key: cord-0978155-lme6vcqs
authors: Peacock, Thomas P.; Goldhill, Daniel H.; Zhou, Jie; Baillon, Laury; Frise, Rebecca; Swann, Olivia C.; Kugathasan, Ruthiran; Penn, Rebecca; Brown, Jonathan C.; Sanchez-David, Raul Y.; Braga, Luca; Williamson, Maia Kavanagh; Hassard, Jack A.; Staller, Ecco; Hanley, Brian; Osborn, Michael; Giacca, Mauro; Davidson, Andrew D.; Matthews, David A.; Barclay, Wendy S.
title: The furin cleavage site of SARS-CoV-2 spike protein is a key determinant for transmission due to enhanced replication in airway cells
date: 2020-09-30
journal: bioRxiv
DOI: 10.1101/2020.09.30.318311
sha: 795e8cc227f188788aa6de34076bef76b6ece236
doc_id: 978155
cord_uid: lme6vcqs

SARS-CoV-2 enters cells via its spike glycoprotein which must be cleaved sequentially at the S1/S2, then the S2’ cleavage sites (CS) to mediate membrane fusion. SARS-CoV-2 has a unique polybasic insertion at the S1/S2 CS, which we demonstrate can be cleaved by furin. Using lentiviral pseudotypes and a cell-culture adapted SARS-CoV-2 virus with a S1/S2 deletion, we show that the polybasic insertion is selected for in lung cells and primary human airway epithelial cultures but selected against in Vero E6, a cell line used for passaging SARS-CoV-2. We find this selective advantage depends on expression of the cell surface protease, TMPRSS2, that allows virus entry independent of endosomes thus avoiding antiviral IFITM proteins. SARS-CoV-2 virus lacking the S1/S2 furin CS was shed to lower titres from infected ferrets and was not transmitted to cohoused sentinel animals. Thus, the polybasic CS is a key determinant for efficient SARS-CoV-2 transmission.

In 2019, a respiratory epidemic of unknown aetiology emerged in Hubei Province, China. The 32 cause of the outbreak was quickly identified as a novel betacoronavirus, closely related to severe acute 33 respiratory syndrome coronavirus (SARS-CoV) and named SARS-CoV-2 (P. Zhou et al., 2020 ; N. Zhu et 34 al., 2020) . SARS-CoV-2 is highly transmissible between humans and by the middle of March, the WHO 35 relatives of SARS-CoV-2, such as SARS-CoV, although similar polybasic CS are found in more distantly 56 related coronaviruses (Andersen, Rambaut, Lipkin, Holmes, & Garry, 2020; Boni et al., 2020; Le 57 Coupanec et al., 2015) . It has previously been demonstrated for the MERS-CoV spike, and for SARS-58

CoV-2, that the furin CS at the S1/S2 junction may promote entry into lung cells ( In this study, we use a combination of lentiviral pseudotypes with spike CS mutations and Vero 68 passaged SARS-CoV-2 virus variants to investigate the molecular mechanism by which the polybasic 69 CS of SARS-CoV-2 mediates efficient entry into lung cells. We describe the biological consequences of 70 these mutations and test the effect of these mutations on viral transmission in ferrets. 71

The polybasic S1/S2 cleavage site of SARS-CoV-2 spike protein is cleaved by furin 73 To investigate the importance of the spike polybasic CS of SARS-CoV-2 (PRRAR), a number of 74 spike mutants were generated which were predicted to modulate the efficiency of furin cleavage 75 ( Figure 1A ) including: substituting two of the upstream arginines to produce a monobasic CS similar 76 to SARS-CoV spike (monoCS), replacing the tribasic CS with the furin CS of a highly pathogenic H5N1 77 avian influenza haemagglutinin containing a string of seven basic amino acids (H5CS), and two 78 naturally occurring deletions seen following passage in Vero E6 cells and/or in clinical isolates 79 (Davidson et al., 2020; Lau et al., 2020) . The first of these removes eight amino acids including all 3 arginines of the PRRAR site (ΔCS) -while the other removes five flanking amino acids but retains the 81 tribasic site (Δflank). The mutations were engineered into a cDNA encoding the spike to enable cell 82 surface expression and the generation of lentiviral pseudotypes (PV) that carry each spike variant. In 83 addition, to study the importance of the PRRAR motif in the context of live virus we took advantage 84 of a naturally occurring Vero cell adapted mutant SARS-CoV-2 isolate, ΔCS (Davidson et al., 2020) . This 85 variant and the wild type virus from which it was derived were cloned by limiting dilution to enable 86 studies using individual genotypes. 87

