key: cord-0977573-ofpna4k1
authors: Schubert, Katharina; Karousis, Evangelos D.; Jomaa, Ahmad; Scaiola, Alain; Echeverria, Blanca; Gurzeler, Lukas-Adrian; Leibundgut, Marc; Thiel, Volker; Mühlemann, Oliver; Ban, Nenad
title: SARS-CoV-2 Nsp1 binds ribosomal mRNA channel to inhibit translation
date: 2020-07-07
journal: bioRxiv
DOI: 10.1101/2020.07.07.191676
sha: 32c8941fd2c9c6d6e73934dca2012769c542bd49
doc_id: 977573
cord_uid: ofpna4k1

The non-structural protein 1 (Nsp1), also referred to as the host shutoff factor, is the first viral protein that is synthesized in SARS-CoV-2 infected human cells to suppress host innate immune functions1,2. By combining cryo-electron microscopy and biochemical experiments, we show that SARS-CoV-2 Nsp1 binds to the human 40S subunit in ribosomal complexes including the 43S pre-initiation complex. The protein inserts its C-terminal domain at the entrance to the mRNA channel where it interferes with mRNA binding. We observe potent translation inhibition in the presence of Nsp1 in lysates from human cells. Based on the high-resolution structure of the 40S-Nsp1 complex, we identify residues of Nsp1 crucial for mediating translation inhibition. We further show that the full-length 5’ untranslated region of the genomic viral mRNA stimulates translation in vitro, suggesting that SARS-CoV-2 combines inhibition of translation by Nsp1 with efficient translation of the viral mRNA to achieve expression of viral genes3.

specialized mechanisms to hijack the host gene expression machinery and employ cellular resources to regulate viral protein production. Such mechanisms are common for many viruses and include inhibition of host protein synthesis and endonucleolytic cleavage of host messenger RNAs (mRNAs) 1, 7 . In cells infected with the closely related SARS-CoV, one of the most enigmatic viral proteins is the host shutoff factor Nsp1. Nsp1 is encoded by the gene closest to the 5'-end of the viral genome and is among the first proteins to be expressed after cell entry and infection to repress multiple steps of host protein expression 2, 8, 9, 10 . Initial structural characterization of the isolated SARS-CoV Nsp1 protein revealed the structure of its N-terminal domain, whereas its C-terminal region was flexibly disordered 11 . Interestingly, SARS-CoV Nsp1 suppresses host innate immune functions, mainly by targeting type I interferon expression and antiviral signaling pathways 12 . Taken together, Nsp1 serves as a potential virulence factor for coronaviruses and represents an attractive target for live attenuated vaccine development 13, 14 .

To provide molecular insights into the mechanism of Nsp1-mediated translation inhibition, we solved the structures of ribosomal complexes isolated from HEK293 lysates supplemented with recombinant purified Nsp1 as well as of an in vitro reconstituted 40S-Nsp1 complex using cryo-EM. We complement our findings by reporting in vitro translation inhibition in the presence of Nsp1 that is relieved after mutating key interacting residues.

Furthermore, we show that the translation output of reporters containing full length viral 5΄UTRs is greatly enhanced, which could explain how Nsp1 inhibits global translation while still translating sufficient amounts of viral mRNAs.

To elucidate the mechanism of how Nsp1 inhibits translation, we aimed to identify the structures of potential ribosomal complexes as binding targets. Previously, it has been suggested that Nsp1 mainly targets the ribosome at the translation initiation step 10 .

