key: cord-0988215-oxsh7w1z
authors: Li, Ming; Wu, Zhiyong; Gu, Hong; Cheng, Dawei; Guo, Xizhi; Li, Lan; Shi, Caiyun; Xu, Guoyi; Gu, Shichao; Abid, Muhammad; Zhong, Yunpeng; Qi, Xiujuan; Chen, Jinyong
title: AvNAC030, a NAC Domain Transcription Factor, Enhances Salt Stress Tolerance in Kiwifruit
date: 2021-11-02
journal: Int J Mol Sci
DOI: 10.3390/ijms222111897
sha: 4b327d9796799a682ddfb7cde66adbeaec4fc1f7
doc_id: 988215
cord_uid: oxsh7w1z

Kiwifruit (Actinidia chinensis Planch) is suitable for neutral acid soil. However, soil salinization is increasing in kiwifruit production areas, which has adverse effects on the growth and development of plants, leading to declining yields and quality. Therefore, analyzing the salt tolerance regulation mechanism can provide a theoretical basis for the industrial application and germplasm improvement of kiwifruit. We identified 120 NAC members and divided them into 13 subfamilies according to phylogenetic analysis. Subsequently, we conducted a comprehensive and systematic analysis based on the conserved motifs, key amino acid residues in the NAC domain, expression patterns, and protein interaction network predictions and screened the candidate gene AvNAC030. In order to study its function, we adopted the method of heterologous expression in Arabidopsis. Compared with the control, the overexpression plants had higher osmotic adjustment ability and improved antioxidant defense mechanism. These results suggest that AvNAC030 plays a positive role in the salt tolerance regulation mechanism in kiwifruit.

Soil salinization can destroy the ionic and osmotic balance of plant cells, inhibit their growth and development, and reduce the yield and quality of crops, making soil salinization a worldwide problem that restricts the healthy and sustainable development of modern agriculture [1] . In arid agricultural areas, soil salinization is becoming more and more serious due to the lack of rainfall, strong light, and other factors that will lead to the accumulation of soluble salt in the soil on the surface, coupled with improper irrigation and excessive fertilization [2] . For these reasons, over 800 million hectares of land around the world are affected by salt, more than 6% of the world's total land area [3] . At present, 45 million hectares (19.5%) of 230 million hectares of arable land in the world are affected by soil salinization, and, due to climatic factors and unreasonable irrigation, this number is increasing year by year [4] [5] [6] . Therefore, soil salinization has become one of the main limiting factors restricting the development of agriculture worldwide [7] . The soil replacement method, trenching and salt drainage, chemical reagent improvement, water and fertilizer regulation, and other measures are common soil improvement methods, but these methods are time-consuming, laborious, and easily lead to soil hardening. Cultivating salt-tolerant crops, as well as the selection of salt-tolerant rootstocks of fruit trees, without excluding the chance to enhance the suitable native wild species, are the most economical, effective, safe, and environmentally friendly methods [8, 9] . As one of the four most successful artificially domesticated and cultivated trees in the 20th century, kiwifruit (Actinidia chinensis Planch) has a unique flavor and is rich in vitamin C, which is the antiviral vitamin par tors, stabilizing protein and membrane structures, and eliminating ROS through oxidative defense mechanisms to reduce the damage caused by oxidative stress [29] . Wang et al. found that rice plants overexpressing ThNAC13 improved salt tolerance by accumulating osmotic regulatory substances and scavenging ROS [30] . After overexpression of OoNAC72 in Arabidopsis thaliana, Guan et al. found that transgenic plants carry out osmotic regulation and remove ROS after salt stress so as to reduce peroxidation damage [31] . Li et al. used gene editing combined with genetic transformation and other molecular biology techniques and found that GmNAC06 could reduce the content of ROS in plants through the accumulation of osmotic mediating substances, thereby increasing the salt tolerance of plants [32] .

We screened Actinidia valvata germplasm material ZMH (Zhenmu, Hunan) with strong salt tolerance and rootstock application prospects in the early stage [33] . We used this as a material to screen 120 AvNAC genes based on conserved domains. Then, we conducted a systematic and comprehensive analysis of the NAC family, including systematic evolutionary relationships, conservative motifs, protein network interaction prediction, and key amino acid residue distribution, and combined this data with sequencing results to screen candidate genes [34] [35] [36] [37] [38] [39] . Subsequently, we verified the function of the AvNAC030 gene by heterologous expression in Arabidopsis. The phenotypic analysis, molecular experiments, and physiological parameters showed that AvNAC030 increased plant salt tolerance. The above results have important theoretical and practical significance for further understanding the molecular mechanism of salt tolerance in kiwifruit and accelerating the cultivation of salt-tolerant rootstocks and varieties.

