key: cord-0971567-ppquta0q
authors: Wei, Baojun; Wei, Yuxiang; Zhang, Kuo; Yang, Changmei; Wang, Jing; Xu, Ruihuan; Zhan, Sien; Lin, Guigao; Wang, Wei; Liu, Min; Wang, Lunan; Zhang, Rui; Li, Jinming
title: Construction of Armored RNA Containing Long-Size Chimeric RNA by Increasing the Number and Affinity of the Pac Site in Exogenous RNA and Sequence Coding Coat Protein of the MS2 Bacteriophage
date: 2008-07-01
journal: Intervirology
DOI: 10.1159/000141707
sha: 040014a46da8e6af9ebee173c762de46b180fca9
doc_id: 971567
cord_uid: ppquta0q

OBJECTIVES: To construct a one-plasmid expression system of the armored RNA containing long chimeric RNA byincreasing the number and affinity of the pac site. METHODS: The plasmid pET-MS2-pac was constructedwith one C-variant pac site, and then the plasmid pM-CR-2C containing 1,891-bp chimeric sequences and two C-variant pac sites was produced. Meanwhile, three plasmids (pM-CR-C, pM-CR-2W and pM-CR-W) were obtained as parallel controls with a different number and affinity of the pac site. Finally, the armored RNA was expressed and purified. RESULTS: The armored RNA with 1,891 bases target RNA was expressed successfully by the one-plasmid expression system with two C-variant pac sites, while for one pac site, no matter whether the affinity was changed or not, only the 1,200 bases target RNA was packaged. It was also found that the C-variant pac site could increase the expression efficiency of the armored RNA. The armored RNA with 1,891-bp exogenous RNA in our study showed the characterization of ribonuclease resistance and stability at different time points and temperature conditions. CONCLUSIONS: The armored RNA with 1,891 bases exogenous RNA was constructed and the expression system can be used as a platform for preparation of the armored RNA containing long RNA sequences.

specific 19-nucleotide stem-loop region ( pac site , see fig. 1 a) located at the 5 terminus of the MS2 bacteriophage replicase gene [6] .

Theoretically, at least 2,000 bases of exogenous RNA sequence might be packaged into coat protein shell; however, the efficiency of packaging decreased quickly as the size of the RNA increased beyond 500 bases [4, 7, 8] . So far, the largest size of RNA packaged was 1,200 bases by utilizing one wild-type pac site [9] , but it could not meet the needs of detecting a variety of viral genomes and the comparison of different clinical laboratory data [7] .

It has been identified that the nucleotides at only a few positions of the pac site , the loop residues A-4, U-5, and A-7 and bulge A-4 position, are important for package [10, 11] , and even these key recognition sites can be varied. For example, substitution of U-5 with C (C-variant, fig. 1 b) yields a significantly higher affinity for coat protein than wild-type pac site in vitro [12] [13] [14] [15] [16] . It has also been confirmed that the presence of a second pac site permits the cooperative binding of the coat protein dimer to the RNA and results in a higher affinity compared with a single pac site [17, 18] . Recently, Wei et al. [19] successfully used armored RNA technology to package 2,248 bases exogenous RNA sequences by a two-plasmid coexpression system with the C-variant pac site.

In order to explore whether the armored RNA could package exogenous RNA longer than 1,200 bases by a one-plasmid expression system by increasing the number and affinity of the pac site , we constructed 1,891 bases chimeric RNA sequences that included three fragments of SARS-CoV, one fragment of HCV, one C-variant pac site and one fragment of H5N1, and then inserted them into the plasmid pET-MS2-pac containing one C-variant pac site to form a two pac sites expression system, namely, pM-CR-2C. Meanwhile, three expression plasmids (pM-CR-C, pM-CR-W and pM-CR-2W) with a different number and affinity of the pac site were constructed as parallel controls.

The fragment encoding MS2 maturase and coat protein was obtained from the plasmid pMS 27 (kindly provided by D.S. Peabody) by PCR using the following primer pairs: 5 -CG GGATCC T-GGCTATCGCTGTAGGTAGCC-3 and 5 -AAGGAAAAAA GC-GGCCGC ACATGGGTGATCCTCATGTA TGGCCGGCGTC-TATTAGTAG-3 . The underlined sequences were BamH and Notl restriction enzyme sites, respectively, and the bold was the C-variant pac site . The amplified products were inserted into pET28(b) vector (Novagen, USA) to generate the recombinant plasmid pET-MS2-pac . The positive constructions were verified by sequencing.

