key: cord-0981978-fwrmfdve
authors: Zannella, Carla; Giugliano, Rosa; Chianese, Annalisa; Buonocore, Carmine; Vitale, Giovanni Andrea; Sanna, Giuseppina; Sarno, Federica; Manzin, Aldo; Nebbioso, Angela; Termolino, Pasquale; Altucci, Lucia; Galdiero, Massimiliano; de Pascale, Donatella; Franci, Gianluigi
title: Antiviral Activity of Vitis vinifera Leaf Extract against SARS-CoV-2 and HSV-1
date: 2021-06-29
journal: Viruses
DOI: 10.3390/v13071263
sha: c0f28abdcf215d7fd8d6ce94d303160bdcb31281
doc_id: 981978
cord_uid: fwrmfdve

Vitis vinifera represents an important and renowned source of compounds with significant biological activity. Wines and winery bioproducts, such as grape pomace, skins, and seeds, are rich in bioactive compounds against a wide range of human pathogens, including bacteria, fungi, and viruses. However, little is known about the biological properties of vine leaves. The aim of this study was the evaluation of phenolic composition and antiviral activity of Vitis vinifera leaf extract against two human viruses: the Herpes simplex virus type 1 (HSV-1) and the pandemic and currently widespread severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). About 40 phenolic compounds were identified in the extract by HPLC-MS/MS analysis: most of them were quercetin derivatives, others included derivatives of luteolin, kaempferol, apigenin, isorhamnetin, myricetin, chrysoeriol, biochanin, isookanin, and scutellarein. Leaf extract was able to inhibit both HSV-1 and SARS-CoV-2 replication in the early stages of infection by directly blocking the proteins enriched on the viral surface, at a very low concentration of 10 μg/mL. These results are very promising and highlight how natural extracts could be used in the design of antiviral drugs and the development of future vaccines.

Grapevine is one of the major fruit crops worldwide, in terms of economic value and cultivated area. A large amount is subjected to wine production; however, grape has become a model for molecular biology, genetics, and breeding, garnering significant research interest in different areas from the study of polyphenols [1] [2] [3] to the investigation of specific gene families, such as resistant genes [4] .

suggesting that grapevine extracts could be used as cheap and eco-friendly innovative antiviral agents to reduce viral contamination in food and other material intended for human use. In this scenario, we demonstrated that another important source of bioactive compounds, V. vinifera leaf extract, had a strong antiviral potential against two important human pathogens, i.e., HSV-1 and the pandemic and currently widespread severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The herpetic infection represents one of the most common infectious diseases in humans. The virus can be classified into two types: HSV-1 and type 2 (HSV-2). It has been estimated that 3.7 billion people under the age of 50 (66.6% of the world's population) are infected by HSV-1 [40] ; moreover, the World Health Organization (WHO) has observed that 491.5 million people aged 15-49 years (13.2%) have HSV-2 infection. HSV-1 is a common virus infecting humans that is generally transmitted by oral-to-oral contact, but also via the genital route [41, 42] . It rarely can also be the causative agent of most severe and fatal diseases, such as keratitis, neonatal infections, and encephalitis. SARS-CoV-2 nowadays represents a serious problem for human health worldwide, both in economic terms and in terms of deaths caused, which to date amount to 3.5 million people [43] . It belongs to the Coronaviridae family, a well-known viral family containing other zoonotic viruses responsible for other pandemic outbreaks caused by SARS-associated coronavirus (SARS-CoV) and Middle East Respiratory Syndrome Coronavirus (MERS). The diseases are very similar and consist of severe acute respiratory infections in humans, characterized by fever, cough, shortness of breath, myalgia, and diarrhea [44] . Despite the advent of vaccines, deaths continue to increase. For these reasons, the identification of new promising drug candidates, especially of natural origin, that are able to interfere with SARS-CoV-2 and HSV-1 is essential.

Green healthy leaves were harvested in April 2019 in Portici (Naples, Italy) from a clone of V. vinifera (var. Paulsen 1103, kindly provided by Dr. Clizia Villano, from University of Naples "Federico II"). The plant has the following descriptive traits: apex is expanded, sublusty, green-bronzed with purplish edges. Apical leaves are showered with light velvet along the ribs of the lower page and are reddish green. The 4th to 6th leaflets are unfolded, whole, orbicular, have a U-shaped petiolar sinus with the base following the main veins, are bristly on the veins of the lower page, and are green with light bronzed reflections; ribs are reddish; petiole has short velvet. The plant stem is curved, ribbed, arachnoid, and purplish-red on one side. Herbaceous shoot is polygonal, with short velvet on the knots and has vinous-red internodes on one side; its knots are brown-purple. Tendrils are violet intermittent, bifid, and triffid; masculine flowers are present. Leaves are medium-sized, kidney-shaped, and whole, they have very open petiolar sinus with the base following the main ribs for a short distance; wavy flap is present; upper page is green, smooth, glabrous, and glossy; underside is light green and has bristly ribs; veins at the base of the upper page are pink; teeth are medium-sized, mucronate, and with convex margins, making it quite regular. Petiole is short, bristly, and vinous red on one side. Woody branch is of medium length and sturdiness, very branched, has a rounded cross section, an almost smooth surface, and a glabrous, grayish color with brown spots; internodes are medium distanced at 12-14 cm; buds are small. The plant blooms and leaves fall in the mid-late period. The plant has bushy habit, excellent vigor, rapid development, and good maturation of the wood; the plant is resistant to phylloxera and some fungal diseases. It is highly compatible with most grafting techniques and adapts to clayey-calcareous, slightly fresh, moderately chlorinated soils, and finally, it tolerates slightly brackish soils. A voucher specimen of this clone is kept and propagated in Portici. Growth conditions are normal open field conditions of the Campania (Italy) region. Fresh leaves were kept on ice and immediately freeze dried and pulverized with pestle and mortar. 