NAC (NAM, ATAF1,2, and CUC2) protein, as a plant-specific transcription factor, is widely distributed in terrestrial plants [40] . The diversity of NAC family members indicates the diversity of their functions, which are related to plant growth and development and stress responses [41] . Family members with close relatives may have similar functions, so phylogenetic analysis is of guiding significance for gene function prediction [42] . Taking the Arabidopsis NAC family as a reference, we used the nomenclature protocol to construct an unrooted phylogenetic tree of 120 NAC members of kiwifruit according to the multiple sequence alignments of conserved domains ( Figure 1 ) [43, 44] . On the basis of Heim's method, we made a few appropriate adjustments (Table 1) . For example, the NAC2 subfamily was divided into the VII a and VII b subfamilies. The TERN subfamily and ONAC022 subfamily were merged into the IX subfamily and formed a sister subfamily. Subfamily NAP and subfamily AtNAC3 in subfamily X are also sister subfamilies, implying their co-evolution [45, 46] . Finally, according to 105 NAC members of Arabidopsis, the kiwifruit NAC family was divided into 13 subfamilies. Subfamily II has no AvNAC members, which may be the result of long-term evolution. AtNAC097 could not be classified in any of these 14 subfamilies and was therefore classified as an orphan [47] . The number of members in different subfamilies varies greatly. Subfamily VII b and IX, with the largest number of family members, both contain 22 AvNACs, while the subfamilies V and XII, with the smallest number, contain 2 AvNACs. These results provide evidence for the evolutionary relationship of the kiwifruit NAC family. 

Motifs play an important role in the interaction of different modules in the signal transduction and transcription complex [48, 49] . We analyzed the sequence, length, distribution, and frequency of 20 conserved motifs of 120 VvNAC genes ( Figure 2 and Table 2 ). Motif1, motif2, motif3, motif4, and motif5, which occur frequently, are mainly distributed at the N-terminal region of the NAC domain, indicating that these conservative motifs play an important role in the function of VvNAC [50] . Some less frequent motifs only appear in a specific subfamily. Motif6 appears only in subfamily III. Motif9, motif11, motif12, motif16, motif19, and motif20 also only appear in specific subfamilies, which may be related to the specific functions of these subfamilies. Therefore, both the number and type of motifs in different subfamilies are quite different. The average number of motifs in each subfamily is 3 to 7, and the types are 5 to 11. Each type of motif appears only once in each gene. However, the occurrence times of each motif are different. Motif3 appears 98 times, and motif13 and motif20 appear only 6 times. There are also great differences in the motif types of each gene. Some genes have 10 types, and some have only one type.

A typical NAC protein consists of a conserved N-terminal NAC region (about 150 amino acids) and a diverse C-terminal transcriptional regulatory region [51, 52] . The NAC domain with DNA binding ability in NAC transcription factors can be divided into five subdomains. The highly conserved positively charged C and D subdomains are responsible for binding to DNA. Nuclear localization signals (NLSs) present in C and D subdomains may be related to nuclear localization in transcription factors and the recognition of specific cis-acting elements on promoters. A subdomain is involved in the formation of functional dimers. B and E subdomains are not conservative and are responsible for the functional diversity of NAC genes [53] . In order to better understand the functions of the kiwifruit NAC family, we conducted multiple sequence array analysis of its 120 members ( Figure 3A ). Subsequently, we compiled statistics on the percentage of conserved amino acids in the five subdomains based on the previous report, and the results showed that there were 14 sites in which the consistency rate exceeded 75%. Among them, the D subdomain with DNA binding ability and containing NLSs contained the most sites, with eight sites. The A subdomain contained three sites, and the C subdomain contained two sites. The non-conserved B domain contained only one site, and the E domain had no sites.

It was previously reported that members of the NAC family could improve the salt tolerance of plants [54] . The expression pattern of genes is related to their function [55] . In order to study the function of the NAC family in kiwifruit under salt stress, we used the salt-tolerant resource ZMH as a material to analyze the expression patterns of NAC family members after 0 (I), 6 (II), 24 (III), and 72 (IV) hours of salt stress ( Figure 4 ). The fragments per kilobase per million (FPKM) values were used to estimate the expression characterization of the NAC family for screening the candidate genes associated with salt tolerance. The results showed that the expression of AvNAC030 and AvNAC031 of subfamily IV, AvNAC037 of subfamily VII a, AvNAC060 of subfamily IX, and AvNAC098 of subfamily XII increased significantly after salt stress. 

The prediction of gene interaction networks can help researchers understand gene functions quickly and effectively [56] . Therefore, we used STRING to predict the candidate gene interaction network based on the AvNAC orthologs in Arabidopsis ( Figure 5 ). The expression of AvNAC030 (NAC019 in Arabidopsis) was induced by salt stress, and its interaction gene RHA2A was able to respond positively to salt stress and osmotic stress, while ZFHD1 was regulated by salt stress. AvNAC031 (NAC041 in Arabidopsis) is the transcription activator of the mannan synthase CSLA9. It can recognize and bind to the DNA-specific sequence of the CSLA9 promoter. AvNAC037 (NAC100 in Arabidopsis) can bind to the promoter regions of genes involved in chlorophyll catabolic processes. AvNAC060 (NAC070 in Arabidopsis) can control the cell wall maturation processes that are required to detach root cap layers from the root. AvNAC098 (NST1 in Arabidopsis) is a transcription activator of genes involved in the biosynthesis of secondary walls. Together with NST2 and NST3, AvNAC098 is required for the secondary cell wall thickening of sclerenchymatous fibers, secondary xylem (tracheary elements), and of the anther endocethium, which is necessary for anther dehiscence. It may also regulate the secondary cell wall lignification of other tissues. Based on the above results, it is speculated that AvNAC030 may be involved in the regulation mechanism of salt tolerance in kiwifruit. 