The chimeric sequences with one C-variant pac site containing five fragments (totally 1,891 bp) were composed of SARS-CoV1 (nt 15224-15618, GenBank accession No. AY864806), SARS-CoV2 (nt 18038-18340, GenBank accession No. AY864806), SARS-CoV3 (nt 28110-28692, GenBank accession No. AY864806), HCV-5 -UTR (nt 18-310, GenBank accession No. AF139594) and H5N1 (nt 295-611, HA300, GenBank accession No. DQ864720) and were obtained as follows [20] . First, SARS-CoV1 and SARS-CoV3 fragment was amplified from the template plasmid pBSSR-V6 and pBSSR7-8 (provided by Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College) using the primers S-SARS1 and LAP-SARS1, LAP-SARS3 and A-SARS3, respectively. SARS-CoV2 fragment was amplified from the template plasmid pNCCL-SARS (constructed by our laboratory) using the primers LAP-SARS2 and A-SARS2. HCV fragment was produced from the template plasmid pNCCL-HCV (constructed by our laboratory) using the primers S-HCV (containing one C-variant pac site ) and HCV-LAP1. HA300 fragment was amplified from the template plasmid pNCCL-H5N1 (constructed by our laboratory) using the primers HA300LAP and A-HA300. Then, the gel-purified PCR products were used in the following overlapping extension PCR reaction. SARS-CoV1+SARS-CoV2 fragments and HCV+HA300 fragments were amplified using the primers S-SARS1 and LAP-SARS2+, FIVELAP2 and 3V-FIVE-07-A, respectively. Then SARS-CoV1+SARS-CoV2+SARS-CoV3 fragments were amplified using primers FIVELAP1 and 3V-FIVE-07-S. Finally, the full-length chimeric sequences SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300 with one C-variant pac site were amplified using the primers 3V-FIVE-07-S and 3V-FIVE-07-A. The primers described above were shown in table 1 . The purified PCR products and the pET-MS2-pac plasmid were then digested with the Not I restriction enzyme, respectively. The resulting fragments were ligated to produce the recombinant expression plasmid pM-CR-2C. The positive constructions were verified by sequencing. Fig. 1 . The sequence and secondary structure of the 19-nucleotide stem-loop region (pac site) . Base numbering is relative to the start of the MS2 replicase initiation codon AUG; A is +1. a The wildtype pac site. b The C-variant pac site .

We also constructed three parallel control recombinant expression plasmids: pM-CR-C, pM-CR-W and pM-CR-2W. These plasmids had the full-length chimeric RNA sequences, but the pac site was different to each other. The plasmid pM-CR-C contained one C-variant pac site and the plasmid pM-CR-W contained one wild-type pac site , in which the pac site was located between the MS2 coat protein and the chimeric sequences. The plasmid pM-CR-2W contained two wild-type pac sites, in which one pac site was located between the MS2 coat protein and the chimeric sequences and another was at the middle of the chimeric se quences.

The four kinds of recombinant plasmid were transformed into the competent Escherichia coli BL21 (DE3) strain separately and protein expression was induced with 1 m M isopropyl-␤ -Dthiogalactoside at 37° for 16 h. The cells were then harvested by centrifugation and lysed by ultrasonic disruption (Branson Sonifier 350). The supernatant was incubated with 25 U DNase I and 100 U RNase A at 37° for 60 min. Finally, the products were detected by agarose gel electrophoresis (1%), with ethidium bromide staining. The armored RNA particles were further purified by CsCl density gradient centrifugation (Beckman Ti90 rotor) according to the conventional protein purification steps [2, 21] . The main fractions were then pooled and purified by dialysis against sonication buffer (100 m M NaCl, 5 m M MgSO 4 , 50 m M Tris-Cl, pH 8.0).

