumaCult ALI medium (Stemcell, Vancouver, 483 Canada). Such a culture allows the differentiation into pseudostratified muco-ciliary airway 484 epithelium composed of ciliated cells, goblet cells, club cells and basal cells. The complete 485 differentiation was assessed by the capacity of cilia to beat and mucus production under light 486 microscope. The study received approval from the local and national ethics committee from the 487 CNIL through the TUBE collections. 488

Prior to infection, epithelia were washed three times with PBS to remove mucus and basal ALI 490 medium was exchanged with 500 µL of fresh medium. The inoculum containing 1200 PFU of virus 491 or medium-only controls were added to the apical surface to a final volume of 100 µL. Viral 492 supernatant was removed after 1 hour incubation at 37°C and infection was followed for the 493 indicated time points. Viral production was then quantified by qRT-PCR using 3 consecutively 494 collected apical washes of 100 µL PBS. 495

For quantification of viral RNA by qRT-PCR, total RNA was isolated using the High Pure Viral RNA 497 kit (Roche) according to the manufacturer's instruction. Viral RNA was quantified using GoTaq® 1-498

Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F 499 cgcaacagttcaagaaattc 28844-28864) and reverse primers (Ngene R ccagacattttgctctcaagc 28960-500 28981). Copy numbers were calculated from a standard curve produce with serial 10-fold dilutions 501 of SARS-CoV-2-RNA. Amplification program began with the RT-step 15 min at 50°C then the 502 denaturation step 10 min at 95°C, and 10 s at 95°C, 10 s at 60°C and 10 s at 72°C (40 cycles). The 503 melting curve was obtained by temperature increment 0,5°C/s from 60°C to 95°C. 504

Human IL-29/IL-28B (IFN-lambda 1/3) concentration in SARS-CoV-2 infected epithelium basal 506 media was quantified using ELISA technics following manufacturer's recommendations (R&D 507 systems, Minneapolis, USA). 100 µl of media was used for each point. 508

For antigen detection, BE were washed repeatedly with PBS to remove mucus then fixed with 4% 510 paraformaldehyde for 30min using complete insert immersion. Epithelia were then washed and 511 permeabilized with 0.5% TritonX-100 in PBS for 10min at room temperature and blocked in IF 512 buffer (PBS containing 10% SVF and 0.5% saponin) for 1h at room temperature. Primary antibody 513 and fluorescently labeled phalloidin to stain the actin cytoskeleton was diluted in IF buffer and 514 applied to inserts for 1h at room temperature. Samples were washed three times under agitation 515 with PBS and incubated with secondary antibody diluted in IF buffer and incubated for 2h at room 516 temperature. Insert were then washed in PBS, desalted in H 2 O miliQ and rinsed in Ethanol 100% 517 and air-dried. Membranes were then removed from inserts and mounted in DAPI (4',6-diamidino-518 2-phenylindole) containing DAKO Fluorescence Mounting Medium prior to microscopy analysis. 519

Mounted samples were subsequently examined on an epifluorescence microscope (Leica inverted 520 DRMi6000 widefield microscope) at low resolution for kinetic studies. High resolution analysis 521 was performed on a SP8 confocal microscope (Leica Microsystems at the Bordeaux Imagery 522 center) using maximal pixel resolution at 20x, 40x or 63x respectively and 0. 

Note that ciliated cells are located to the apical side (see movie S1 for 3D). C: As in B but the 

Epidemiology and cause of severe acute respiratory syndrome (SARS) 570 in Guangdong, People's Republic of China

Origin and evolution of pathogenic coronaviruses

A Novel Coronavirus from Patients with Pneumonia in China

A pneumonia outbreak associated with a new coronavirus of probable bat 577 origin

A new coronavirus associated with human respiratory disease in China

Targeting SARS-CoV-2 581 Proteases and Polymerase for COVID-19 Treatment: State of the Art and Future 582 Opportunities

Coronavirus biology and replication: 584 implications for SARS-CoV-2

Genomic characterization of the 2019 novel human-pathogenic 586 coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan. 587 Emerging microbes & infections 9

SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked 589 by a Clinically Proven Protease Inhibitor

Viral Respiratory Pathogens and Lung Injury

Journal of thoracic oncology : official 594 publication of the International Association for the Study of

Pathological study of the 2019 novel coronavirus disease (COVID-19) through 597 postmortem core biopsies. Modern pathology : an official journal of the United States and 598 Canadian Academy of Pathology

Pulmonary pathology of COVID-19: a review of autopsy studies. Current 600 opinion in pulmonary medicine

Persistence of viral RNA, pneumocyte syncytia and thrombosis are 602 hallmarks of advanced COVID-19 pathology

Single-cell landscape of bronchoalveolar immune cells in patients with 604 COVID-19

Clinical features of patients infected with 2019 novel coronavirus in 606 Wuhan

Comparative pathogenesis of COVID-19, MERS, and SARS in a nonhuman 608 primate model

Characteristics of SARS-CoV-2 and COVID-19

Virological assessment of hospitalized patients with COVID-2019

Transmissibility of COVID-19 depends on the viral load around onset in 614 adult and symptomatic patients

SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients

Identification of RT-PCR-Negative Asymptomatic COVID-19 Patients via 618 Serological Testing. Frontiers in public health

SARS-CoV-2 Infection in Children

Epidemiology of SARS-CoV-2

On the Effect of Age on the Transmission of SARS-CoV-623 2 in Households, Schools, and the Community

Long-Term Modeling of SARS-CoV-2 Infection of In Vitro Cultured Polarized 626 Human Airway Epithelium

Nikaïa 628 Smith, Sylvain Levallois

Morphogenesis and cytopathic effect of SARS-CoV-2 infection in human 634 airway epithelial cells

Imbalanced Host Response to SARS-CoV-2 Drives Development of 636 COVID-19

Impaired type I interferon activity and inflammatory responses in severe 638 COVID-19 patients

Inborn errors of type I IFN immunity in patients with life-threatening 640 COVID-19

Asthmatic Bronchial Smooth Muscle Increases CCL5-Dependent Monocyte 647 Migration in Response to Rhinovirus-Infected Epithelium

House dust mites induce proliferation of severe asthmatic smooth muscle 650 cells via an epithelium-dependent pathway. American journal of respiratory and critical 651 care medicine 191

ACE2 localizes to the respiratory cilia and is not increased by ACE inhibitors 653 or ARBs

An Infectious cDNA Clone of SARS-CoV-2

Infectivity of severe acute respiratory syndrome coronavirus 2 in children 657 compared with adults

Clinical infectious diseases : an official publication of the Infectious Diseases Society 661 of America

Importance of Type I and III Interferons at 663 Respiratory and Intestinal Barrier Surfaces

Single-cell analyses reveal SARS-CoV-2 interference with intrinsic immune 665 response in the human gut

Functional analysis and evaluation of 667 respiratory cilia in healthy Chinese children

Severe acute respiratory syndrome coronavirus infection of human 669 ciliated airway epithelia: role of ciliated cells in viral spread in the conducting airways of 670 the lungs

Syncytia formation by SARS-CoV-2-infected cells

Furin cleavage of SARS-CoV-2 Spike promotes but is not essential for 674 infection and cell-cell fusion

Drugs that inhibit TMEM16 proteins block SARS-CoV-2 spike-induced 676 syncytia

Pulmonary pathology of early-phase COVID-19 pneumonia in a patient with 678 a benign lung lesion

Super-spreaders in infectious diseases

Age-determined expression of priming protease TMPRSS2 and 683 localization of SARS-CoV-2 in lung epithelium

SARS-CoV-2 Nucleocapsid Protein Targets RIG-I-Like Receptor 686 Pathways to Inhibit the Induction of Interferon Response

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) membrane 688 (M) protein inhibits type I and III interferon production by targeting RIG-I/MDA-5 689 signaling

Human rhinovirus species C infection in young children with acute wheeze 691 is associated with increased acute respiratory hospital admissions. American journal of 692 respiratory and critical care medicine 188

Dynamics and predisposition of respiratory viral co-infections in 694 children and adults. Clinical microbiology and infection : the official publication of the 695

Association between human rhinovirus C and severity of acute asthma 698 in children

Sensitization to Aspergillus fumigatus and lung function in children 700 with cystic fibrosis

Epidemiological analysis and rapid detection by one-step multiplex PCR assay 703 of Haemophilus influenzae in children with respiratory tract infections in Zhejiang 704 Province

Low type I interferon 706 response in COVID-19 patients: Interferon response may be a potential treatment for 707 COVID-19

COVID-19: lambda interferon against viral load and 709 hyperinflammation

Retrospective Multicenter Cohort Study Shows Early Interferon Therapy Is 711 Associated with Favorable Clinical Responses in COVID-19 Patients

The amphipathic helix of adenovirus capsid protein VI contributes to 714 penton release and postentry sorting

A SIMPLE METHOD OF ESTIMATING FIFTY PER CENT 716 ENDPOINTS12

Top image shows a Z-projection, 737 the bottom image shows an individual Z-section of a 3D reconstruction counterstained with 738 phalloidin. Scale bar is 10µm, for full Z-stack see movie S4. D: Experiment and presentation as in 739 (B) stained with anti-N (green signal) to identify infected cells and anti-cytokeratin 5 to identify basal 740 cells (magenta signal) and counterstained with DAPI (grey signal). Scale bar is 10µm, for full Z-741 stack see movie S5. E: Experiment and presentation as in (B) stained with anti-N (green signal) to 742 identify infected cells and anti-acetylated tubulin to identify multiciliated cells (magenta signal)

A: Representative widefield 750 microscopy images of BE from two adult donors

Large specific signals in all channels are apparent on day four (white arrows). B: 756 The absolute number of N-positive signals was determined for each BE for the whole epithelia on 757 each day as indicated. Data shown are absolute number of N dots quantification at different days 758 post-infection and described in material and methods. The (#) sign marks points with partial BE 759 damage C: Signals quantified in (B) were classed by size and plotted as min to max Box & Whisker 760 plots

 Figure S3 . SARS-CoV-2 infection kinetic of bronchial epithelia (BE) from children and adult donor.