We fused the green fluorescent protein (GFP) to the C-terminus of AvNAC030 with a mutation in the stop codon, and used the CaMV35S constitutive promoter to drive it to determine its subcellular location. Subsequently, 35S::AvNAC030:GFP fusion protein and control 35S::GFP were transferred into Arabidopsis protoplasts by a PEG-mediated method ( Figure 6 ). AtBZR2 was fused to mCherry as a nuclear marker. The Arabidopsis protoplasts with 35S::GFP plasmid displayed fluorescence throughout the cells. In contrast, the Arabidopsis protoplasts with 35S::AvNAC030:GFP plasmid was detected only in the nucleus. This result suggests that AvNAC030 may encode a nuclear localized protein. 

Four-week-old homozygous T 3 -generation Arabidopsis were used to study the function of AvNAC030 in response to salt stress in a substrate treated with 250 mM NaCl solution. The phenotype of overexpression (OE) plants was significantly superior to that of Vector control (VC) plants, although both OE and VC plants were damaged to varying degrees after salt treatment ( Figure 7A ). OE plants also had a higher survival rate after 4 weeks of salt treatment ( Figure 7B ). Subsequently, we determined the content of flavonoids with ROS scavenging abilities, and the results showed that the accumulation of total flavonoids in OE plants after salt treatment was significantly higher than that of VC plants ( Figure 7C ) [57] . At the same time, the leaves of OE plants suffered less damage than VC plants after salt stress, and the results of Fv/Fm images and Fv/Fm values were consistent with this phenotype ( Figure 7D ,E). Therefore, OE plants were considered to be more salt-tolerant than VC plants.

ROS can reflect the degree of salt damage to plants, usually in the form of H 2 O 2 and O 2− , which can be directly reflected by the color after 3,3 -diaminobenzidine (DAB) and nitro blue tetrazolium (NBT) staining [58] . Therefore, in order to understand the ability of AvNAC030 to scavenge ROS, the OE and VC Arabidopsis before and two days after treatment were histochemically stained with DAB and NBT. DAB and NBT staining revealed no significant difference between OE and VC Arabidopsis before treatment. After salt treatment, OE plants showed the lowest levels of brown precipitate and blue spots compared with VC plants ( Figure 8A,B) . Subsequently, the content of H 2 O 2 and O 2− was detected, and the results were consistent with the results of the dyeing tests ( Figure 8D ,E). We then observed the cell death of OE and VC plants through trypan blue staining, and the cell death was related to the degree of damage caused by ROS ( Figure 8C ). These results indicate that overexpression of AvNAC030 can effectively eliminate ROS and reduce the damage to plants caused by salt stress. 

In order to study the function of AvNAC030 after salt stress, we used OE and VC plants before and two days after salt treatment as materials to detect the indexes related to the ability to scavenge ROS and regulate osmoregulation substances. The results showed that the electrolyte leakage (EL) and malondialdehyde (MDA) values of OE plants were significantly lower than that those of VC plants after two days of salt stress, indicating that the cell membrane integrity was better preserved by OE plants following salt stress ( Figure 9A ,B). We then tested the multifunctional osmolytes and found that the proline content of OE plants was significantly higher than that of VC plants after salt treatment ( Figure 9D) . Similarly, the activity of SOD (superoxide dismutase), POD (peroxidase), and CAT (catalase) in OE plants was significantly higher than that in VC plants after salt stress ( Figure 9D -E). These results indicated that overexpression of AvNAC030 could effectively improve the salt tolerance of plants.

To further investigate the molecular mechanism of AvNAC030 after salt stress, we measured the relative expression levels of marker genes related to salt stress. The results showed that after salt treatment, the expression levels of AtMYB111, AtOZF1 (Oxidationrelated Zinc Finger 1), AtGSTU5 (Glutathione S-transferase class tau 5), and AtP5CS1 (delta1pyrroline-5-carboxylate synthase 1) in OE plants were significantly higher than those in VC and WT (Wild type) plants. These results suggest that AvNAC030 may increase the salt tolerance of plants by regulating these salt stress-related genes ( Figure 10 ). 