The total RNA of the armored RNA particles was isolated using QIAamp viral RNA mini kit (Qiagen, Germany) according to the manufacturer's instructions. Reverse transcription (RT) reactions were performed in a total volume of 50 l containing 5 l of total RNA, 10 pmol primer Overlap-A ( table 1 ), 4 l of first strand buffer, 0.2 m M dNTP, 2.5 m M MgCl 2 , and 200 U of superscript III reverse transcriptase (Invitrogen, USA). The mixture was incubated at 55° for 50 min, 70° for 15 min to denature the reverse transcriptase, and cooled at 4°.

PCR was performed in a 50-l reaction volume at 94° for 5 min, followed by 40 cycles of 30 s at 95°, 30 s at 56° and 140 s at 72°, and finally a 10-min elongation at 72°. The PCR products were purified and ligated with pEGM -T Easy vector (Promega, USA) and then transformed into the competent E. coli DH5 ␣ . The recombinant plasmid was verified by sequencing.

The optical density (OD 260 ) of the armored RNA particles was measured at 260 nm. The expression efficiency was then estimated based on the relationship that an optical density of 1.0 corresponded to a concentration of 0.125 mg/ml of the armored RNA.

The armored RNA particles were 10-fold serially diluted with the newborn calf serum to obtain 10,000 and 1,000,000 IU/ml. A single batch of the armored RNA particles was aliquoted into single time point samples of 100 l for the stability study. Samples were then incubated at 4°, 37° and room temperature, respective- 

The armored RNA was expressed in E. coli BL21 (DE3), digested by DNase I and RNase A at 37° for 60 min, and purified with CsCl gradient centrifugation. A single band of about 1,500 bp of DNA corresponding to the armored RNA is shown in figure 2 . 

After purification by CsCl gradient centrifugation, total RNA was isolated and RT-PCR was performed. PCR was also performed to check for DNA contaminants. The results of RT-PCR showed that the full-length chimeric RNA was packaged into the armored RNA corresponding to the plasmid pM-CR-2C and pM-CR-2W and sequencing results verified that they were the chimeric sequences desired. However, only 1,200-bp RNA was packaged into the armored RNA corresponding to the plasmid pM-CR-C and pM-CR-W. These results indicated the use of a two pac sites expression system could increase the length of packaged RNA. The results of RT-PCR and PCR are shown in figure 3 .

The optical density at 260 nm was measured to calculate the expression efficiency of the armored RNA. The expression efficiency of the plasmid pM-CR-2C, pM-CR-2W, pM-CR-C, and pM-CR-W was 0.51, 0.35, 0.35 and 0.23 mg/ml, respectively. The expression efficiency of the plasmid pM-CR-2C was 38% higher than that of the plasmid pM-CR-2W, and that of the plasmid pM-CR-C was 52% higher than that of the plasmid pM-CR-W. Thus, the C-variant pac site could enhance the expression efficiency of the armored RNA and the two C-variant pac sites plasmid, i.e. pM-CR-2C had the highest expression efficiency.

The armored RNA samples were incubated at 4°, 37° and room temperature, respectively, for the stability analysis. Samples taken at different time points (3 days, 1 week, 3 weeks, 4 weeks and 8 weeks) were stored at -80° for 8 weeks. Subsequent real-time PCR results showed that the armored RNA was rather stable at different time points and temperature conditions ( fig. 4 ). 

The armored RNA containing about 1,700 bases MS2 bacteriophage RNA genome was obtained by utilizing a one-plasmid expression system [22] , which indicated that the maximal length of the packaged RNA would be approximately 2,000 bases. However, so far, only 1,200 bases exogenous RNA was packaged into armored RNA by the one-plasmid expression system with one wild-type pac site [9] . In the present study, we constructed a new one-plasmid expression system with two C-variant pac sites to demonstrate the possibility of forming the armored RNA containing exogenous RNA about 2,000 bases in length.

The C-variant pac site could increase the affinity between the coat protein and RNA to 6-fold or even as high as 50-fold [23, 24] . Nevertheless, we utilized the C-variant pac site to construct the two pac sites armored RNA expression system. Our study revealed that the expression efficiency of the plasmid pM-CR-2C and pM-CR-C with the C-variant pac site(s) was higher than the plasmid pM-CR-2W and pM-CR-W with the wild-type pac site(s) , respectively.