Therefore, we treated lysed HEK293E with bacterially expressed and purified Nsp1 and loaded the cleared lysate on a sucrose gradient. Fractions containing ribosomal particles were then analyzed for the presence of Nsp1. Interestingly Nsp1 not only co-migrated with 40S particles, but also with 80S ribosomal complexes (Fig. 1a) , suggesting that it interacts with a range of different ribosomal states. We then pooled all sucrose gradient fractions containing ribosomal complexes and investigated them using cryo-EM. This analysis revealed a 43S pre-initiation complex (PIC) encompassing the initiation factor eIF3 core, eIF1, the ternary complex comprising eIF2 and initiator tRNAi with additional density in the mRNA entrance channel that could not be assigned to mRNA (Fig. 1b,c; Extended Data Fig. 1) . To unambiguously attribute this extra density to Nsp1, we assessed whether Nsp1 binds purified ribosomal 40S subunits alone. In vitro binding assays using sucrose density centrifugation showed that Nsp1 associates with 40S ribosomal subunits since it co-pelleted with the 40S (Fig. 1d) . However, Nsp1 did not interact with 60S subunits, suggesting that the interaction with 40S subunits is specific. Based on these results we assembled in vitro a 40S-Nsp1 complex and determined its structure at 2.8 Å resolution using cryo-EM (Extended Data Fig. 2 ). The molecular details revealed by these maps allowed us to identify the density as the C-terminal region of Nsp1 and build an atomic model. Docking of the model into the maps of the 43S PIC obtained from the HEK293E cell lysates clearly showed that the C-terminus of Nsp1 is also associated with the 43S PIC ( Fig. 1b; Extended Data Fig. 3 ). As observed in the high-resolution structure of the 40S-Nsp1 complex, the C-terminal part of Nsp1 in the mRNA entrance channel (Fig. 1e ) folds into two helices that interact with h18 of the 18S rRNA as well as proteins uS3 in the head and uS5 and eS30 in the body, respectively ( Fig. 1f; Fig. 2a ). In both complexes, Nsp1 binds in the mRNA entrance channel on the 40S subunit, where it would partially overlap with the fully accommodated mRNA. Consequently, mRNA was not observed due to Nsp1 binding.

The high-resolution reconstruction also revealed the network of molecular interactions between Nsp1 and the 40S subunit. The first C-terminal helix (residues 153-160) interacts with uS5 and uS3 through multiple hydrophobic side chains such as Y154, F157 and W161 (Fig. 2b) . The two helices are connected by a short loop containing the KH motif that establishes stacking interactions with helix h18 of the 18S rRNA through U607 and U630 as well as backbone binding (Fig. 2c) . The second helix (residues 166-178), localized in proximity of the eS30 C-terminus, interacts with the phosphate backbone of h18 via the two conserved arginines R171 and R175 (Fig. 2d ).

An additional weak density at the head of the small subunit in the proximity of eS10 between h16 and uS3 was observed. This may correspond to the flexibly disposed N-terminal domain of Nsp1 considering the 20 amino acid long unstructured linker between the N-and C-terminal domains (Fig. 2e, Extended Data Fig. 4 ). However, we cannot exclude that this density corresponds to unassigned ribosomal protein segments in the vicinity as the Cterminal 65 amino acids of eS10 (head) or the N-terminal 60 amino acids of uS5 (body) could become better ordered in the context of Nsp1 binding. Thus, it occurs that Nsp1 is tightly bound to the 40S subunit through anchoring of its C-terminal helices to the mRNA channel, while the N-terminal domain can sample space in the radius of approximately 60 Å from its attachment point.

Luciferase-encoding reporter mRNA (RLuc) in an S3 HeLa lysate in vitro translation system 15 ( Fig. 3d) . WT Nsp1 was recombinantly expressed and purified and its effect on translation was tested by adding increasing amounts of the protein to HeLa cell lysates containing capped and polyadenylated RLuc mRNA control transcript. We observed a concentration-dependent inhibition of translation where almost full inhibition was reached at 1 µM of Nsp1 (Fig. 3b) .

To dissect the contributions of the observed interactions between the 40S and Nsp1 on the inhibition of translation, we used our structural information to design several mutants targeting key amino acids in helix 1 (double mutant Y154A / F157A), the KH motif (double mutant K164A / H165A), and in helix 2 (double mutant R171E / R175E) as summarized in Fig. 3a . We also rationalized our mutations based on the high conservation of the Nsp1 Cterminus between SARS-CoV-2, SARS-CoV and closely related bat Coronaviridae, with sequence identities above 85% for the ORF1ab (encoding for polyproteins pp1a and pp1ab)