Polyphenols were extracted following the procedure developed by Docimo et al., 2016 [45] with some changes. A solution of 1.5 mL of 75% (v/v) methanol/0.05% (v/v) trifluoroacetic acid (TFA) was used for the extraction of 25 mg of pulverized leaf samples, by an incubation at room temperature for 1 h in continuous orbital shaker at medium speed. After sample centrifugation at 19,000× g for 10 min, and filtration by 0.2 mm polytetrafluoroethylene filters, the extract was concentrated in a Vacufuge Concentrator (Eppendorf, Hamburg, Germany) and lyophilized. The powder was solubilized at 100 mg/mL in DMSO: H 2 O (9:1). The weight ratio of the final lyophilized powder to the dried raw plant material was used to calculate the extraction yield.

The extract was dissolved in MeOH at 5 mg/mL and an aliquot of 3 µL was analyzed through an Information Dependent acquisition (IDA) experiment conducted on a Q-TRAP™ 4500 (AB Sciex, Framingham, MA, USA) tandem mass spectrometer equipped with an ACQUITY UPLC BEH C18 column (130 Å, 1.7 µm, 2.1 mm × 50 mm) (Waters, Milford, MA, USA). Full MS spectra were acquired in Enhanced MS (EMS) mode in the m/z range 300-1000, then the 5 most intense ions were subjected to fragmentation in Enhanced Product Ion (EPI) mode. The EPI was conducted in the m/z range 50-1000 with a collision energy (CE) of −40 eV. Both EMS and EPI were conducted in negative mode, with a scan rate of 10,000 Da/s, with the source temperature at 200 • C, capillary voltage of 4.5 kV, and de-clustering potential at −150 V.

The gradient was run at a flow of 200 µL/min, using H 2 O and acetonitrile, as solvent A and solvent B, respectively, both were supplemented with 0.01% of formic acid. The adopted gradient was set as follows: from 5% to 30% B in 20 min, isocratic flow at 30% B for 1 min, from 30 to 100% B in 5 min, and isocratic flow at 100% B for 3 min.

A molecular network was created with the Feature-Based Molecular Networking (FBMN) workflow [46] on GNPS [47, 48] . Firstly, the raw MS data were converted from *.wiff to *.mzXML extension through the tool MSconvert tool by ProteoWizard, and secondly processed with MZmine in order to clean the signals, delete the noise, and calculate the peak's area of each compound [43] . The networking description and parameters were automatically generated from GNPS; here, we present a brief extract. The output files were exported to GNPS for FBMN analysis, and the parameters were settled in accordance with the data as follows: the tolerance of the precursor ion mass was set to 2 Da and the tolerance of the MS 2 fragment ion was set to 0.5 Da. The molecular network was created by setting the edges to have more than 3 matching peaks and a cosine score higher than 0.7. The maximum size of a molecular family was set to 100. Analogues were searched for against MS/MS spectra within a range difference of 300 in the precursor ion value. Finally, the molecular network was visualized using Cytoscape. The full description and the GNPS job can be publicly accessed through the link: https://gnps.ucsd.edu/ProteoSAFe/status. jsp?task=5b3274bd0bbd442794c9bbb1721b92f7 (accessed on 28 June 2021).

The relative abundance of the described compound was also calculated. Briefly, the abundance of each polyphenol in Table 1 was calculated as the percentage of its area divided by the sum of all the polyphenols areas. The relative abundance of DGMGs was calculated in the same way but referring to their areas.

Relative abundance = Polyphenol area Total polyphenols areas × 100 (1) , 100 mg/mL of streptomycin, 2 mM L-glutamine, and 100 IU/mL of penicillin-streptomycin solution in a humidified atmosphere with 5% CO 2 at 37 • C. HepG2 carcinoma cells were propagated in RPMI-1640 Medium containing 4.5 g/L glucose supplemented with 10% FBS, 100 IU/mL penicillin-streptomycin, and 2 mM L-glutamine. The other cell lines were propagated in Dulbecco's Modified Eagle's Medium (DMEM) with 10% FBS, 2 mM L-glutamine and 100 IU/mL antibiotics. All the materials used for cell culture practice were purchased from Euroclone, Milan, Italy. HSV-1 (strain SC16), carrying a lacZ gene driven by the CMV IE-1 promoter to express β-galactosidase, was propagated on Vero cells monolayers. SARS-CoV-2 (clinical isolate, kindly provided by Lazzaro Spallanzani Hospital, Rome, Italy) was propagated on Vero cells as already reported [49] . All experimental work involving SARS-CoV-2 virus was performed in a biosafety level 3 (BSL3) containment laboratory.