In addition, because the pac site plays an important role in the package processes, the expression efficiency and package capacity might be further enhanced if inserting a second pac site [25, 26] . We tried to use two pac sites to package the 1,819 bases chimeric RNA. Our study demonstrated that the plasmid pM-CR-2C and pM-CR-2W with two C-variant or wild-type pac sites could package 1,891 bases RNA, which was close to the theoretical length 2,000 bases, while only 1,200 bases RNA was packaged into the plasmid pM-CR-C and pM-CR-W with one C-variant or wild-type pac site .

The armored RNA containing long chimeric RNA, including three SARS-CoV fragments, one HCV fragment, and one H5N1 fragment, can be used as a control or calibrator for qualitative or quantitative detection of SARS-CoV, HCV, and H5N1 by RT-PCR. Simultaneously, our study indicated that the multiple target viral RNAs can be packaged into a single armored RNA to serve as a common calibrator for detection of different RNA virus.

The stability experiment and subsequent real-time PCR results revealed that the available armored RNA was stable at different time points and temperature conditions. All of these showed that the armored RNA constructed in this study met the criteria as a calibration standard or an internal assay control.

In conclusion, we have demonstrated that the chimeric RNA with a length of 1,891 bases can be packaged into MS2 coat protein to produce the armored RNA by utilizing a one-plasmid expression system with two C-varaint pac sites, which exhibited the highest expression efficiency. The expression system can be used as a platform for preparation of the ribonuclease-resistant armored RNA containing long RNA sequences, which could act as a calibration standard or an internal assay control in clinical laboratories. Additionally, an approximately 2,248 bases chimeric armored RNA was also successfully expressed by a two-plasmid coexpression system with the C-variant pac site [19] . So it is possible to produce an armored RNA packaging of about 3,000 bases exogenous RNA by a oneor two-plasmid expression system by increasing the number and affinity of the pac site .

Ribonuclease-resistant RNA controls (armored RNA) for reverse transcription-PCR, branched DNA, and genotyping assays for hepatitis C virus

Ribonuclease-resistant viral RNA standards. US Patent No. 5677124

Taqman 5 -nuclease human immunodeficiency virus type 1 PCR assay with phage-packaged competitive internal control for high-throughput blood donor screening

Armored RNA as virus surrogate in a real-time reverse transcriptase PCR assay proficiency panel

A novel real-time multiplex reverse transcriptase-polymerase chain reaction for the detection of HIV-1 RNA by using dualspecific armored RNA as internal control

Production in Saccharomyces cerevisiae of MS2 virus-like particles packaging functional heterologous mRNAs

Armored RNA technology for production of ribonucleaseresistant viral RNA controls and standards

Highly sensitive assay for detection of enterovirus in clinical specimens by reverse transcription-PCR with an armored RNA internal control

Preparation of a chimeric armored RNA as a versatile calibrator for multiple virus assays

RNA aptamers for the MS2 bacteriophage coat protein and the wild-type RNA operator have similar solution behaviour

Structural basis of pyrimidine specificity in the MS2 RNA hairpin-coat-protein complex

Dissecting the key recognition features of the MS2 bacteriophage translational repression complex

Probing sequence-specific RNA recognition by the bacteriophage MS2 coat protein

Nucleoside and nucleotide inactivation of R17 coat protein: evidence for a transient covalent RNAprotein bond

Development of an advanced polysome display system dependent on a specific protein-RNA motif interaction

Mutants of the bacteriophage MS2 coat protein that alter its cooperative binding to RNA

Cooperative binding of R17 coat protein to RNA

Encapsidation of heterologous RNAs by bacteriophage MS2 coat protein

Ribonucleaseresistant virus-like particles containing long chimeric RNA sequences produced by a twoplasmid coexpression system

Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension

Winkler MM: Methods of quantifying viral load in an animal with a ribonuclease-resistant RNA preparation

Winkler MM: Ribonuclease-resistant RNA preparation and utilization. US Patent 6214982

Use of synthetic oligoribonucleotides to probe RNA-protein interactions in the MS2 translational operator complex

An RNA mutation that increases the affinity of an RNAprotein interaction

RNA binding site of R17 coat protein

Crystal structures of a series of RNA aptamers complexed to the same protein target