In several previous studies, the ability of coronavirus spike proteins to be cleaved by furin has 88 been correlated with the ability to generate syncytia at neutral pHs when overexpressed (Belouzard 89 in syncytia formation, respectively). As described before, SARS-CoV spike expression resulted in poor 94 syncytia formation while MERS-CoV spike produced much higher levels of syncytia ( Figure 1B ). SARS-95

CoV-2 WT spike gave an intermediate level of syncytia formation that was ablated for the mutants 96 which were not cleaved by furin. The H5CS spike bearing the optimised furin CS produced a higher 97 level of syncytia formation than SARS-CoV-2 WT, similar to MERS-CoV spike. 98

To investigate the differences in spike cleavage efficiency in producer cells between the 99 mutants, we produced PV with each mutant spike protein (or SARS-CoV) in human embryonic kidney 100 293T (293T) cells. PV were concentrated and probed by western blot ( Figure 1C , left panel). Equal 101 amounts of PV particles were loaded as indicated by p24 content. PV formed with SARS-CoV-2 WT 102 spike had two bands reactive with anti-spike S2 antibody, corresponding to cleaved and uncleaved 103 spike, with the stronger band corresponding to the cleaved S2 product. PV containing the H5CS spike 104 showed very little uncleaved spike while PV with SARS-CoV WT spike and SARS-CoV-2 monobasic and 105 deletion mutants showed near compete losses of cleaved spike. When PV were produced in parallel 106 in the presence of a furin inhibitor, full-length spike was somewhat restored for the WT and H5CS 107 spike ( Figure 1C , right panel). We also took WT and ΔCS SARS-CoV-2 virus, concentrated virions by 108 centrifugation and probed by western blot for spike cleavage ( Figure 1D ). Like the PV, WT SARS-CoV-109 2 harboured both uncleaved and cleaved S2 whereas the virions of the ΔCS mutant virus only had 110 uncleaved spike. Overall, these data confirm that the polybasic CS of SARS-CoV-2 is a bona fide furin 111

The polybasic cleavage site of SARS-CoV-2 spike protein promotes entry into epithelial 113 cell lines and cultures but adversely affects entry into Vero and 293Ts cells.

To investigate whether the S1/S2 furin CS of SARS-CoV-2 plays a role in virus entry, we initially 115 performed competition assays by taking a mixed population of virus containing 70% ΔCS mutant and 116 30% WT SARS-CoV-2 (as determined by deep sequencing of the S1/S2 CS; Figure 2A ) and inoculating 117 the virus mix onto Vero E6 cells, human intestinal Caco-2 cells or air-liquid interface human airway 118 epithelial cell cultures (HAEs) at a low multiplicity of infection (MOI) to enable multicycle replication. 119

We deep sequenced the progeny virus at 72 hours post-inoculation from the Vero E6 or Caco-2 120 (human intestinal) cells and found that whereas the ΔCS mutant outcompeted the WT in Vero E6 cells, 121 WT became predominant in the Caco-2 cells. In primary HAE cultures, the WT virus also outcompeted 122 the ΔCS virus until the variant was almost undetectable after 72 hours. We also infected Calu-3 (human 123 lung) cells with either the clonal WT or ΔCS viruses at an MOI of 0.1 ( Figure 2C ). WT virus replicated 124 robustly and reached peak titres greater than 10 5 pfu after 48 hours. Conversely, ΔCS virus, appeared 125 unable to productively infect Calu-3 cells and no infectious titre was detected in supernatant at any 126 time point. 127