and key amino acids highly conserved ( Fig. 2e ; Extended Data Fig. 4) 16 . Furthermore, the KH mutant had been described to abolish interaction with 40S in SARS-CoV 12 . In contrast to the WT protein, the three mutants did not affect translation of the RLuc control mRNA, even at concentrations of 6 µM (Fig. 3b) . Consistently, the mutants lost their ability to bind 40S ribosomal subunits indicating that the C-terminal domain is primarily responsible for the affinity of Nsp1 for the ribosome (Fig. 3c) . These results also agree with our structural findings where the C-terminal domain of Nsp1 is responsible for specific contacts with the ribosome, whereas the N-terminal domain is flexibly disposed. Interestingly, this mRNA binding inhibition mechanism may be unique to SARS-CoV-2 and closely related beta-coronaviruses, since the C-terminal region of Nsp1 is shorter in alpha-coronaviruses and is not highly conserved amongst other beta-coronaviruses including MERS-CoV, the latter being consistent with the observation that MERS-CoV Nsp1 does not bind the ribosome 17 .

Since translation of viral mRNA competes with translation of cellular mRNAs, the inhibitory effects of Nsp1 in the context of special features of the SARS-CoV-2 genomic RNA need to be considered. Therefore, we investigated the differences in the translation of reporter mRNAs with viral vs. cellular 5´UTRs and the relative inhibitory effect of Nsp1. Using the in vitro translation system described above, we compared the translation efficiency of RLuc reporters harboring the full-length 5΄UTR of the SARS-CoV-2 genomic RNA (FL-RLuc) with the translation of equimolar amounts of a native RLuc reporter (Fig. 3d) . We observed a significant five-fold increase in translation when the reporter mRNA included the viral 5΄UTR, suggesting that the viral mRNA is more efficiently translated than host mRNAs (Fig. 3e) .

Nevertheless, titration of WT Nsp1 inhibited translation of both mRNAs, FL-RLuc and native RLuc, to the same extent (Fig. 3f ).

These findings, as well as evidence from SARS-CoV 9 , indicate that Nsp1 acts as a general inhibitor of translation initiation. Our structural data suggest that SARS-CoV-2 Nsp1 inhibits translation by sterically occluding the entrance region of the mRNA channel and interfering with binding of cellular mRNAs (Fig. 4a,b) . However, the question of how ribosomes in virus-infected cells are recruited to efficiently translate the viral mRNA remains open. Our results on the inhibitory mechanism of Nsp1 together with the translationstimulating features of the viral mRNA provide a possible explanation. First, Nsp1 will act as a strong inhibitor of translation that tightly binds ribosomes and reduces the pool of available ribosomes that can engage in translation. Under ribosome limiting conditions, translation from more efficient viral mRNA is then likely to be favored (Fig. 4c) . Therefore, the combination of an Nsp1-mediated general translation inhibition and an enhanced translation efficiency of viral transcripts appears to lead to an effective switch of translation from host cell mRNAs towards viral mRNAs.

Considering that Nsp1 can inhibit its own translation, the virus tunes cellular levels of Nsp1 exactly below the concentrations necessary to inhibit viral mRNA translation, but possibly enough to inhibit translation initiation from less efficiently recruited cellular mRNAs.

Through this mechanism, we propose that Nsp1 would be able to inhibit global cellular translation particularly for mRNAs responsible for the host innate immune response, while the remaining ribosomes would still be able to translate viral mRNAs with high efficiency. During the course of viral infection, the effect of viral mRNAs on shifting protein synthesis machinery towards production of viral proteins would be increasingly strong since their levels are known to increase to 50% of total cellular RNAs 3 .