Next, 4 × 10 4 cells/well were plated in a 24-well plate and treated for 48 h, with V. vinifera extract at 65, 125, 250, and 500 µg/mL, and with Vorinostat (SAHA) for 24 h, used as a positive control. The activity of these molecules against the cell viability was determined by the Thiazolyl Blue Tetrazolium Bromide [3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide] (Sigma-Aldrich, St. Louis, MO, USA) MTT assay. After treatment with natural extract and SAHA, 0.5 mg/mL of MTT water solution was added to the cells for 3 h. The purple formazan crystals, after removal of the supernatant, were solubilized in iso-propanol (Carlo Erba Reagents, Cornaredo, Italy) and the absorbance was read at a wavelength of 570 nm with a TECAN M-200 reader (Tecan, Männedorf, Switzerland).

Vero were plated into 12-well cell culture plates (2 × 10 5 cells/mL for each well) in culture medium. The next day, leaf extract was dissolved in MEM without FBS at the following concentrations: 0.625, 1.25, 2.5, 5, 10, 50, 100, and 500 µg/mL. The antiviral effect was measured following different schemes of treatment, as previously described [50] . The percentage of infectivity inhibition was calculated by counting the number of plaques obtained in the presence of extract with respect to those in CTRL− (only virus without extract). All experiments were performed in triplicate. Greco extract was used as a positive control for HSV-1 and SARS-CoV-2 antiviral assays [11] .

Vero were plated into 12-well cell culture plates (2 × 10 5 cells/mL cells for each well) in culture medium. The next day, the monolayer was treated with leaf extract and HSV-1 and SARS-CoV-2, as described above. After 24 h, the total RNA was isolated using TRIzol reagent and quantified by measuring the absorbance at 260/280 nm (NanoDrop 2000, Thermo Fisher Scientific, Waltham, MA, USA). A total of 1 µg of total RNA was reverse transcribed to cDNA by 5× All-In-One RT MasterMix (Applied Biological Materials, Richmond, Canada). A quantitative polymerase chain reaction was run in triplicate using a CFX Thermal Cycler (Bio-Rad, Hercules, CA, USA). Then, 2 µL of cDNA were amplified in 20 µL reactions using BrightGreen 2× qPCR MasterMix-No Dye (Applied Biological Materials) and 0.1 µM of primer. Relative target Ct (the threshold cycle) values of UL54, UL52 and UL27 (for HSV-1), and S protein (for SARS-CoV-2) were normalized to GAPDH, as the housekeeping gene. The mRNA levels of cells treated with leaf extract were expressed using the 2 −∆∆Ct method [51] . Primers were purchased by Eurofins (Vimodrone, Milan, Italy) and their sequences are reported in Table 1 .

Negative ionization mode HPLC-MS/MS is one of the powerful methods to characterize flavonoids because it provides information on both aglycones and glycosidic conjugates that can differentiate isomers [47, 52] . HPLC-MS/MS IDA analysis was carried out to investigate V. vinifera leaves metabolic profile.

MZmine [53] and GNPS [54] software were used to convert and analyze the raw MS data, and finally Cytoscape built the complex network shown in Figure 1 . Each node indicates a precursor ion, the node size is strongly related to its abundance in the sample (sum precursor intensity), and the edges size between two nodes is directly dependent on their MS/MS spectra similarity (cosine score) [55] . Analysis of GNPS results together with data manual curation evidenced the presence in the network of one big flavonoids cluster together with a smaller one belonging to digalactosylmonoacylglycerol (DGMG) lipids; other unpaired nodes have also been identified during GNPS analysis ( Figure 1 ). 

HSV-1 UL27 forward GCCTTCTTCGCCTTTCGC HSV-1 UL27 reverse CGCTCGTGCCCTTCTTCTT SARS-CoV-2 S forward AGGTTGATCACAGGCAGACT SARS-CoV-2 S reverse GCTGACTGAGGGAAGGAC GAPDH forward CCTTTCATTGAGCTCCAT GAPDH reverse CGTACATGGGAGCGTC

Negative ionization mode HPLC-MS/MS is one of the powerful methods to characterize flavonoids because it provides information on both aglycones and glycosidic conjugates that can differentiate isomers [47, 52] . HPLC-MS/MS IDA analysis was carried out to investigate V. vinifera leaves metabolic profile.