Next, we probed the ability of PV with different mutant spike proteins to enter several 128 different human cell lines: 293T cells expressing human ACE2, Caco-2 cells or Calu-3 cells ( Figure 2D -129 F). PV bearing the envelope of amphotropic murine leukaemia virus (MLV-A) or Indiana vesicular stomatitis virus glycoprotein (VSV-G) were used as positive controls for cell entry while PV produced 131 without any viral glycoproteins (bald) were used as negative controls throughout. As seen in the Vero 132 E6 cells (Figure 2A ), a clear negative correlation was seen between efficiency of furin cleavage of the 133 spike and entry in the 293T-ACE2 cells ( Figure 2D ). PV with WT SARS-CoV-2 spike entered 293T-ACE2s 134 more poorly than SARS-CoV, while mutants without furin cleavage (monoCS, ΔCS, Δflank) entered cells 135 significantly more efficiently (over 3-fold compared to WT). Introduction of the optimal furin CS (H5CS) 136 resulted in significantly poorer entry than WT (~10-fold lower; P < 0.001). When Caco-2 and Calu-3 137 cells were tested for PV entry, however, the opposite trend was observed reflecting the efficiency of 138 virus replication in Caco-2, Calu-3 and primary HAE cells ( Figure 2E ,F). WT and H5CS spike PV entered 139 cells efficiently while the mutants unable to be cleaved by furin, including ΔCS, entered cells 140 significantly less efficiently (>2-fold lower in Caco-2 cells and ~5-fold lower in Calu-3 cells). 141

We next tested the PV which had been generated in the presence of a furin inhibitor for their 142 ability to enter 293T-ACE2 and Caco-2 cells ( Figure 2G ,H). In 293T-ACE2, entry of PV bearing WT SARS-143

CoV-2 or H5CS spike was boosted 2-to 3-fold if furin was inhibited when the PV was produced ( Figure  144 2G). Conversely, WT SARS-CoV-2 PVs entered Caco-2 cells more poorly (2-fold lower) after inhibition 145 of furin cleavage, while no effect was seen on the H5CS mutant, potentially due to the majority of 146 spike still remaining cleaved even after furin inhibition ( Figure 1H ). No significant differences in entry 147 were observed for the other mutants or SARS-CoV. 148

Overall, these results suggest that during replication of SARS-CoV-2 in Vero and 293T-ACE2 149 cells, there is a fitness cost in having a cleaved spike prior to entry, while in primary airway cells and 150 lung and intestinal cell lines, possessing a processed SARS-CoV-2 furin CS provides an advantage by 151 facilitating entry. 152

Entry of SARS-CoV-2 into 293T cells is dependent on cathepsins while entry into Caco-153 2, Calu-3 and primary HAE cells is dependent on TMPRSS2

As well as processing at the S1/S2 CS, coronavirus spike protein requires cleavage at the S2' 155 site to enable the virus membrane to fuse with the membrane of the host cell. To investigate whether 156 the different cell entry phenotypes seen in 293T-ACE2/Vero vs Caco-2/Calu-3/HAE cells was due to 157 differences in the protease use in different cell types, we performed PV entry assays in the presence 158 of different protease inhibitors: camostat which inhibits serine proteases such as TMPRSS2, and E-159 64d, which inhibits cathepsins. Both drugs have previously been shown to be inhibitory to SARS-CoV 160 and SARS-CoV-2 entry (Hoffmann, Kleine-Weber, Schroeder, et al., 2020; X. . 161

In 293T-ACE2 cells, camostat pre-treatment did not inhibit PV entry whereas E-64d strongly 162 inhibited entry of SARS-CoV spike PVs, as well as SARS-CoV-2 WT PVs and all CS mutants ( Figure 3A ). 163

In Caco-2 cells, a different pattern was seen: camostat had a significant impact on PVs bearing spike 164 proteins with furin CSs whereas E-64d had a significant impact on PV which were not cleaved by furin 165 ( Figure 3B ). In Calu-3 cells, camostat significantly inhibited entry of all coronavirus PVs while E-64d 166 also had a modest, but significant (P < 0.05), effect on the ΔCS mutant ( Figure 3C Finally, we investigated the effect of amphoB treatment on SARS-CoV-2 replication in primary 219 airway cells. AmphoB had no effect on WT virus replication, but greatly increased the replication of 220 the ΔCS mutant ( Figure 4F ). This implies that IFITM proteins, such as IFITM3, are a major block for 221 entry of viruses without furin CSs in these cells. 222

