key: cord-0975574-pouynrd5
authors: Yu, Xiao; Sun, Xiaodong; Cui, Peng; Pan, Hao; Lin, Sheng; Han, Ruobing; Jiang, Chenyan; Fang, Qiwen; Kong, Dechuan; Zhu, Yiyi; Zheng, Yaxu; Gong, Xiaohuan; Xiao, Wenjia; Mao, Shenghua; Jin, Bihong; Wu, Huanyu; Fu, Chen
title: Epidemiological and clinical characteristics of 333 confirmed cases with coronavirus disease 2019 in Shanghai, China
date: 2020-05-13
journal: Transbound Emerg Dis
DOI: 10.1111/tbed.13604
sha: 8f56db944dc1d208f31e2f1fab1b9b87fb3e38f5
doc_id: 975574
cord_uid: pouynrd5

Coronavirus disease 2019 (COVID‐19) is an emerging infectious disease first identified in Wuhan City, Hubei Province, China. As of 19 February 2020, there had been 333 confirmed cases reported in Shanghai, China. This study elaborates on the epidemiological and clinical characteristics of COVID‐19 based on a descriptive study of the 333 patients infected with COVID‐19 in Shanghai for the purpose of probing into this new disease and providing reference. Among the 333 confirmed cases in Shanghai, 172 (51.7%) were males and 161 (48.3%) were females, with a median age of 50 years. 299 (89.8%) cases presented mild symptoms. 139 (41.7%) and 111 (33.3%) cases were infected in Wuhan and Shanghai, respectively. 148 (44.4%) cases once had contact with confirmed cases before onset, while 103 (30.9%) cases had never contacted confirmed cases but they had a sojourn history in Wuhan. The onset date of the first case in Shanghai was 28 December, with the peak appearing on 27 January. The median incubation period of COVID‐19 was estimated to be 7.2 days. 207 (62.2%) cases had fever symptoms at the onset, whereas 273 (82.0%) cases experienced fever before hospitalization. 56 (18.6%) adults experienced a decrease in white blood cell and 84 (42.9%) had increased C‐reactive protein after onset. Elderly, male and heart disease history were risk factors for severe or critical pneumonia. These findings suggest that most cases experienced fever symptoms and had mild pneumonia. Strengthening the health management of elderly men, especially those with underlying diseases, may help reduce the incidence of severe and critical pneumonia. Time intervals from onset to visit, hospitalization and diagnosis confirmed were all shortened after Shanghai's first‐level public health emergency response. Shanghai's experience proves that COVID‐19 can be controlled well in megacities.

Since early December, 2019, China has been experiencing an outbreak of coronavirus disease 2019 , which is caused by a new coronavirus and first reported in Wuhan, Hubei Province (Zhu et al., 2020) . This new virus has been proved to be capable of human-to-human transmission (Chan et al., 2020a; Li et al., 2020; Riou & Althaus, 2020) . Entering January 2020, imported and local infections successively appeared in Shanghai (Cai et al., 2020) . In order to control the spread of COVID-19, Shanghai Municipal People's Government launched a public health firstlevel response on 24 January 2020 (Shanghai Municipal People's Government, 2020). By 19 February 2020, there had been 333 confirmed cases in Shanghai.

Recent studies have revealed characteristics of early transmission and clinical course of COVID-19 Huang et al., 2020; Li et al., 2020; Wang, Yuan, et al., 2020; Young et al., 2020) . Due to the differences in susceptible populations, exposure environments, virus virulence and management mechanisms, characteristics of the disease may vary among different cities, especially in Shanghai, a megacity with a highly mobile population and the highest ageing rate in China (Shanghai Municipal Statistics Bureau, 2018) . Besides, the results of Shanghai's prevention and control work reflected in these data may provide references for other megacities for the prevention and control of COVID-19. Here, we provide an analysis of the data on 333 confirmed cases to describe the epidemiological and clinical characteristics of COVID-19 in Shanghai.

We conducted a descriptive study of all the 333 confirmed COVID-19 cases reported in Shanghai in the case reporting system as of February 19th, 2020.

All the cases were tested positive for COVID-19 in the laboratory and were diagnosed by clinical experts according to the 5th Diagnosis and Treatment Plan (China Medical Administration, 2020). Suspected cases were clinically diagnosed based on symptoms and exposure history, and confirmed cases were those suspected cases with positive results for viral nucleic acid test. The severity of symptoms of COVID-19 is divided into non-pneumonia, mild, severe and critical pneumonia.

'Severe' refers to dyspnoea, and respiratory rate ≥ 30/min, blood oxygen saturation ≤ 93%, PaO 2 / FiO 2 ratio ≤ 300 mmHg; "critically ill" refers to those cases that present with respiratory failure, or septic shock, or multiple organ dysfunction/ failure (China Medical Administration, 2020). We used clinical severity of all patients reported in the case reporting system as of 19 February 2020.