The identification of the C-terminal region of Nsp1 as the key domain for ribosome interactions that are essential for controlling cellular response to viral infections will be helpful in designing attenuated strains of SARS-CoV-2 for vaccine development. Furthermore, these results provide an excellent basis for structure-based experiments aimed at investigating Nsp1 function in vivo by using viral model systems. (a) Sucrose gradient fractionation of HEK lysate supplemented with Nsp1. Nsp1 co-migrates with 40S and 80S ribosomal particles in a 15-45% (w/v) sucrose gradient. His6-tagged Nsp1 is visualized by Western blot using an α-His antibody, while the rRNA content in corresponding fractions is monitored on an agarose gel. All samples for the Western blot derive from the same experiment and the blots were processed in parallel. (b-c) Overview of Nsp1 (red) binding to a 43S PIC containing the core of initiation factor eIF3 (cyan), eIF1 (blue) and the eIF2-tRNA ternary complex (magenta). (d) In the in vitro binding assay, WT Nsp1 was added to 40S and 60S ribosomal SU and loaded on a 30% (w/v) sucrose cushion. Unbound proteins remained in the supernatant (SN), while bound Nsp1 co-pelleted with 40S (P). (e) Overview of Nsp1 binding to the small ribosomal subunit. Nsp1 (red) binds close to the mRNA entry site and contacts uS3 (blue) from the ribosomal 40S head as well as uS5 (green), the C-terminus of uS30 (orange) and h18 of the 18S rRNA (grey) of the 40S body. 

Human ribosomal subunits were purified as described 18 , and final samples were flash-frozen in liquid nitrogen at a concentration of 1 mg/ml (OD600 of 10) and stored at -80 °C.

To verify Nsp1-40S complex formation, we performed binding assays using sucrose density centrifugation. Thawed human 40S and 60S ribosomal subunits were adjusted to a final and that had been treated with the same enzymes. The 223 nt-long 5΄UTR of SARS-CoV genomic mRNA sequence was subcloned to replace the RLuc 5' UTR by fusion PCR using primers TCTGCAGAATTCGCCCTTCATG and GCCCTATAGTGAGTCGTATTACAATTCACT for vector amplification and the pair GACTCACTATAGGGCAACTTTAAAATCTGTGTGGCTGTCACT and GGCGAATTCTGCAGACTTACCTTTCGGTCACACCCG for amplification of the 5΄UTR fragment using 5'UTR-eGFP cloned in pUC19 vector as a template, which was designed to possess the SARS-CoV-2 5'UTR sequence in front of the eGFP coding sequence.

Preparation of in vitro transcribed mRNAs was performed as described 15 Capping buffer (New England Biolabs). The capping reaction was carried out at 37 °C for 1 h and quenched by the addition of acidic P.C.I., followed by RNA purification. Finally, the integrity of the capped mRNAs was verified by agarose gel electrophoresis.

HeLa S3 lysates were prepared similarly as described before 15 . Briefly, lysates were prepared from S3 HeLa cell cultures grown to a cell density ranging from 1-2x10 6 

In vitro translation reactions were performed similarly as described before 15 Additionally, before precipitation, samples were taken for analysis on agarose gels (0.06% bleach, 1% (w/v) agarose).

Quantifoil For each sample, one grid was selected for data collection using a Titan Krios cryo-transmission electron microscope (Thermo Fisher Scientific) operating at 300 kV and equipped with either a Falcon3EC camera (Thermo Fisher Scientific) in integration mode or a K3 camera (Gatan), which was run in counting and super-resolution mode, mounted to a GIF Quantum LS operated with an energy filter slit width of 20 eV. The Falcon3EC datasets were collected at a nominal magnification of 75'000 x (pixel size of 1.08 Å/pixel), while for the K3 datasets a nominal magnification of 81'000x was used (physical pixel size of 1.08 Å/pixel, which corresponds to a super-resolution pixel size of 0.54 Å/pixel). For counting mode, illumination conditions were adjusted to an exposure rate of 24 e -/pixel/second. Micrographs were recorded as movie stacks at an electron dose of ~60 e -/Å 2 applied over 40 frames. For both datasets, the defocus was varied from approximately -1 to -3 μm.

The stacks of frames were first aligned to correct for motion during exposure, dose-weighted and gain-corrected using MotionCor2 19 (2019)). In short, the particle set was first cleaned from the preferentially oriented particles based on their orientation parameters, which reduced the particle set to 700'459 particles.

Those particles were then further classified for their quality and for the presence of Nsp1 using a focused 3D classification approach. The final set of particle images was refined using a global 3D refinement. To further improve the local resolution of the 40S-Nsp1 complex, masks around the 40S head and body were generated using UCSF Chimera 24 by creating a mask which was extended by 10 Å around a fitted model of the 40S subunit. Those masks were used for a multi-body refinement in Relion3.1 25 . Finally, the two focused maps were combined to generate a composite 3D map of the entire in vitro reconstituted 40S-Nsp1 complex.