The SARS-CoV-2 polybasic cleavage site promotes replication in the respiratory tract were placed into each cage. All ferrets were nasal washed daily for the following 2 weeks and virus 230 shedding in the nose was titrated by qRT-PCR and by TCID50 ( Figure 5A ,B, Supplementary Figure S2A ,B). 231

All eight directly inoculated ferrets shed virus robustly for 9-12 days ( Figure 5A ). The WT infected 232 group shed more virus in the nose than ferrets infected with ΔCS virus, indicated by higher infectivity 233

and higher E gene copy numbers, the latter significant at days 2-4. In the WT group, 2/4 contact ferrets 234 In nasal washes of the two remaining ferrets 237 exposed to donors infected with WT virus, low E gene copy numbers were detected but no infectious 238 virus was measured by TCID50, and these animals remained seronegative at 14 days post exposure, 239 implying these ferrets were genuinely not infected in contrast to all directly infected animals and the 240 two virus positive WT infected sentinels (Supplementary Figure S2C) . 241

Next, a competition assay was performed whereby four ferrets were inoculated intra-nasally 242 with 10 5 pfu of the previously described mixture of WT and ΔCS virus at a 30:70 ratio, as determined 243 by deep sequencing. One day post-inoculation, naïve contact ferrets were cohoused with each directly 244 inoculated animal and all animals were nasal washed daily. All directly inoculated ferrets became 245 productively infected, shedding infectious virus and detectable E gene in nasal wash for between 9-246 12 days ( Figure 5C ). Interestingly, which virus genotype became dominant in the nasal washes of the 247 directly infected ferrets appeared to vary stochastically; in two animals the WT virus became 248 predominant by day 2, and levels of infectious virus and E gene detected in their nasal wash was 249 highest. In the nasal wash of the other two directly inoculated animals, the ΔCS virus remained the 250 majority species or outcompeted the WT over the course of the experiment. Productive transmission 251 was only recorded in a single contact and interestingly, this animal was co-caged with one of the 252 animals that was shedding predominantly WT virus. The ΔCS genotype was detectable in this single contact at low levels on day 3, 8 and 9, but at all times the WT genotype was clearly predominant. 254 Furthermore, this was the only contact ferret to seroconvert, confirming the other 3 contact ferrets 255

were not productively infected (Supplementary Figure S3D) Finally, we wanted to investigate whether spike deletion mutants could be found in human 261 clinical samples and, if so, whether they were more likely to be found in a particular organ. Initially we 262 downloaded 100,000 genome sequences from GISAID and found 2 sequences from nasal swabs with 263 CS deletions (Supplementary Table S1 ). Next, we sequenced the S1/S2 CS from 24 previously described 264 post-mortem samples taken from five different post-mortems and including tissues from the 265 respiratory and gastrointestinal tract, the brain, heart, bone marrow, kidney, tongue and spleen 266 (Hanley et al., 2020) . Sequencing revealed very low levels of viral RNA bearing different S1/S2 CS 267 deletion (<1%) from heart and spleen tissue from separate patients (Supplementary Table S2 ). The 268 three separate deletions reported in Supplementary Table S1 have not previously been reported but 269 are similar to those seen upon passage in Vero E6 cells. OS5 deletes 4 amino acids after the CS similar 270 to a deletion reported in a recent preprint (Sasaki et al., 2020); OS19-1 overlaps with most of ∆Flank 271 and OS19-2 completely removes the S1/S2 site, similar to ∆CS. We have also observed identical 272 deletions to OS19-2 upon passaging the clonal WT virus in Vero E6 cells. These results are consistent 273 with the conclusion that S1/S2 cleavage site deletions can arise naturally in vivo, albeit at a very low and inhibit viral membrane fusion in these compartments. Viruses that lack a polybasic S1/S2 CS 284 cannot be cleaved by furin in producer cells and are thus forced to enter the next cell they infect 285 through the endosome where the spike can be cleaved at S1/S2 and S2' by cathepsins. However, pre-286 cleaved spike is not always advantageous: in cell types lacking TMPRSS2 expression, such as Vero E6, 287 viruses without the furin CS gain an advantage, potentially because they are more stable, since spike 288 cleavage may result in premature loss of the S1 subunit altogether and abrogate receptor binding. Our 289 results show that, in contrast with WT SARS-CoV-2, a virus with a deleted furin CS did not replicate to 290 high titres in the upper respiratory tract of ferrets and did not transmit to cohoused sentinel animals, 291 in agreement with recent results from similar experiments with hamsters (Y. Zhu et al., 2020). It is not 292 yet clear whether transmission is blocked due to the lower titres released from the directly inoculated 293 donor ferrets, or to a lower ability to initiate infection in the TMPRSS2-rich cells of the nasal epithelium 294 or a combination of these. We have found that furin CS deletions arise naturally in various different 295 human organs during severe infection, but rarely and at low levels. Indeed, we note only 2 recorded 296 genomes on GISAID out of 100,690 (as of 16/9/20) with furin CS deletions (Supplemental Table S1 ). 297