Kiwifruit has the effects of promoting digestion, lowering cholesterol, lowering blood lipids, enhancing immunity, preventing cancer, and being anticancer. It is known as the king of fruits and the king of vitamin C [59] . Although it is an emerging fruit tree, it has been developed rapidly in recent years. However, there are some restrictions in the process of industrial development. Kiwifruit is suitable for neutral acid soil, but soil salinization is increasing in kiwifruit production areas. It has adverse effects on the growth and development of plants, leading to the decline in yield and quality. Therefore, it is urgent to study its salt tolerance response mechanism and adaptation strategy, so as to provide a theoretical basis for the breeding of new kiwifruit varieties and the cultivation of resistant materials. In the preliminary study, the A. valvata germplasm material ZMH with strong salt tolerance was selected [34] . The root system of the material is well developed and has good compatibility as a rootstock for grafting the valvata Dunn, A. chinensis Planchon, A. deliciosa (Chev.) C. F. Liang & A. R. Ferguson, A. arguta (Siebold & Zucc.) Planch. ex Miq. Therefore, ZMH is a promising resource of resistant rootstocks, as well as a high-quality material for mining salt tolerance genes and studying the mechanism of salt tolerance regulation.

Taking ZMH as the research material, after removing the pseudogenes, we finally obtained 120 NAC family members. Then, we conducted a phylogenetic analysis and divided them into 13 subfamilies. The results were similar to those of Arabidopsis [44] . It has been reported that NAC genes in the same subgroup may have similar functions, such as specific resistance to stresses or plant specificity [60] . Liu et al. found that ATAF1 in the Arabidopsis ATAF subfamily significantly improved the salt tolerance of transgenic rice [61] . Al-Abdallat et al. improved the salt tolerance of tomato by overexpressing two ATNAC3related genes [62] . In addition to ATAF, the ATNAC3 subfamily and SENU5 subfamily have also been reported to respond to salt stress or improve plant salt tolerance [63] . HaNAC-1 in the SENU5 subfamily from sunflower was observed to be upregulated in seedling roots and shoots in response to salinity stress [64] . CarNAC1 from the SENU5 subfamily was strongly induced by salt stress [65] . BnNAC5 from the SENU5 subfamily of Brassica napus is involved in response to high-salinity stress [66] . Dong et al. found that overexpression of ClNAC9 in the SENU5 subfamily increased the saline resistance of transgenic Arabidopsis [67, 68] . Liu et al. found that the Chrysanthemum lavandulifolium (Fisch. Ex Trautv.) Makino gene ClNAC9 in the SENU5 subfamily positively regulated saline stress in transgenic chrysanthemum grandiflora Hook [69] . Wang et al. found that overexpressing the NAC transcription factor LpNAC13 of the SENU5 subfamily from Lilium pumilum Redouté in tobacco positively regulated the salt response [70] . According to the phylogenetic relationship, AvNAC030 belongs to the SENU5 subfamily ( Figure 1 ). The results of motif analysis provide further evidence for this phylogenetic relationship ( Figure 2 ). Interestingly, most of the conserved motifs are at the N-terminus of the NAC domain, which is consistent with the previous description, indicating that these motifs are necessary for the function of NAC [71] . The results of conserved amino acid residues show that the C and D subdomains are relatively conserved, indicating that the NAC family has retained its basic functions during long-term evolution. The variability of the B and E subdomains illustrates their importance in functional diversity ( Figure 3 ). The analyses of the expression pattern and interaction network show that AvNAC030 responds to salt stress (Figures 4 and 5) . These results suggest that AvNAC030 plays a key role in the regulation mechanism of salt tolerance.

The result of subcellular localization show that AvNAC030 may function as a transcription factor ( Figure 6 ). To understand the regulatory mechanism of AvNAC030, we also used transgenic Arabidopsis to study its function after salt stress. We found that after salt treatment, OE significantly reduced the damage caused by salt stress compared with VC plants (Figure 7D ,E). Therefore, the survival rate of OE plants was higher than that of VC plants ( Figure 7A ,B). ROS usually exists in the form of H 2 O 2 and O 2− , and can be rapidly produced in plants when exposed to adverse environmental conditions such as high salinity, drought, or extreme temperatures [72] . Excessive ROS leads to oxidative damage of cell components such as proteins, lipids, and DNA. Plants maintain the balance between ROS production and removal to ensure ROS homeostasis, thereby reducing the effects of oxidative stress [73] . Flavonoids, as non-enzymatic antioxidants, have been widely reported to reduce ROS damage in plant cells under biotic and abiotic stress [74] . After being exposed to salt stress, OE plants accumulated more flavonoids than VC plants. We then tested their ability to eliminate H 2 O 2 and O 2− . The ROS scavenging ability of OE plants was superior to that of VC plants, and more living cells were retained ( Figure 8 ). The results were consistent with the phenotype. MDA, as a decomposition product of polyunsaturated fatty acids, has a positive correlation with the accumulation of ROS [75] . The results showed that after being exposed to salt stress, the cell membrane of VC plants was damaged by salt to a higher degree, resulting in more soluble leakage, and therefore had a higher EL value and MDA content ( Figure 9A ,B). Proline plays an important role in scavenging hydroxyl radicals. In addition, it stabilizes the subcellular structure and protects cellular macromolecules against damage by adjusting the intracellular osmotic potential [76] . SOD can catalyze the conversion of superoxide anions into H 2 O 2 and O 2 , and is an important material for scavenging free radicals in plants, while POD and CAT are enzymes for scavenging H 2 O 2 . SOD, POD, and CAT maintain the steady level of free radical content in plants through synergistic action, and prevent the changes in plant physiology and biochemistry caused by free radicals [77] . The results of determining proline content and SOD, POD, and CAT activities showed that OE plants had a stronger ability to scavenge ROS than VC plants under salt stress ( Figure 9C -F). AtMYB111 improves ROS scavenging efficiency by regulating the synthesis of flavonoids [25] . AtOZF1 plays a role in regulating oxidative stress response in Arabidopsis [78] . AtGSTU5 is used as a marker of oxidative stress [79] . AtP5CS1 is a proline synthesis marker gene [80] . The results show that AvNAC030 might enhance the salt tolerance of plants by regulating these stress-related genes after salt stress ( Figure 10 ). These results suggest that AvNAC030 can increase the salt tolerance of plants by improving the efficiency of ROS removal and maintaining the intracellular and extracellular osmotic balance to protect the integrity of the membrane ( Figure 11 ). 