MZmine [53] and GNPS [54] software were used to convert and analyze the raw MS data, and finally Cytoscape built the complex network shown in Figure 1 . Each node indicates a precursor ion, the node size is strongly related to its abundance in the sample (sum precursor intensity), and the edges size between two nodes is directly dependent on their MS/MS spectra similarity (cosine score) [55] . Analysis of GNPS results together with data manual curation evidenced the presence in the network of one big flavonoids cluster together with a smaller one belonging to digalactosylmonoacylglycerol (DGMG) lipids; other unpaired nodes have also been identified during GNPS analysis ( Figure 1 ). Assignment of each node has been manually curated and the putative identification is reported in Table 2 . Results showed that compound 1 was not in a cluster and it was identified by the GNPS annotation tool as the tannin 1-O,6-O-Digalloyl-β-D-glucopyranose. Assignment of each node has been manually curated and the putative identification is reported in Table 2 . Results showed that compound 1 was not in a cluster and it was identified by the GNPS annotation tool as the tannin 1-O,6-O-Digalloyl-β-D-glucopyranose. A detailed analysis of the MS and MS 2 spectra, combined with the GNPS annotation tools, lead to the characterization of 35 flavonoids conjugates (see Table 2 ). Most of them were quercetin derivatives (8 compounds), others included derivatives of luteolin (5 compounds), kaempferol (4 compounds), apigenin (3 compounds), isorhamnetin (2 compounds), myricetin, chrysoeriol, biochanin, isookanin, and scutellarein (1 compound) (Figure 2 ). Four flavonoids were not identified (N.I.). Moreover, we calculated the relative abundance of each compound present in Table  2 within the same chemical class. Results showed that compound 13 is the most representative among polyphenols, accounting for more than 44% of the total, followed by compounds 6 and 11, with 16% and 13%, respectively. Compounds 8, 14, 15, 26, and 28 account for less than 10% each, while all the others are present in less than 1% or traces ( Table 2) . Among DGMGs, compound 37 is the most representative, with 97%, while compound 38 is present in traces and compound 39 represents 3% of the cluster.

The aglycone fragment at m/z 285 of compounds 2, 20, 23, 25, and 26 suggested that they originated from kaempferol or luteolin. showed parental ion at m/z 483 and was generally assigned as luteolin-C-hexoside, by comparison with a precedent study [59] . Moreover, we calculated the relative abundance of each compound present in Table 2 within the same chemical class. Results showed that compound 13 is the most representative among polyphenols, accounting for more than 44% of the total, followed by compounds 6 and 11, with 16% and 13%, respectively. Compounds 8, 14, 15, 26, and 28 account for less than 10% each, while all the others are present in less than 1% or traces ( Table 2 ). Among DGMGs, compound 37 is the most representative, with 97%, while compound 38 is present in traces and compound 39 represents 3% of the cluster.

The aglycone fragment at m/z 285 of compounds 2, 20, 23, 25, and 26 suggested that they originated from kaempferol or luteolin. showed parental ion at m/z 483 and was generally assigned as luteolin-C-hexoside, by comparison with a precedent study [59] .

Compounds 10, 11, and 29 exhibited the same [M − H] − ion at m/z 431. Compounds 10 and 11 showed a typical fragment of C-glycosides [M − H-120] − at m/z 311. In addition, their MS 2 pattern corresponds to the vitexin and isovitexin fragmentation profiles, respectively [58] . The isomer 29 was generally assigned as apigenin-C-glucoside. We could not assign any identification to compounds 3, 7, 12, and 27.

Compound 37 was assigned as digalactosylmonoacylglycerol (DGMG) 18:3 by GNPS annotation tool. By comparison, compounds 38 and 39 were tentatively assigned as DGMG 20:5 and DGMG 16:2, respectively.

In order to evaluate if leaf polyphenol extract had an antiviral potential, and in which stage of the viral infection it could act, we performed experiments in four conditions: (a) simultaneous addition of extract and virus to the cells ("co-treatment"); (b) extract firstly incubated with the virus and then added to the cells ("virus pre-treatment"); (c) extract added to the infected cells ("post-treatment"); and (d) cells treated before with the extract and then infected with the virus ("cell pre-treatment"). The tested range of extract concentrations was from 0.625 to 500 µg/mL both for HSV-1 and SARS-CoV-2, which was used as a virus model for enveloped DNA and RNA viruses, respectively. The percentage of viral inhibition was calculated with respect to the untreated infected control (CTRL−). The reported antiviral activity was very similar for both viruses (Figures 3 and 4) , indicating an early effect manifesting directly on the viral envelope. The extract was most effective when incubated with HSV-1 and SARS-CoV-2 upon addition to target cells (co-treatment, Figures 3A and 4A ) or with the virus (virus pre-treatment, Figures 3B and 4B ) prior to infection on the cell monolayer. No activity was registered when the extract was added after HSV-1 infection (post-treatment, Figures 3C and 4C) , while a slight antiviral effect was observed when cells were firstly treated with the extract and then infected (cell pretreatment, Figures 3D and 4D ). In detail, leaf extract was able to completely inhibit HSV-1 replication in virus pre-treatment assay until a concentration of 10 µg/mL was obtained but the virus resumed growing at 5 µg/mL, though with less efficiency ( Figure 3B) . Instead, the antiviral activity of V. vinifera extract was slightly lower against SARS-CoV-2, as it was set at 80% at 10 µg/mL. As HSV-1, no relevant inhibition was detected when the concentration of the extract was reduced to 5 µg/mL. was observed when cells were firstly treated with the extract and then infected (cell pretreatment, Figures 3D and 4D ). In detail, leaf extract was able to completely inhibit HSV-1 replication in virus pre-treatment assay until a concentration of 10 µg/mL was obtained but the virus resumed growing at 5 µg/mL, though with less efficiency ( Figure 3B ). Instead, the antiviral activity of V. vinifera extract was slightly lower against SARS-CoV-2, as it was set at 80% at 10 µg/mL. As HSV-1, no relevant inhibition was detected when the concentration of the extract was reduced to 5 µg/mL. The leaf extract definitely showed a stronger antiviral potential than Greco extract, which was used as a positive control (CTRL +) against HSV-1 and SARS-CoV-2 [11, [64] [65] [66] . The leaf extract definitely showed a stronger antiviral potential than Greco extract, which was used as a positive control (CTRL+) against HSV-1 and SARS-CoV-2 [11, [64] [65] [66] .