Given the ease of loss of the furin CS in cell culture, the lack of these mutants in sequenced isolates is 298 further evidence that the furin CS is essential for sustained transmission of SARS-CoV-2 in humans.

Presence of a furin CS at the S1/S2 junction is not uncommon in human coronaviruses; two of 300 the four seasonal coronaviruses that transmit efficiently in humans, hCoV-HKU1 and hCoV-OC43 in the human airway WT SARS-CoV-2 has evolved to enter cells without the need for endosomal 344 acidification. Monitoring wild coronaviruses will likely be important in predicting and preventing 345 future pandemics. We suggest that a furin CS in the SARS lineage is a cause for concern. The polybasic 346 insertion to the S1/S2 CS provides a significant fitness advantage in TMPRSS2 expressing cells and is 347 likely essential for efficient human transmission. Hepes, 2mM L-Glutamine, 1x P/S, 0.6% w/v agarose). Plates were incubated for 3 days at 37 o C before 393 overlay was removed and cells were stained for 1 hour at RT in crystal violet solution. 394

To titrate virus by TCID50 Vero E6 cells were used at 70-80% confluence. Serial dilutions of 395 virus, diluted in serum-free DMEM, 1% NEAA, 1% P/S, were added to each well and cells were left for 396 5 days before they were fixed with 2x crystal violet solution and analysed. 4 replicates of each sample 397 were performed in tandem. TCID50 titres were determined by the Spearman-Kärbar method (Kärber, 398 1931) . 399 clinically as the cause of death were sourced and processed as previously described (Hanley et al., 459 2020) . Briefly, fresh tissue was processed within biosafety level 3 facilities and total RNA was extracted 460 using TRIzol (Invitrogen)-chloroform extraction followed by precipitation and purification using an 461

RNeasy mini kit (Qiagen). RNA was reverse transcribed using Superscript IV (Invitrogen) and the 462 following primer (GTCTTGGTCATAGACACTGGTAG). PCR was performed using KOD polymerase 463 (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and 464 GGCTGTTTAATAGGGGCTGAAC) giving a 260bp amplicon. Samples were prepared for sequencing using were analysed in Geneious (v11) and a pipeline in R. Forward and reverse reads were paired using 467 FLASh (https://ccb.jhu.edu/software/FLASH) before being mapped to a reference sequence. Raw 468 sequences were deposited at www.ebi.ac.uk/ena, project number PRJEB40394. The analysis pipeline 469

can be found at github.com/Flu1/Corona. 470 

The proximal origin of 545 SARS-CoV-2

Activation of the SARS coronavirus spike protein 547 via sequential proteolytic cleavage at two distinct sites

Ferrets as Models for Influenza Virus Transmission Studies and Pandemic Risk Assessments

TMPRSS2 and TMPRSS4 facilitate trypsin-independent spread of influenza virus in Caco-2 cells. 554