The NAC sequences of Arabidopsis were obtained from TAIR (https://www.arabid opsis.org/, accessed on 6 May 2020). The NAC sequences of kiwifruit were retrieved from the full-length transcriptomic data of ZMH (unpublished). We removed repetitive sequences and incomplete sequences. The retrieved NACs were screened by analyzing the conserved domain using the conserved domains database (https://www.ncbi.nlm .nih.gov/Structure/cdd/wrpsb.cgi, accessed on 8 June 2020). The obtained sequences containing the conserved NAC domain (PF02365) were detected again by the Pfam database (http://pfam.xfam.org/, accessed on 8 June 2020). The details of the NAC family were obtained by the ExPASy Proteomics server (http://web.expasy.org/compute_pi/, accessed on 12 June 2020) ( Table 3 ). Nucleotide and amino acid sequences based on the full-length transcriptome data are presented in Table A1 (Appendix A).

We used Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/, accessed on 10 July 2020) for phylogenetic analysis, which was then presented with the Interactive Tree of Life (iTOL) (https://itol.embl.de/itol.cgi, accessed on 12 July 2020). The numbers were bootstrap values based on 1000 iterations. Only bootstrap values larger than 50% support were displayed. We identified the conserved motifs with MEME (http://meme -suite.org/index.html, accessed on 16 July 2020) and retained e-values < 1 × 10 −20 for analysis. We performed multiple sequence alignments of AvNACs using CLUSTALW (http s://myhits.sib.swiss/cgi-bin/clustalw, accessed on 18 July 2020) with default parameters. The heatmap of the NAC family was generated with TBtools (https://github.com/C J-Chen/TBtools/releases, accessed on 21 July 2020) based on the ZMH RNA-seq data (unpublished). The prediction of the gene interaction network was completed by STRING (https://string-db.org/cgi/input.pl, accessed on 26 July 2020) with option value>0.700.

The ZMH from A. valvata was grown in a greenhouse at the Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences, Zhengzhou, Henan Province, China (34 • 43 N, 113 • 39 E, altitude 111 m). When the height of the tissue culture seedlings reached 40 cm, they were treated with 0.4% NaCl solution. Samples were taken for sequencing after treatment at 0 (I), 12 (II), 24 (III), and 72 (IV) h. Each sample had three biological replicates and each replicate included roots from three plants.

The open reading frame (ORF) of AvNAC030 with a mutational stop codon was cloned between the Xba I and Sal I sites of the pB221-GFP vector with the T4 DNA ligase (Thermo Scientific, Waltham, MA, USA) and a pair of primers (Table 4 ). Protoplasts were prepared from rosette leaves of 4-week-old A. Arabidopsis seedlings, and the recombinant and control plasmids were transformed into Arabidopsis protoplasts by using PEG (polyethylene glycol) 4000 mediated transformation [81] . The N-terminal of AtBZR2 (AT1G19350.3) contained an NLS, so we fused it with mCherry to label the nuclear of protoplast. [82] . After 18 h, the GFP fluorescence was observed under a laser scanning confocal microscope (Olympus FV1000 viewer, Tokyo, Japan). (Table 4 ) and Pfu DNA polymerase (TransGen Biotech, Beijing, China). The products were purified and integrated into the blunt vector (pEASY-Blunt Simple Cloning Kit, Beijing, China) for sequencing, and then was cloned between the Nco I and Bgl II sites of the pCAMBIA3301 vector with the T4 DNA ligase and a pair of primers (Table 4 ). The floral dip method was used for genetic transformation, and phosphinothricin resistance was used to detect positive plants. The homozygous T 3 generation was germinated in soil chambers in a greenhouse at 22 • C with 16 h light/8 h dark cycle and 70% relative humidity, and the four-week-old potted Arabidopsis plants were subjected to 250 mM NaCl treatment for functional verification.