For the HEK cell extract, after 2D classifications, ab initio reconstruction was performed in cryoSPARC2 23 , and the determined volumes were used as starting references for a heterogeneous refinement in cryoSPARC2 (Extended Data Fig. 1 ). The 80'101 particle images corresponding to the 40S ribosomal subunit were selected for a further round of heterogeneous refinement in cryoSPARC2, which resolved a density corresponding to initiation factor eIF3 in a fraction of the particles. To improve the occupancy of eIF3, particle images belonging to the 40S subunit class were then subjected to a focused 3D classification in Relion3.1 using a circular mask on the eIF3 region. The 3D class depicting the best density for eIF3 was selected (8'000 particle images) and was then used for a global 3D refinement.

To further improve the resolution of the Nsp1-bound region, a focused refinement was done using a mask on the body of the 40S subunit.

For building of the 40S-Nsp1 complex, the head and body of PDB 5oa3 18 were docked as rigid bodies into the 2.8 Å head and body maps that were obtained by focused classification (Extended Data Fig. 2 ). The structures were adjusted manually into the high-resolution maps using COOT 26 , and the C-terminus of Nsp1 (residues 148-180), which was well-resolved in the map of the 40S body, was built de novo. The coordinates were subjected to 5 cycles of real space refinement using PHENIX 1.18 27 . To stabilize the refinement in less well-resolved peripheral areas, protein secondary structure and Ramachandran as well as RNA base pair restrains were applied. Remaining discrepancies between models and maps as well as missing Mg 2+ ions were detected using real space difference maps, and after model completion the coordinates were refined for two additional cycles. The resulting final models have excellent geometries and correlations between the maps and models (Table 1 , Extended Data Fig. 2 ).

The structures were validated using MOLPROBITY 28 and by comparison of the model vs. map

FSCs at values of 0.5, which coincided well with the FSCs between the half-sets of the EM reconstruction using the FSC=1.43 criterion (Extended Data Fig. 2 ).

To assemble the full 40S-Nsp1 complex, both refined structures were docked into a 2.8 Å chimeric map comprising the complete 40S-Nsp1. After readjustment of the head-to-body connections, the complete model was subjected to two additional rounds of real space refinement as described above.

The 5.9 Å and 4.3 Å maps of the Nsp1-43S PIC shown in Extended Data Fig. 1 and 3 

The high-resolution cryo-EM maps of the complete 40S-Nsp1 complex, the 40S body and the 

Viral and Cellular mRNA Translation in Coronavirus-Infected Cells

Severe acute respiratory syndrome coronavirus nsp1 protein suppresses host gene expression by promoting host mRNA degradation

The Architecture of SARS-CoV-2 Transcriptome

The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2

Human Coronaviruses: A Review of Virus-Host Interactions

Identification and Characterization of Severe Acute Respiratory Syndrome Coronavirus Replicase Proteins

Mechanisms and enzymes involved in SARS coronavirus genome expression

A two-pronged strategy to suppress host protein synthesis by SARS coronavirus Nsp1 protein

SARS coronavirus nsp1 protein induces template-dependent endonucleolytic cleavage of mRNAs: Viral mRNAs are resistant to nsp1-induced RNA cleavage

Severe Acute Respiratory Syndrome Coronavirus Protein nsp1 Is a Novel Eukaryotic Translation Inhibitor That Represses Multiple Steps of Translation Initiation

Novel β-Barrel Fold in the Nuclear Magnetic Resonance Structure of the Replicase Nonstructural Protein 1 from the Severe Acute Respiratory Syndrome Coronavirus

Severe Acute Respiratory Syndrome Coronavirus nsp1 Suppresses Host Gene Expression, Including That of Type I Interferon, in Infected Cells

Severe Acute Respiratory Syndrome Coronavirus Evades Antiviral Signaling: Role of nsp1 and Rational Design of an Attenuated Strain

Coronavirus non-structural protein 1 is a major pathogenicity factor: Implications for the rational design of coronavirus vaccines