After cases were reported to Center for Disease Control and Prevention in Shanghai (CDC), field investigation was taken within 24 hr and an epidemiological investigation report was formed. The epidemiological investigation report includes (a) basic demographic information; (b) onset, diagnosis and treatment process; (c) suspicious exposure history within 2 weeks before onset; (d) experts' diagnosis opinions; (e) laboratory results; and (f) prevention and control measures.

Specific information in epidemiological investigation reports was extracted and entered into a database built with Epidata software (Epidata Association). All personally identifiable information was removed during analysis. 

Continuous variables were expressed as medians and interquartile ranges (IQR) and compared by using Wilcoxon rank-sum tests. Categorical variables were summarized as counts and percentages in each category and compared by using chi-square and Fisher's exact tests. All missing data were not imputed or analysed. Multivariate logistic regression analysis was used to analyse the risk factors for severe/critical illness, and variables with p < .2 in univariate analysis were included.

The incubation period was calculated according to three different exposure histories (Backer, Klinkenberg, & Wallinga, 2020; Donnelly et al., 2003; Goh et al., 2006) 

This study was reviewed and approved by Shanghai Municipal CDC Ethics Review Committee.

As shown in Table 1 , of all the 333 confirmed cases, the ratio between male (172, 51.7%) and female (161, 48.3%) was 1.07:1, the median age was 50 years (IQR, 35 to 63; Range 0 to 88 years). Patients aged 15-45 years (138, 41.4%) and above 60 years (107, 32.1%) accounted for a relatively large amount. As for body mass index (BMI), 19 (5.7%) cases were underweight and 145 (43.5%) cases were overweight. 101(30.3%) cases were retired people, and 4 (1.2%) cases were healthcare workers (Only one of them was infected in medical process). 107 (32.1) cases had anamnesis. 24 (7.4%) cases had a smoking history, and 78 (24.1%) cases had an alcohol history. Most cases (299, 89.8%) had mild pneumonia.

As of 19 February 2020, 2 cases died of COVID-19 and the mortality rate of this disease in Shanghai was 0.06%. One of the dead was an 88-year-old man with hypertension, heart disease and chronic 

As shown in Figure 1 , the onset date of Shanghai's first case was 28

December 2019, with the peak was arriving on 27 January 2020.

Also, the incidence peak of people infected in Wuhan appeared on 27 January 2020. The number of patients infected in Shanghai gradually increased from 12 January 2020, reaching the peak on 2 February. From 7 February 2020, no cases reported in Shanghai were infected in Wuhan.

Of all the 333 confirmed cases, 242 (72.7%) cases currently live in Shanghai. 3 cases had onset symptoms before 14 January 2020 (stage 1), 74 cases before 24 January 2020 (stage 2), 216 cases before 4 February 2020 (stage 3) and 242 cases before 19 February 2020 (stage 4) ( Figure 2 ). In the above stated four stages, the number of streets or towns with confirmed cases was 4, 49, 94 and 101, respectively ( Figure 2 ).

There were 64 cases with a travel history in Wuhan, and the median incubation period was 7.8 days (IQR, 5.0 to 8.2 days; range, 0.5 to 20 days). The gamma distribution fit indicated that the estimated median incubation period was 7.2 days (95% confidence interval [CI], 6.1 to 8.4 days) (Figure 3a ).

57 cases had multiple exposures to confirmed cases, and the median incubation period was 7.5 days (IQR, 5.0 to 7.9 days; range, 0.5 to 23 days). As shown in the gamma distribution, the estimated median incubation period was 7.0 days (95% CI, 5.9 to 8.1 days) (Figure 3a ).

11 cases had single exposure to confirmed cases, and the median incubation period was 9.0 days (IQR, 5.0 to 8.0 days; range, 1 to 14 days). As demonstrated in the gamma distribution, the estimated median incubation period was 7.5 days (95% CI, 4.4 to11.8 days)

( Figure 3a ).

We pooled all the 132 cases together to fit the gamma distribution, and the results showed that the estimated median incubation period was 7.2 days (95% CI, 6.4 to 7.9 days), and with the 95th, 99th

percentile of the distribution was 16.0 and 20.4 days, respectively ( Figure 3b ).

F I G U R E 1 Epidemic curve of 333 confirmed COVID-19 cases infected in different areas (Wuhan, Shanghai, other areas)

As shown in Table 2 , overall, median onset visit interval of patients was 1.0 days (IQR, 0.0 to 4.0 days) and became shorter after 24

January. Median onset hospitalization interval and onset diagnosis-confirmed interval was 3.0 (IQR, 1.0 to 6.0) and 5.0 days (IQR, 3.0 to 8.0 days), respectively. Also, onset hospitalization interval and onset diagnosis-confirmed interval were all shorter after 24 January.