These data are very interesting and indicate that the leaf extract could act directly on viral particles, blocking the interaction with the cell membrane. To deepen the viral inactivation mechanism, another antiviral test was carried out, such as the attachment assay ( Figures 5 and 6) , by shifting the temperature during the infection at 4 • C. These data are very interesting and indicate that the leaf extract could act directly on viral particles, blocking the interaction with the cell membrane. To deepen the viral inactivation mechanism, another antiviral test was carried out, such as the attachment assay ( Figures 5 and 6) , by shifting the temperature during the infection at 4 °C. Figure 5 . Early viral attachment assay of leaf extract (µg/mL) against HSV-1. The antiviral activity is expressed as % of inhibition. The results presented were obtained from three independent experiments. Data are mean ± SD. Statistical differences were analyzed via Student's t-test, a value of p ≤ 0.05 was considered significant, with * p ≤ 0.05. These data are very interesting and indicate that the leaf extract co viral particles, blocking the interaction with the cell membrane. To de tivation mechanism, another antiviral test was carried out, such as th ( Figures 5 and 6) , by shifting the temperature during the infection at 4 Figure 5 . Early viral attachment assay of leaf extract (µg/mL) against HSV-1. T is expressed as % of inhibition. The results presented were obtained from thre periments. Data are mean ± SD. Statistical differences were analyzed via Stude p ≤ 0.05 was considered significant, with * p ≤ 0.05. Figure 5 . Early viral attachment assay of leaf extract (µg/mL) against HSV-1. The antiviral activity is expressed as % of inhibition. The results presented were obtained from three independent experiments. Data are mean ± SD. Statistical differences were analyzed via Student's t-test, a value of p ≤ 0.05 was considered significant, with * p ≤ 0.05. ses 2021, 13, x FOR PEER REVIEW Figure 6 . Early viral attachment assay of leaf extract (µg/mL) against SARS-C activity is expressed as % of inhibition. The results presented were obtained f ent experiments. Data are mean ± SD. Statistical differences were analyzed via value of p ≤ 0.05 was considered significant, with * p ≤ 0.05.

The extract's inhibitory effects on virus-cell binding event revea to block the attachment of both of the viruses into the host cell. It is m extract prevents the binding of viral envelope with the cell membran quent stages of infection by hindering some interacting site inside the deputed to the fusion, i.e., HSV-1 glycoprotein B and SARS-CoV-2 spi To validate data obtained by plaque assays, we analyzed the V. v pression genes involved in the viral infection (Figures 7 and 8 ). 0.625, 1.25, 2.5, 5, 10, 50 , 100, and 500 μg/mL was incubated with HSV-1 for 1h Figure 6 . Early viral attachment assay of leaf extract (µg/mL) against SARS-CoV-2. The antiviral activity is expressed as % of inhibition. The results presented were obtained from three independent experiments. Data are mean ± SD. Statistical differences were analyzed via Student's t-test, a value of p ≤ 0.05 was considered significant, with * p ≤ 0.05.

The extract's inhibitory effects on virus-cell binding event revealed that it was able to block the attachment of both of the viruses into the host cell. It is most likely that leaf extract prevents the binding of viral envelope with the cell membrane and all the subsequent stages of infection by hindering some interacting site inside the viral glycoprotein deputed to the fusion, i.e., HSV-1 glycoprotein B and SARS-CoV-2 spike protein.

To validate data obtained by plaque assays, we analyzed the V. vinifera effect on expression genes involved in the viral infection (Figures 7 and 8 ).

ruses 2021, 13, x FOR PEER REVIEW Figure 6 . Early viral attachment assay of leaf extract (µg/mL) against SARS-CoV-2. T activity is expressed as % of inhibition. The results presented were obtained from thr ent experiments. Data are mean ± SD. Statistical differences were analyzed via Stude value of p ≤ 0.05 was considered significant, with * p ≤ 0.05.

The extract's inhibitory effects on virus-cell binding event revealed tha to block the attachment of both of the viruses into the host cell. It is most li extract prevents the binding of viral envelope with the cell membrane and a quent stages of infection by hindering some interacting site inside the viral deputed to the fusion, i.e., HSV-1 glycoprotein B and SARS-CoV-2 spike pro To validate data obtained by plaque assays, we analyzed the V. vinifera pression genes involved in the viral infection (Figures 7 and 8 ). Regarding the HSV-1 antiviral effect, UL27 gene, a late gene coding for t glycoprotein B (gB) was quantified via molecular assay (Figure 7) . In brief for herpetic infections. Anti-SARS-CoV-2 activity of V. vinifera leaf ext tigated through the spike protein (S) gene expression (Figure 8 ). S pro anti-receptor inserted into the viral envelope essential to the attachm via the human angiotensin-converting enzyme 2 (hACE2) receptor [72 V. vinifera extract strongly reduced the S expression after SARS-C a concentration of 10 µg/mL was reached, and it resumed being expr pendent manner at lower concentrations. All together, these data indic leaf extract possesses a great antiviral and never previously investiga was reported against SARS-CoV-2. To date, the activity of flavonoids 2 has been analyzed with promising results in silico through bioinfo [46, 48, 75] ; in addition, the activity of these molecules towards other c as the Severe acute respiratory syndrome coronavirus (SARS-CoV) an piratory Syndrome Coronavirus (MERS), has been widely reported [7 results are noteworthy, although some phenolic compounds identifie are already reported as antiviral agents, such as quercetin which is curr trial [77] . This study focuses on the high anti-inflammatory ability of in COVID-19 treatment, and its dosage depends on the type of trea prophylactic use and 1000 mg for curative treatment.