Evolutionary origins of the SARS-CoV-2 sarbecovirus lineage responsible for the COVID-19 557 pandemic

IFITM 559 proteins promote SARS-CoV-2 infection of human lung cells. bioRxiv

Syncytia formation by SARS-CoV-2 infected cells. bioRxiv

Neuropilin-1 facilitates SARS-CoV-2 cell entry and provides a possible pathway into the 566 central nervous system. bioRxiv

The spike 568 glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in 569 CoV of the same clade

Neuropilin-1 is a host factor for SARS-CoV-2 infection. bioRxiv

Characterisation of the transcriptome and proteome of SARS-CoV-2 reveals a cell 575 passage induced in-frame deletion of the furin-like cleavage site from the spike glycoprotein

Survey of Human Chromosome 21 Gene Expression Effects on Early Development in Danio 579 rerio. G3 (Bethesda)

IFITM3 581 restricts the morbidity and mortality associated with influenza

Determining the Mutation Bias of Favipiravir in Influenza Virus Using Next-Generation 585

The mechanism of resistance to favipiravir in influenza

Histopathological findings and viral tropism in UK patients with severe fatal COVID-19: a post-591 mortem study

A Multibasic Cleavage Site in the Spike 593 Protein of SARS-CoV-2 Is Essential for Infection of Human Lung Cells

SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically 597 Proven Protease Inhibitor

Chloroquine does not inhibit infection of human lung cells with SARS-600

CoV-2

Washington State -nCo

First Case of 2019 Novel Coronavirus in the United States

Distinct patterns of IFITM-mediated restriction of filoviruses, SARS coronavirus, and 606 influenza A virus

Accurate sampling and 608 deep sequencing of the HIV-1 protease gene using a Primer ID

Furin Cleavage Site Is Key to SARS-CoV-2 Pathogenesis. bioRxiv

Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche

Infection and 617 Rapid Transmission of SARS-CoV-2 in Ferrets

SARS-CoV-2 growth, furin-cleavage-site adaptation and neutralization using 621 serum from acutely infected hospitalized COVID-19 patients

CoV-2 variants with deletions at the S1/S2 junction

Cleavage of a Neuroinvasive Human Respiratory Virus Spike Glycoprotein by

Proprotein Convertases Modulates Neurovirulence and Virus Spread within the Central 629 Nervous System

Internal genes of a highly pathogenic H5N1 influenza virus determine high viral replication in 632 myeloid cells and severe outcome of infection in mice

Angiotensin-635 converting enzyme 2 is a functional receptor for the SARS coronavirus

Amphotericin B increases influenza A virus infection by preventing IFITM3-mediated 639 restriction

The reproductive number of COVID-19 is 641 higher compared to SARS coronavirus

Identification of common deletions 643 in the spike protein of SARS-CoV-2

Antiviral therapies against Ebola 645 and other emerging viral diseases using existing medicines that block virus entry. F1000Res, 646 4

CoV-2 receptor ACE2 and TMPRSS2 in human primary conjunctival and pterygium cell lines 649 and in mouse cornea

Antiviral activities of type I 651 interferons to SARS-CoV-2 infection

Efficient 654 activation of the severe acute respiratory syndrome coronavirus spike protein by the 655 transmembrane protease TMPRSS2

Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells

Self-660 amplifying RNA SARS-CoV-2 lipid nanoparticle vaccine candidate induces high neutralizing 661 antibody titers in mice

Host cell entry of Middle East respiratory syndrome coronavirus 663 after two-step, furin-mediated activation of the spike protein

Consensus and 666 variations in cell line specificity among human metapneumovirus strains

SARS-coronavirus-2 replication in Vero E6 cells: replication kinetics, rapid 670 adaptation and cytopathology

Hydroxychloroquine-mediated 672 inhibition of SARS-CoV-2 entry is attenuated by TMPRSS2. bioRxiv

Characterization of spike glycoprotein 675 of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV

Proteolytic 678 processing of Middle East respiratory syndrome coronavirus spikes expands virus tropism