207 (62.2%) cases had fever, 106 (31.8%) had cough, and 40 (12.0%) had fatigue symptoms at the onset (Table 3) .

From onset to hospitalization, the most common symptom was still fever (82.0%), followed by dry cough (41.1%) and fatigue (15.0%).

Respectively, 123 (37.0%) cases experienced fever with other symptoms at the onset, and 199 (59.8%) had fever and other symptoms from onset to hospitalization. The most common combination of symptoms at the onset and from onset to hospitalization was fever with dry cough, fever with fatigue and fever with myalgia. From onset to hospitalization, the median peak temperature in cases with fever symptoms was 38.0°C (IQR, 37.7 to 38.5°C) ( Table 3) .

Of the cases with the first blood routine after the onset, 56

(18.6%) adults showed a decrease in white blood cell count, 1 (0.7%) had an increase in white blood cell count, with statistical difference between female and male. 84 (42.9%) cases had increased C-reactive protein ( 

307 cases had non-or mild pneumonia, and 26 had severe or critical pneumonia. Univariate analysis showed that older age groups, men and anamnesis especially heart disease were risk factors for severe or critical illness (Table 5 ). In multivariate analysis, for each increase in the age group, the risk of severe/ critical illness increased by 4.33 times; the risk of severe/ critical illness for men was 4.56

times that of women. The risk of severe/ critical illness in people with heart disease was 4.17 times that of people without heart disease (Table 6) .

Seen from the perspective of the infected areas, the cases in Shanghai were mainly imported. However, due to the nature of human-to-human transmission, the number of patients infected in Shanghai had gradually increased, which indicates that the COVID-19 has a strong ability to transmit between humans. In order to control the disease, were infected by their family members and all children cases had mild symptoms (7 non-pneumonia, 3 mild pneumonia). In concert with other research , children cases account for only a small ratio of all age groups in Shanghai and had milder symptoms, but the reasons remain unclear. Considering that some studies suggest that the expression of the receptor for COVID-19, which was currently regarded as angiotensin-converting enzyme 2 (ACE2) , is not lower in children compared to that in adults (Xie, Chen, Wang, Zhang, & Liu, 2006) , we suspect that fewer trips and less socializing in children lead to the lower morbidity, or simply because symptoms in children are

Before 24 January (include 24 January) There are two facts worth discussing about the exposure history. One was that 103 cases had sojourned Wuhan without contacting confirmed cases and the other one was that 21 cases contacted people sojourning in Hubei but not confirmed cases.

In our investigation, most of these patients did not even notice that people they contacted had symptoms like fever or cough.

Mahase E pointed out that many asymptomatic or mildly infected people may scatter in the community as sources of infection (Mahase, 2020) . And a familial cluster analysis indicated that patients in the incubation period may also be contagious (Chan et al., 2020b) . Our investigation supported their opinions that asymptomatic and latent infections may become the focus of further prevention and control.

In our calculation, cases with single exposure to confirmed cases had a longer median incubation period (9.0 days) than those with a travel history in Wuhan (7.8 days) and multiple exposures to confirmed cases (7.5 days). This may be attributed to the greater amounts of pathogens that the patients were exposed to on account of the prolonged or multiple exposures. After pooling data and fitting gamma distribution, we estimated that the median incubation period was 7.2 days. However, our results showed a difference from other researches (Backer et al., 2020; Guan et al., 2020; Ki & nCo, 2020; Li et al., 2020) , of which the median incubation period ranged from 3.0 to 6.4 days. Most articles did not announce their calculation methods, and the cases used to calculate in these articles were mainly travellers (Backer et al., 2020; Ki & nCo, 2020; Li et al., 2020) .

It is possible that the authors of these articles directly subtracted the date of travellers' departure from the date of onset when cal- However, though some of the patients (37.8%) did not have fever at onset, most patients (82.0%) indeed experienced fever from onset to hospitalization. This suggests that screening patients for fever symptoms is relatively effective. In our study, we found that most patients had normal white blood cell count, neutrophil and lymphocyte level, but 42.9% of the adults' cases experienced an increasing C-reactive protein in their TA B L E 4 First blood routine after onset of Adults (n = 323) and Children (n = 10) b Normal range of white blood cell is 4.0-10.0 × 10 9 /L, except 6.0 ~ 15.0 × *10 9 /L in child aged 6 month to 6 years; normal range of neutrophil is 1.5 ~ 7.5 × 10 9 /L; normal range of lymphocyte is 0.8 ~ 4.0 × 10 9 /L; normal range of C-reactive protein is 10 mg/L or less. c All the missing data were not included in the statistical test.

first blood routine after onset (Table 4) , which was consistent with other researches (Singhal, 2020) . Though elevated C-reactive protein is not ex- , and its expression in men is higher than that in women , which may be the reason for the higher proportion of men with severe illness. People with heart disease or in older age groups tend to be more severely ill, perhaps because their immune systems are weak.