In order to complete the toxicological activity of leaf extract, V. vi colon, lung, breast, cardiomyocytes, hepatocyte cancer cells, and im keratinocyte cell line for 48 h at four different concentrations from 65 µ ( Figure 9A-F) . With respect to the known published anticancer effect or peel of V. vinifera [78] , the leaf extract did not induce any substant cancer viability. This different response, compared to that previously r be explained by the different extraction methodologies or V. vinifera v Regarding the HSV-1 antiviral effect, UL27 gene, a late gene coding for the structural glycoprotein B (gB) was quantified via molecular assay (Figure 7) . In brief, a virus pretreatment assay was performed, as previously mentioned, and RNA was collected after 48 h post-infection. Results showed that the extract inhibited HSV-1 replication by blocking much of viral gene expression, which almost halved at a concentration of 10 µg/mL. The outcomes on the replication are in accordance with literature [67] [68] [69] [70] [71] , demonstrating that the leaf extract had a virucidal action and could be used as a prophylactic treatment for herpetic infections. Anti-SARS-CoV-2 activity of V. vinifera leaf extract was also investigated through the spike protein (S) gene expression ( Figure 8 ). S protein represents the antireceptor inserted into the viral envelope essential to the attachment to the host cell via the human angiotensin-converting enzyme 2 (hACE2) receptor [72] [73] [74] .

V. vinifera extract strongly reduced the S expression after SARS-CoV-2 infection until a concentration of 10 µg/mL was reached, and it resumed being expressed in a dosedependent manner at lower concentrations. All together, these data indicated that V. vinifera leaf extract possesses a great antiviral and never previously investigated activity, which was reported against SARS-CoV-2. To date, the activity of flavonoids against SARS-CoV-2 has been analyzed with promising results in silico through bioinformatics approaches [46, 48, 75] ; in addition, the activity of these molecules towards other coronaviruses, such as the Severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East Respiratory Syndrome Coronavirus (MERS), has been widely reported [76] . Altogether these results are noteworthy, although some phenolic compounds identified in the leaf extract are already reported as antiviral agents, such as quercetin which is currently under clinical trial [77] . This study focuses on the high anti-inflammatory ability of quercetin, effective in COVID-19 treatment, and its dosage depends on the type of treatment: 500 mg for prophylactic use and 1000 mg for curative treatment.

In order to complete the toxicological activity of leaf extract, V. vinifera was tested in colon, lung, breast, cardiomyocytes, hepatocyte cancer cells, and immortalized human keratinocyte cell line for 48 h at four different concentrations from 65 µg/mL to 500 µg/mL ( Figure 9A-F) . With respect to the known published anticancer effect of the grape, seeds, or peel of V. vinifera [78] , the leaf extract did not induce any substantial variation in cell cancer viability. This different response, compared to that previously reported [79] , could be explained by the different extraction methodologies or V. vinifera varieties used. These data suggest how this complex polyphenolic extract, in these conditions, was able to selectively act on a specific target, without altering other cellular mechanisms. 

Plants represent an important source of natural products with high medical relevance [51] . Polyphenols, as flavonoids, are widespread compounds in the plant kingdom, and they are characterized by different biological activities, including antioxidant, antimicrobial, anticancer, anti-inflammatory, and antiviral properties. In this study, aqueous methanol solvent was employed to prepare raw extracts of V. vinifera leaves and its chemical profile was analyzed through HPLC-MS in negative ionization mode. This analysis led to the identification and characterization of 35 flavonoids, most of which were derivatives of quercetin. Others included derivatives of luteolin, kaempferol, apigenin, isorhamnetin, myricetin, chrysoeriol, biochanin, isookanin, and scutellarein. Furthermore, we tested the antiviral potential of the extract against HSV-1 and SARS-CoV-2 with very interesting results, showing the capability of flavonoids to inhibit SARS-CoV-2 for the first time. Considering the current pandemic emergency, our results represent a promising resource for pharmaceutical industrial applications. Funding: CM1406/EPICHEMBIO; B63D18000560007/Campania Regional Government FASE2: IDEAL; B21C17000030007/Campania Regional Government Technology Platform Lotta alle Patolo- 