SARS-CoV-2 is transmitted via contact and via the air between ferrets

SARS-CoV-2 684 variants with mutations at the S1/S2 cleavage site are generated <em>in vitro</em> during 685 propagation in TMPRSS2-deficient cells. bioRxiv

Cell entry mechanisms of 688 SARS-CoV-2

Opposing activities of IFITM proteins in SARS-CoV-2 infection. bioRxiv

Middle East respiratory syndrome coronavirus 693 infection mediated by the transmembrane serine protease TMPRSS2

A 696 transmembrane serine protease is linked to the severe acute respiratory syndrome 697 coronavirus receptor and activates virus entry

Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry

Disrupting HIV-1 capsid formation causes cGAS sensing of viral DNA

Pathogenicity, 706 immunogenicity, and protective ability of an attenuated SARS-CoV-2 variant with a deletion 707 at the S1/S2 junction of the spike protein

Natural 710 transmission of bat-like SARS-CoV-2PRRA variants in COVID-19 patients

IFITM proteins inhibit entry driven by the MERS-713 coronavirus spike protein: evidence for cholesterol-independent mechanisms

The role of furin cleavage site in 716 SARS-CoV-2 spike protein-mediated membrane fusion in the presence or absence of trypsin

Zhan-sheng

Transmembrane Protein 3 Inhibits Hantaan Virus Infection, and Its Single 720 Nucleotide Polymorphism rs12252 Influences the Severity of Hemorrhagic Fever with Renal 721 Syndrome

Cathepsin L Expression and Activity via JNK Pathway in Human Dermal Fibroblasts

Interferon-726 induced transmembrane protein-3 genetic variant rs12252-C is associated with severe 727 influenza in Chinese individuals

Interferon induction 729 of IFITM proteins promotes infection by human coronavirus OC43

Identification of Residues 732 Controlling Restriction versus Enhancing Activities of IFITM Proteins on Entry of Human 733 Coronaviruses

LY6E Restricts the Entry of 735 Human Coronaviruses, Including the Currently Pandemic SARS-CoV-2

Bat SARS-Like WIV1 coronavirus 738 uses the ACE2 of multiple animal species as receptor and evades IFITM3 restriction via 739 TMPRSS2 activation of membrane fusion

A pneumonia 742 outbreak associated with a new coronavirus of probable bat origin

The cAMP-responsive 745 element binding protein (CREB) transcription factor regulates furin expression during human 746 trophoblast syncytialization

A Novel Coronavirus 748 from Patients with Pneumonia in China

The S1/S2 boundary of SARS-751

CoV-2 spike protein modulates cell entry pathways and transmission. bioRxiv

Cells infected at an MOI of 0.1. Starting inoculum ratio shown on the left-hand 772 bar while proportions of virus as determined by deep sequencing at 72 hours post-inoculation 773 shown on the right. Virus titres determined by plaque assay at 72 hours post-inoculation 774 shown in superimposed white data points

Cells infected at an MOI of 0.1. Starting inoculum ratio shown at time 777 0, proportions of virus determined by deep sequencing. All time points taken from triplicate 778 repeats. Virus replication determined by plaque assay and shown as imposed white data 779 points

Head to head replication kinetics of clonal WT and ΔCS viruses in Calu-3 human lung cells

Cells infected at an MOI of 0.1. All time points taken from triplicate repeats. Virus replication 782 determined by plaque assay. Statistics determined by Student's t-test on log transformed 783 data

Entry of lentiviral pseudotypes (PV) containing different viral glycoproteins

Caco-2 (E) and Calu-3 (F) cells. Cells transduced with different PV and lysed 48 hours 786 later and analysed by firefly luciferase luminescence

Statistics determined by one-way ANOVA on Log-transformed data (after determining log 788 normality by the Shapiro-Wilk test and QQ plot

H) Relative entry of PV grown in the absence or presence of furin inhibitor

RVKR-CMK) into 293T-ACE2 (G) or Caco-2 (H) cells. Untreated PV normalised to an RLU of 1

Statistics determined by multiple t-tests. All assays performed in triplicate

The furin cleavage site of SARS-CoV-2 spike allows more efficient serine-protease 795 dependent entry into airway cells