Total flavonoid content was measured as described previously by Jia [83] . For chlorophyll fluorescence measurements, the images were obtained by IMAGING-PAM chlorophyll fluorometer (Walz, Effeltrich, Germany), and the maximum quantum efficiency of photosystem II (Fv/Fm) was measured with Imaging WinGegE software [84] . H 2 O 2 and O 2 − were stained with DAB (Solarbio, Beijing, China) and NBT (Beijing Biodee Biotechnology, Beijing, China). The programmed cell death was detected by 0.4% trypan blue solution (MYM Biological Technology Company Limited, Chicago, IL, USA). The H 2 O 2 and O 2 − content was measured as described previously by Liu and Elstner [85, 86] . EL was measured as described previously by Ben-Amor [87] . MDA, proline, SOD, POD, and CAT activity were detected using corresponding test kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) [88] .

qRT-PCR was performed in the presence of SYBR green qPCR Master Mix (Fermentas, Ontario, Lithuania) and the amplification was performed in the Eco Real-Time PCR system (Illumina, San Diego, CA, USA). All reactions were performed in triplicate. The primers were designed using Oligo 7.0 and are listed in Table 4 .

All experiments were replicated independently at least three times, and data are shown as the mean ± SD of three independent experiments. Data were subjected to analysis of variance (ANOVA) using the Statistical Analysis System (SPSS version 22.0) software. The differences between the means were compared using the Tukey's test (p < 0.05).

Using ZMH as the material, we performed high-throughput sequencing at the four time points after its salt treatment. We then analyzed the members of the NAC family based on the sequencing results and bioinformatics analysis. According to the results, we speculate that AvNAC030 may play a positive role in the mechanism of salt tolerance. Finally, we used Arabidopsis genetic transformation technology and combined it with phenotype, physiology and molecular biology to analyze the function of AvNAC030 under salt stress. In this way, we can fully explore the original data and combine bioinformatics analysis with molecular biology experiments more efficiently to study the function of the NAC family. Data Availability Statement: Sequence data from this work can be found in the NCBI database (SRA data).

The authors declare no conflict of interest. ATGAAGGTTACCGATGATGCTTCGTGTTTTGGAGGTGGAGGCTGTTGGCCGCCTGGGTTTCGGTTCCACCCGACGGA  CGAGGAGCTCGTGCTGTACTATCTGAAGAGGAAGATCTGTGGCCGGCGCCTGAAGCTCGACATCGTCGGCGAGACT  GATGTCTACAAGTGGGACCCGGAGGAGTTGCCTGGGCTCTCCAAATTGAAAACTGGGGACAGGCTATGGTTCTTTTT  TAGCCCAAGGGACAGGAAGTACCCGAATGGAGCAAGGTCAAATAGGGCAACAAGGCAGGGGTATTGGAAAGTAAC  TGGGAAGGACCGCACTATAACATGTAGTTCTCGTGCTGTTGGGGTGAAGAAAACTCTGGTTTTCTACAAAGGCCGTG  CGCCTGCTGGTCAACGCACGGATTGGGTGATGCACGAGTATACTTTGGACGAGGAGGAGCTCAAGAGATGCCAGAC  CGCCAAGGATTATTATGCTCTCTATAAGGTCTACAAAAAGAGTGGACTTGGTCCCAAGAATGGTGAGCAGTATGGAGC  TCAATTCAGAGAAGAAGACTGGGCTGATGATGATAACACAATTGTTAATGATCATGCTAACCTTGAAACTCCAGTGAAG  CAAGTTAACGACATTGCTTCTGTTGACAATACCAGAACTAATGGTCAAGTGCAGTCCGGACTTAATGTCCTTGATGAGT  TTATGAGCCAAAATGCAGTGGAGTCTCTACTTGTCCAACCTCTTGGTGTACATTTTGGTTATGCACTGCATGAGTTTGTT  GATGAGGAAGAAAACCAAAGTAGCTTGGTGGATCAATCCTTTAGGGAAACCGATTTGCAAGAAAGGAGCATGGTACT  CCAACAAAGCTGGCAGCAAAATGATGTGCAGCCTAGCTTTGACCTGACTCAGTCAGCCACCTCTCAGTTGCAACTTTA  TGAGAAACCTGAAGTTACATCTGCCCCAATCATTTCGAGACAGGAATCTCATGACAGCGAGCTGGAAGATTATATTGAA  ATGGATGATCTCATTGGCCCAGGACCTACCGTTCAAAACATGGACAATGATCTCATTGGCCCAACACCTACCGTTGACA  AACCTGTGGAGAATCTTCACTTTGATGGGTTCAGTGAGCTAGATTTATTCCATGATGCAGCCATGTTTATTCGAGATATGG  GTCCGATTAATCCAGAAATACTTGCTCACTCATATAGTAACAATTTTCAAAACAAAATGGTTAACCAATTGGATTGTCAAC  TTCAACCGTATTCCAGTTATTCAAGTGAGAGCAACGGTCAGCTGTGGATGCATGGTCAAAACAACATTGATACACCACC  AGAATACAATCAGGGGGTTGTTCATCCGCCAACTTCAGGTGTGGTATGTGACTGTAGTTCTGCAAGTCTTCCTTCTGGA  GTATATGAAAATGAAAACCAAAGCCAAAGCCAAAACCAAAACCAAAACCAAAACCAAAGTGGCAATGTAGACGATGG  TGGAGACTCATGGTTAACTTCTGCATTGTGGTCCTTTGTGGAATCTGTACCAACCACTCCGGCATCCGCTTCAGAGGGT  GCTGCTTTGGTGAATAGGGCTTTTGAACGAATGTCCAGCTTCGGTAGAGTGAGAGCAAGTGCCGGAGACACAAGTGT AGCTGCAGGTAACCCTGTTGCAACTCTGCGCAGGTCCGGCAGTCGTCATAGTAGGGGATTTTTCTTTTATGCATTTCTT GGAGTGTTGTGTGCCATATTGTGGGTATTGATCAGAACATCTGTAAGAGTATTGACTCGATACATATCTTCATGA 