Plants represent an important source of natural products with high medical relevance [51] . Polyphenols, as flavonoids, are widespread compounds in the plant kingdom, and they are characterized by different biological activities, including antioxidant, antimicrobial, anticancer, anti-inflammatory, and antiviral properties. In this study, aqueous methanol solvent was employed to prepare raw extracts of V. vinifera leaves and its chemical profile was analyzed through HPLC-MS in negative ionization mode. This analysis led to the identification and characterization of 35 flavonoids, most of which were derivatives of quercetin. Others included derivatives of luteolin, kaempferol, apigenin, isorhamnetin, myricetin, chrysoeriol, biochanin, isookanin, and scutellarein. Furthermore, we tested the antiviral potential of the extract against HSV-1 and SARS-CoV-2 with very interesting results, showing the capability of flavonoids to inhibit SARS-CoV-2 for the first time. Considering the current pandemic emergency, our results represent a promising resource for pharmaceutical industrial applications. Funding: CM1406/EPICHEMBIO; B63D18000560007/Campania Regional Government FASE2: IDEAL; B21C17000030007/Campania Regional Government Technology Platform Lotta alle Patologie Oncologiche: iCURE.

Metabolic and RNA profiling elucidates proanthocyanidins accumulation in Aglianico grape

Comprehensive polyphenolic profiling in promising resistant grapevine hybrids including 17 novel breeds in northern Italy

Grapevine as a Rich Source of Polyphenolic Compounds

VvNAC17, a novel stress-responsive grapevine (Vitis vinifera L.) NAC transcription factor, increases sensitivity to abscisic acid and enhances salinity, freezing, and drought tolerance in transgenic Arabidopsis

The Pharmacological Activity, Biochemical Properties, and Pharmacokinetics of the Major Natural Polyphenolic Flavonoid: Quercetin. Foods 2020

The red wine component ellagic acid induces autophagy and exhibits anti-lung cancer activity in vitro and in vivo

Gastroprotective effect of leaf extract of two varieties grapevine (Vitis vinifera L.) native wild and cultivar grown in North of Tunisia against the oxidative stress induced by ethanol in rats

Antidiabetic effects of novel cell culture established from grapevine

Protective Effect of Vitis labrusca Leaves Extract on Cardiovascular Dysfunction through HMGB1-TLR4-NFkappaB Signaling in Spontaneously Hypertensive Rats

Preparation and Antioxidant Activity of Ethyl-Linked Anthocyanin-Flavanol Pigments from Model Wine Solutions

Grape Canes from Typical Cultivars of Campania (Southern Italy) as a Source of High-Value Bioactive Compounds: Phenolic Profile, Antioxidant and Antimicrobial Activities

Grapevine Cane Extracts: Raw Plant Material, Extraction Methods, Quantification, and Applications

Antimicrobial activity of red wine and oenological extracts against periodontal pathogens in a validated oral biofilm model

Grape Seed Proanthocyanidin Inhibits Mucin Synthesis and Viral Replication by Suppression of AP-1 and NF-kappaB via p38 MAPKs/JNK Signaling Pathways in Respiratory Syncytial Virus-Infected A549 Cells

Proanthocyanidin from grape seeds potentiates anti-tumor activity of doxorubicin via immunomodulatory mechanism

The chemoadjuvant potential of grape seed procyanidins on p53-related cell death in oral cancer cells

Resveratrol directly targets COX-2 to inhibit carcinogenesis

Grape seed proanthocyanidins inhibit the invasive potential of head and neck cutaneous squamous cell carcinoma cells by targeting EGFR expression and epithelial-to-mesenchymal transition

Combined resveratrol, quercetin, and catechin treatment reduces breast tumor growth in a nude mouse model

PMP22 Regulates Self-Renewal and Chemoresistance of Gastric Cancer Cells

Therapeutic impact of grape leaves polyphenols on certain biochemical and neurological markers in AlCl3-induced Alzheimer's disease

Anti-cancer activity of grape seed semi-polar extracts in human mesothelioma cell lines

Antioxidant and Antibacterial Activities of Grape (Vitis vinifera L.) Seeds and Skin from Organic and Conventional Vineyards

Effect of Black Grape Seed Extract (Vitis vinifera) on Biofilm Formation of Methicillin-Resistant Staphylococcus aureus and Staphylococcus haemolyticus

Effects of Defoliation on Phenolic Concentrations, Antioxidant and Antibacterial Activity of Grape Skin Extracts of the Varieties Blaufrankisch and Merlot (Vitis vinifera L.)

Characterization of an Antioxidant and Antimicrobial Extract from Cool Climate, White Grape Marc

Sepsis-A Retrospective Cohort Study of Bloodstream Infections. Antibiotics 2020

Phenolic Compounds and Bioactivity of Healthy and Infected Grapevine Leaf Extracts from Red Varieties Merlot and Vranac (Vitis vinifera L.)