Human NMD ensues independently of stable ribosome stalling

Genomic variance of the 2019-nCoV coronavirus

Middle East Respiratory Syndrome Coronavirus nsp1 Inhibits Host Gene Expression by Selectively Targeting mRNAs Transcribed in the Nucleus while Sparing mRNAs of Cytoplasmic Origin

Structural and Functional Insights into Human Re-initiation Complexes

MotionCor2: Anisotropic correction of beam-induced motion for improved cryo-electron microscopy

Gctf: Real-time CTF determination and correction

New tools for automated high-resolution cryo-EM structure determination in RELION-3

Prevention of overfitting in cryo-EM structure determination

Algorithms for rapid unsupervised cryo-EM structure determination

Integrated Tools for Structural and Sequence Alignment and Analysis

Characterisation of molecular motions in cryo-EM single-particle data by multi-body refinement in RELION

Features and development of Coot

Macromolecular structure determination using X-rays, neutrons and electrons: Recent developments in Phenix

MolProbity: All-atom structure validation for macromolecular crystallography

Structural Insights into the Mammalian Late-Stage Initiation Complexes

The Phyre2 web portal for protein modeling, prediction and analysis

Conformational Differences between Open and Closed States of the Eukaryotic Translation Initiation Complex

Structure and interactions of the translation initiation factor eIF1

Deciphering key features in protein structures with the new ENDscript server

We thank the ETH Scientific center for optical and electron microscopy (ScopeM) and the CryoEM Knowledge hub (CEMK), in particular D. Böhringer, for technical support and the opportunity to continue our work in spite of the ETH lockdown due to the COVID-19 pandemic.We thank the Functional Genomics Center Zurich (FGCZ) for the help with mass-spectrometry.The authors would like to thank their teams for the support in the lab, and especially to M. Jia, P. Bhatt and D. Yudin for creating a productive working atmosphere. 

NB and KS initiated the project and designed the experiments. KS expressed proteins, together with BE, and prepared samples for cryo-EM. KS, AJ and AS prepared grids, carried out data collection and processing. EDK and OM designed translation experiments, EDK and LG were involved in cloning and EDK performed in vitro translation reactions, with the help of LG. KS and BE performed sucrose binding assays.ML was involved in structure modelling and refinement as well as in figure preparation. NB and KS coordinated the project. All authors contributed to the final version of the manuscript.

The authors declare no competing interests.

Extended Data Figure 1 : Data processing of the HEK cell extract cryo-EM dataset.Scheme for the processing of the HEK cell extract sample. Local resolution estimates are plotted as heat map on the final volume accompanied with a slice through the volume. The half map vs. half map FSC curves are shown for the overall refinement (purple) and the refinement focused on the body (blue). Figure 2 : Data processing of the in vitro reconstituted 40S-Nsp1 cryo-EM dataset.

Scheme of the processing steps performed for the sample of the in vitro binding experiment. The local resolution distribution is plotted on the final volumes as heat map, together with additional slices through the volumes. The half map vs. half map FSC curves are plotted for the overall refinement (purple), the refinement focused on the body (blue), on the head (cyan), as well as for the composite map (green). The map vs. model FSCs are plotted for the body (yellow) and the head (orange) in their respective focused maps, as well as for the full 40S in the composite map (red). Nsp1 sequences of human SARS-CoV, human SARS-CoV-2 and SARS-related bat coronaviruses 16 were obtained from the UNIPROT (www.uniprot.org) and GenBank (www.ncbi.nlm.nih.gov/genbank) databases. The sequences were aligned using Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo). The alignment was visualized with ESPript 33 . Note that sequences of MERS Nsp1 and other human coronaviruses were not included in the alignment due to lack of sequence homology. For displaying the secondary structure, the atomic coordinates of the SARS-CoV Nsp1 N-terminus (pdb 2HSX) 11 and of the Nsp1 C-terminus (this publication) were combined. Regions of known structure are highlighted with blue (N-terminal domain) and red (C-terminal domain) bars. Unresolved regions are indicated by dotted lines, including the ~60 Å unstructured linker (black) and the N-terminus (blue). Double mutations analyzed in this study are shown as asterisks in different colors. 

Sugar pucker outliers (%):