Mechanisms of plant responses and adaptation to soil salinity

World salinization with emphasis on Australia

New insights on plant salt tolerance mechanisms and their potential use for breeding. Front

Mechanisms of salinity tolerance

Diversity, distribution and roles of osmoprotective compounds accumulated in halophytes under abiotic stress

Plant salt stress: Adaptive responses, tolerance mechanism and bioengineering for salt tolerance

Role of rootstocks in fruit production-A review

Ecological and Biological Properties of Satureja cuneifolia Ten. and Thymus spinulosus Ten.: Two Wild Officinal Species of Conservation Concern in Apulia (Italy). A Preliminary Survey

A key structural gene, AaLDOX, is involved in anthocyanin biosynthesis in all red-fleshed kiwifruit (Actinidia arguta) based on transcriptome analysis

Actinidia in China: Natural diversity, phylogeographical evolution, interspecific gene flow and kiwifruit cultivar improvement

Genetic diversity in kiwifruit polyploid complexes: Insights into cultivar evaluation, conservation, and utilization

Genetic resources of kiwifruit: Domestication and breeding

Analyses of microbial biomass and community diversity in kiwifruit orchard soils of different planting ages

Study on the allocation patterns of above-and below-ground biomass of Actinidia chinensis in northern area of Qinling

Research progress on rootstock of kiwifruit

Plant salt-tolerance mechanisms

Salt tolerance mechanisms of plants

AtSIZ1 improves salt tolerance by maintaining ionic homeostasis and osmotic balance in Arabidopsis

SlMYB102, an R2R3-type MYB gene, confers salt tolerance in transgenic tomato

PvNAC1 increases biomass and enhances salt tolerance by decreasing Na + accumulation and promoting ROS scavenging in switchgrass (Panicum virgatum L.)

Overexpression of Na + /H + antiporter gene AtNHX1 from Arabidopsis thaliana improves the salt tolerance of kiwifruit (Actinidia deliciosa)

Elucidating the molecular mechanisms mediating plant salt-stress responses

Unraveling salt stress signaling in plants

An overview of the genetics of plant response to salt stress: Present status and the way forward

A new insight of salt stress signaling in plant

Salt tolerance in rice: Focus on mechanisms and approaches

NAC proteins: Regulation and role in stress tolerance

The Arabidopsis MYB transcription factor, MYB111 modulates salt responses by regulating flavonoid biosynthesis

ThNAC13, a NAC transcription factor from Tamarix hispida, confers salt and osmotic stress tolerance to transgenic Tamarix and Arabidopsis. Front

OoNAC72, a NAC-type Oxytropis ochrocephala transcription factor, conferring enhanced drought and salt stress tolerance in Arabidopsis

GmNAC06, a NAC domain transcription factor enhances salt stress tolerance in soybean

Effect of salt stress on growth, physiological and biochemical characters of four kiwifruit genotypes

Genome wide identification and characterization of abiotic stress responsive lncRNAs in Capsicum annuum

Genome-wide identification and functional characterization of natural antisense transcripts in Salvia miltiorrhiza

Genome-wide identification and characterization of the brassinazole-resistant (BZR) gene family and its expression in the various developmental stage and stress conditions in wheat (Triticum aestivum L.)