Influence of phenolic compounds from wines on the growth of Listeria monocytogenes

Potential Antimicrobial Activity of Red and White Wine Phenolic Extracts against Strains of Staphylococcus aureus, Escherichia coli and Candida albicans

Effective inhibition of MERS-CoV infection by resveratrol

Resveratrol, sirtuins, and viruses

Antibacterial, antiviral, and antifungal properties of wines and winery byproducts in relation to their flavonoid content

Antiviral Properties of the Natural Polyphenols Delphinidin and Epigallocatechin Gallate against the Flaviviruses West Nile Virus, Zika Virus, and Dengue Virus

Bovine Viral Diarrhea Virus (BVDV): A Preliminary Study on Antiviral Properties of Some Aromatic and Medicinal Plants

Portuguese winemaking residues as a potential source of natural anti-adenoviral agents

The Potentiality of Grape Seed Extract as a Novel Anti-hepatitis C virus Agent

Grape seed extract for control of human enteric viruses

Massive Proportion of World's Population Are Living with Herpes Infection; World Health Organization

World Health Organization. Globally, an Estimated Two-Thirds of the Population Under 50 are Infected with Herpes Simplex Virus Type 1; World Health Organization

HSV membrane glycoproteins, their function in viral entry and their use in vaccine studies

World Health Organization. WHO Coronavirus (COVID-19) Dashboard; World Health Organization

Pathology and Pathogenesis of SARS-CoV-2 Associated with Fatal Coronavirus Disease, United States

Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor

A drug repurposing approach towards elucidating the potential of flavonoids as COVID-19 spike protein inhibitors

Phenolic Profiles of Leaves, Grapes and Wine of Grapevine Variety Vranac (Vitis vinifera L

Flavonols as potential antiviral drugs targeting SARS-CoV-2 proteases (3CL(pro) and PL(pro)), spike protein, RNA-dependent RNA polymerase (RdRp) and angiotensin-converting enzyme II receptor (ACE2)

In Vitro Antiviral Activity and Projection of Optimized Dosing Design of Hydroxychloroquine for the Treatment of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)

Combating Actions of Green 2D-Materials on Gram Positive and Negative Bacteria and Enveloped Viruses

Total Phenols from Grape Leaves Counteract Cell Proliferation and Modulate Apoptosis-Related Gene Expression in MCF-7 and HepG2 Human Cancer Cell Lines

Chemical Composition and Biological Activities of the Aqueous Fraction of Parkinsonea aculeata L. Growing in Saudi Arabia

MZmine 2: Modular framework for processing, visualizing, and analyzing mass spectrometry-based molecular profile data

Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking

Molecular Network and Culture Media Variation Reveal a Complex Metabolic Profile in Pantoea cf. eucrina D2 Associated with an Acidified Marine Sponge

HPLC-UV-MS profiles of phenolic compounds and antioxidant activity of fruits from three citrus species consumed in Northern Chile

Comprehensive characterization of C-glycosyl flavones in wheat (Triticum aestivum L.) germ using UPLC-PDA-ESI/HRMS(n) and mass defect filtering

Characterization of Phenolics from Crataegus monogyna and Crataegus laevigata (Hawthorn) Leaves, Fruits and their Herbal Derived Drops (Crataegutt Tropfen)

Antioxidant polyphenols of Madeira sorrel (Rumex maderensis): How do they survive to in vitro simulated gastrointestinal digestion?

Preparation of quercetin glucuronides and characterization by HPLC-DAD-ESI/MS

Analysis of Flavonoids in Rhamnus davurica and Its Antiproliferative Activities

Scientific validation of synergistic antioxidant effects in commercialised mixtures of Cymbopogon citratus and Pterospartum tridentatum or Gomphrena globosa for infusions preparation

The Use of Mass Spectrometric Techniques to Differentiate Isobaric and Isomeric Flavonoid Conjugates from Axyris amaranthoides

World Health Organization. Coronavirus Disease (COVID-19) Pandemic; World Health Organization

Oncolytic Viruses in Combination Therapeutic Approaches with Epigenetic Modulators: Past, Present, and Future Perspectives

Engineering of Janus-Like Dendrimers with Peptides Derived from Glycoproteins of Herpes Simplex Virus Type 1: Toward a Versatile and Novel Antiviral Platform

Modifications of Activity of Autonomic Nervous System, and Resting Energy Expenditure in Women Using Hormone-Replacement Therapy

Polycystic ovary syndrome and probiotics: A natural approach to an inflammatory disease. Curr

Roles of flavonoids against coronavirus infection

Anti-HSV-1 and HSV-2 Flavonoids and a New Kaempferol Triglycoside from the Medicinal Plant Kalanchoe daigremontiana

Repurposing of Some Natural Product Isolates as SARS-COV-2 Main Protease Inhibitors via In Vitro Cell Free and Cell-Based Antiviral Assessments and Molecular Modeling Approaches

The SARS-CoV-2 Spike protein has a broad tropism for mammalian ACE2 proteins

SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor

Virus-Receptor Interactions of Glycosylated SARS-CoV-2 Spike and Human ACE2 Receptor

In silico evaluation of flavonoids as effective antiviral agents on the spike glycoprotein of SARS-CoV-2

Effect of Quercetin on Prophylaxis and Treatment of COVID-19

Cytotoxicity and apoptotic cell death induced by Vitis vinifera peel and seed extracts in A431 skin cancer cells

In vitro assessment of cytotoxic, antioxidant and antimicrobial activities of leaves from two grape varieties collected from arid and temperate regions in Palestine

Acknowledgments: The authors are grateful to PRIN 2017 "Natural and pharmacological inhibition of the early phase of viral replication (VirSudNet)" N • 2017M8R7N9.

The authors declare no conflict of interest.