Considering these risk factors for severe/critical illness, it is understandable that two fatal cases in Shanghai both had an old age and suffered from underlying diseases (one patient had heart disease).

Interestingly, smoking is not associated with the severity of the disease, and that may be due to the levels of ACE2 are lower in smokers (Wan, Shang, Graham, Baric, & Li, 2020) . This discovery was not consistent with the study of Liu W et.al (Liu et al., 2020) , but in concert with a meta-analysis (Lippi & Henry, 2020) . However, diabetes and hypertension are to a certain extent associated with diseases severity, but there is no statistical significance. However, they are risk factors for severe symptoms in other studies (Fang, Karakiulakis, & Roth, 2020) , and our sample size may be limited to finding a statistical significance.

This study has several limitations. First, some cases have incomplete documentation of smoking history, alcohol history and clinical features. Second, our sample size is limited, especially for sever or critical patients, which may lead to some meaningful results being ignored.

In summary, the prevention and control measures in Shanghai are effective. Most patients have mild symptoms and experience fever.

Elderly, male and heart disease history is the risk factors for severe or critical pneumonia. It is necessary to strengthen the health management of these groups.

Publication was funded by Natural Science Foundation of Shanghai (Grant No. 20411950100) . We thank all medical workers taking part in investigation and treatment of COVID-19 patients in Shanghai.

All authors declare no competing interests. 

The data that support the findings of this study are available from the corresponding author upon reasonable request. sex(female = 1, male = 2),female was used as the reference; heart disease, diabetes, high blood pressure, respiratory disease(no = 1, yes = 2), the status no was used as the reference.

TA B L E 6 Multivariate analysis of clinical severity risk factors Zhu, N., Zhang, D., Wang, W., Li, X., Yang, B., Song, J., … Tan, W. (2020 

ORF1ab: forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; probe 5′-FAM-CCGTCTGCGG TATGTGGAAAGGTTATGG-BHQ1-3′.

N: forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; probe 5′-FAM-TTGCTGC TGCTTGACAGATT-TAMRA-3′.

Incubation period of 2019 novel coronavirus (2019-nCoV) infections among travellers from Wuhan

First case of 2019 novel coronavirus infection in children in Shanghai

A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: A study of a family cluster

Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study

Notice of the General Office of the National Health and Health Commission on Issuing a New Coronavirus Pneumonia Prevention and Control Plan

Viral etiology in adult influenza-like illness/ acute respiratory infection and predictivity of C-reactive protein

Epidemiological determinants of spread of causal agent of severe acute respiratory syndrome in Hong Kong

Clinical characteristics of fatalities due to influenza A (H1N1) virus in Mexico

Are patients with hypertension and diabetes mellitus at increased risk for COVID-19 infection?

Epidemiology and control of SARS in Singapore

Clinical characteristics of 2019 novel coronavirus infection in China. medRxiv

Coronavirus Disease 2019 (COVID-19) Daily DataSummary

Clinical features of patients infected with 2019 novel coronavirus in Wuhan

Epidemiologic characteristics of early cases with 2019 novel coronavirus (2019-nCoV) disease in Republic of Korea

Early transmission dynamics in Wuhan, China, of novel coronavirus-infected pneumonia

Active smoking is not associated with severity of coronavirus disease 2019 (COVID-19)

Analysis of factors associated with disease outcomes in hospitalized patients with 2019 novel coronavirus disease

China coronavirus: Mild but infectious cases may make it hard to control outbreak, report warns

Clinical characteristics of influenza in season

The epidemiological characteristics of an outbreak of 2019 novel coronavirus diseases (COVID-19) in China

Pattern of early human-to-human transmission of Wuhan

Shanghai launched a first-level response to resolutely curb the spread of the epidemic

Status and Prediction of Population Aging in Shanghai

Differences in the epidemiological characteristics and clinical outcomes of pandemic (H1N1) 2009 influenza, compared with seasonal influenza

A review of coronavirus disease-2019 (COVID-19)

Characteristics of COVID-19 infection in Beijing

Receptor recognition by the novel coronavirus from Wuhan: An analysis based on decade-long structural studies of SARS coronavirus

Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan

Clinical and epidemiological characteristics of 34 children with

Clinical characteristics and therapeutic procedure for four cases with 2019 novel coronavirus pneumonia receiving combined Chinese and Western medicine treatment

Age-and gender-related difference of ACE2 expression in rat lung

Epidemiologic features and clinical course of patients infected with SARS-CoV-2 in Singapore

Single-cell RNA expression profiling of ACE2, the putative receptor of Wuhan 2019-nCov

Discovery of a novel coronavirus associated with the recent pneumonia outbreak in humans and its potential bat origin