Genome-Wide Identification and Characterization of PIN-FORMED (PIN) Gene Family Reveals Role in Developmental and Various Stress Conditions in Triticum aestivum L

Genome-wide identification and expression pattern analysis of the KCS gene family in barley

Genome-wide identification and expression analysis of the AT-hook Motif Nuclear Localized gene family in soybean

NAC transcription factors: Structurally distinct, functionally diverse

Genome-wide investigation of the NAC transcript factor family in perennial ryegrass (Lolium perenne L.) and expression analysis under various abiotic stressor

Systematic sequence analysis and identification of tissue-specific or stress-responsive genes of NAC transcription factor family in rice

Genome-wide identification and expression analysis of the NAC transcription factor family in cassava

Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana

Genome-wide analysis, expression dynamics and varietal comparison of NAC gene family at various developmental stages in Morus notabilis

Genome-wide analysis of NAC transcription factors and their response to abiotic stress in celery (Apium graveolens L.)

Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum)

The Arabidopsis basic/helix-loop-helix transcription factor family

The basic helix-loop-helix transcription factor family in plants: A genome-wide study of protein structure and functional diversity

Genome-wide investigation of the NAC gene family and its potential association with the secondary cell wall in moso bamboo

Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors

DNA-binding specificity and molecular functions of NAC transcription factors

A structural view of the conserved domain of rice stress-responsive NAC1

Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice

Genome-wide characterization and expression profiling of the NAC genes under abiotic stresses in Cucumis sativus

Identification of basic/helix-loop-helix transcription factors reveals candidate genes involved in anthocyanin biosynthesis from the strawberry white-flesh mutant

Enhancement of oxidative and drought tolerance in Arabidopsis by overaccumulation of antioxidant flavonoids

Screening and functional identification of salt tolerance HMG genes in Betula platyphylla

Fruit scientific research in New China in the past 70 years: Kiwifruit

Genome-wide identification and expression analysis of the NAC transcription factor family in pineapple

Arabidopsis ATAF1 enhances the tolerance to salt stress and ABA in transgenic rice

Overexpression of two ATNAC3-related genes improves drought and salt tolerance in tomato (Solanum lycopersicum L.). Plant Cell Tissue Organ Cult

Identification and analysis of Chrysanthemum nankingense NAC transcription factors and an expression analysis of OsNAC7 subfamily members

Differential expression of genes regulated in response to drought or salinity stress in sunflower

Cloning and characterization of a novel NAC family gene CarNAC1 from chickpea (Cicer arietinum L.)

Two Brassica napus genes encoding NAC transcription factors are involved in response to high-salinity stress

Transcriptome-wide survey and expression analysis of stress-responsive NAC genes in Chrysanthemum lavandulifolium

Cloning and function analysis of ClNAC9 from Chrysanthemum lavandulifolium

The Chrysanthemum lavandulifolium ClNAC9 Gene Positively Regulates Saline, Alkaline, and Drought Stress in Transgenic Chrysanthemum grandiflora

Overexpressing the NAC transcription factor LpNAC13 from Lilium pumilum in tobacco negatively regulates the drought response and positively regulates the salt response

Genome-wide organization and expression profiling of the NAC transcription factor family in potato (Solanum tuberosum L.)

Oxidative stress in the pathogenesis of keratoconus and Fuchs endothelial corneal dystrophy

A novel NAC transcription factor, PbeNAC1, of Pyrus betulifolia confers cold and drought tolerance via interacting with PbeDREBs and activating the expression of stress-responsive genes

Characterization of Arabidopsis thaliana FLAVONOL SYNTHASE 1 (FLS1)-overexpression plants in response to abiotic stress

Over-expression of poplar transcription factor ERF76 gene confers salt tolerance in transgenic tobacco

Stress-inducible expression of GmDREB1 conferred salt tolerance in transgenic alfalfa

Salt-induced stabilization of EIN3/EIL1 confers salinity tolerance by deterring ROS accumulation in Arabidopsis

Physiological characterization of the Arabidopsis thaliana oxidation-related zinc finger 1, a plasma membrane protein involved in oxidative stress

Probing the diversity of the Arabidopsis glutathione S-transferase gene family

A novel ∆ 1 -pyrroline-5-carboxylate synthetase gene of Medicago truncatula plays a predominant role in stress-induced proline accumulation during symbiotic nitrogen fixation

Drought tolerance conferred in soybean (Glycine max. L.) by GmMYB84, a novel R2R3-MYB transcription factor

Functional characterization of GmBZL2 (AtBZR1 like gene) reveals the conserved BR signaling regulation in Glycine max

The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals

A novel system for evaluating drought-cold tolerance of grapevines using chlorophyll fluorescence

Exogenous hydrogen peroxide changes antioxidant enzyme activity and protects ultrastructure in leaves of two cucumber ecotypes under osmotic stress

Inhibition of nitrite formation from hydroxylammoniumchloride: A simple assay for superoxide dismutase

Inhibition of ethylene biosynthesis by antisense ACC oxidase RNA prevents chilling injury in Charentais cantaloupe melons

Comparative transcriptome and proteome analysis of salt-tolerant and salt-sensitive sweet potato and overexpression of IbNAC7 confers salt tolerance in Arabidopsis. Front