key: cord-0949414-2ufmeebh
authors: Li, Ya‐Ting; Liang, Ying; Ling, Ye‐Sheng; Duan, Meng‐Qi; Pan, Li; Chen, Zhuang‐Gui
title: The spectrum of viral pathogens in children with severe acute lower respiratory tract infection: A 3‐year prospective study in the pediatric intensive care unit
date: 2019-06-13
journal: J Med Virol
DOI: 10.1002/jmv.25502
sha: d75b171eda8816c9c7d115757cfc0a615ef5bcca
doc_id: 949414
cord_uid: 2ufmeebh

BACKGROUND: No comprehensive analysis is available on the viral etiology and clinical characterization among children with severe acute lower respiratory tract infection (SALRTI) in Southern China. METHODS: Cohort of 659 hospitalized children (2 months to 14 years) with SALRTI admitted to the Pediatric Intensive Care Unit (PICU) in the Guangzhou from May 2015 to April 2018 was enrolled in this study. Nasopharyngeal aspirate specimens or induced sputum were tested for eight categories respiratory viral targets. The viral distribution and its clinical characters were statistically analyzed. RESULTS: Viral pathogen was detected in 326 (49.5%) of children with SALRTI and there were 36 (5.5%) viral coinfections. Overall, the groups of viruses identified were, in descending order of prevalence: Influenza virus (IFV) (n = 94, 14.3%), respiratory syncytial virus (RSV) (n = 75, 11.4%), human rhinovirus (HRV) (n = 56, 8.5%), adenovirus (ADV) (n = 55, 8.3%), parainfluenza (PIV) (n = 47, 7.1%), human coronavirus (HCoV) (n = 15, 2.3%), human metapneumovirus (HMPV) (n = 14, 2.1%) and human bocavirus (HBoV) (n = 11, 1.7%). The positive rate in younger children (< 5 years) was significantly higher than the positive rate detected in elder children (> 5 years) (52.5% vs 35.1%, P = 0.001). There were clear seasonal peaks for IFV, RSV, HRV, ADV, PIV, and HMPV. And the individuals with different viral infection varied significantly in terms of clinical profiles. CONCLUSIONS: Viral infections are present in a consistent proportion of patients admitted to the PICU. IFV, RSV, HRV, and ADV accounted for more than two‐thirds of all viral SALRTI. Our findings could help the prediction, prevention and potential therapeutic approaches of SALRTI in children.

The etiological factor in young children is a viral infection or a combination of viral and bacterial infection, which is apparently different from that of ALRTI caused by bacteria in adults. Therefore, the lack of effective diagnostic methods for the identification of the etiological factor is the major reason why more than 50% of ALRTIs were treated unnecessarily and inappropriately with antibiotics, even in the case of viral infection. 8 This often leads to serious consequences such as a high rate of antibiotic resistance, 9 especially in virus-infected children with SALRTI. Therefore, a better understanding of the epidemiology of viral respiratory tract infections in critically ill children is essential for the development of a novel strategy for SALRTI prevention, control, and treatment.

Although several studies have been conducted to investigate the 

This study was conducted in compliance with the protocol approved by the Ethics Committee of the Third Affiliated Hospital of Sun Yat-Sen University. Written informed consent was obtained from the patients' guardians before enrollment.

The study participants consisted of children admitted to the PICU of the Third Affiliated Hospital of Sun Yat-Sen University between May 2015 and April 2018. SALRTI was diagnosed according to the clinical guidelines recommended by the World Health Organization. 10, 11 The eligibility and classification of the clinical syndromes of SALRTI were determined from each patient's original medical history and physical examination records. The inclusion criteria were as follows: (children > 5 years of age) sudden onset of fever > 38°C, cough or sore throat, shortness of breath or difficulty breathing, and requiring hospitalization; (children < 5 years of age) meeting either (1) the Integrated Management of Childhood Illness (IMCI) criteria for pneumonia (any child 2 months to 5 years of age with cough or difficulty breathing and breathing faster than 60 breaths/min [infants < 2 months], breathing faster than 50 breaths/min (2-12 months), or breathing faster than 40 breaths/min [1-5 years] ) or (2) the IMCI criteria for severe pneumonia (any child 2 months to 5 years of age with cough or difficulty breathing and any of the following general danger signs: unable to drink or breastfeed, vomits everything, convulsions, lethargic or unconscious, chest indrawing, or stridor in a calm child) and (3) requiring hospital admission. Nasopharyngeal aspirate (NPA) or induced sputum (IS) was collected from the patients at the first day of admission and transferred into the virus transport medium.

Demographic information and medical test results were obtained using standardized forms. , including HCoV-229E, OC43, NL63, HKU1, SARS, and MERS), adenovirus (ADV), human rhinovirus (HRV), and human bocavirus (HBoV). These viruses were detected using either real-time polymerase chain reaction (PCR) or reverse transcription-PCR. The procedure was described previously, [12] [13] [14] [15] [16] with specific primers and probes listed in Table 1 . 

RSV-A RSV A-F GCTCTTAGCAAAGTCAAGTTGAATGA N 82 RSV A-R TGCTCCGTTGGATGGTGTATT RSV A-Probe FAM-ACACTCAACAAAGATCAACTTCTGTCATCCAGC-BHQ1 RSV-B RSV B-F GATGGCTCTTAGCAAAGTCAAGTTAA N 104 RSV B-R TGTCAATATTATCTCCTGTACTACGTTGAA RSV B-Probe FAM-TGATACATTAAATAAGGATCAGCTGCTGTCATCCA-BHQ1 PIV1 PIV1-F ATCTCATTATTACCYGGACCAAGTCTACT HN 128 PIV1-R CATCCTTGAGTGATTAAGTTTGATGAATA PIV1-Probe FAM-AGGATGTGTTAGAYTACCTTCATTATCAATTGGTGATG- BHQ1 PIV2 PIV2-F CTGCAGCTATGAGTAATC NP 119 PIV2-R TGATCGAGCATCTGGAAT PIV2-Probe FAM-AGCCATGCATTCACCAGAAGCCAGC-BHQ1 PIV3 PIV3-F ACTCTATCYACTCTCAGACC NP 106 PIV3-R TGGGATCTCTGAGGATAC PIV3-Probe FAM-AAGGGACCACGCGCTCCTTTCATC-BHQ1 PIV4 PIV4-F GATCCACAGCAAAGATTCAC NP 113 PIV4-R GCCTGTAAGGAAAGCAGAGA PIV4-Probe FAM-TATCATCATCTGCCAAATCGGCAA-

The positive rates of viral infections in male and female patients were 48.44% (202 of 417) and 51.2% (124 of 242), respectively. No significant difference was found between both sexes (χ 2 = 0.480,

The positive rate in younger children (< 5 years) was significantly higher than that in older children (> 5 years) (52.5% vs 35.1%, χ 2 = 11.405, P = 0.001). Children aged 2 months to 1 year were the most susceptible to viral respiratory pathogens with a positive rate of 55.4% (Table 3) . However, the infection patterns of viruses were different among the age groups. RSV was highly clustered in patients with SALRTI who are younger than 3 years old (> 10% positive rate). ADV accounted for 2.9% to 11.9% of the viruses identified in all age groups. This group of viruses was the common pathogen in all but with higher incidence in school-aged children (5-10 years old) in which IFV was the most frequent one (25.7%) ( Table 3 ).

The patients were divided into four groups, in accordance with the (Table 2 ). In general, the total frequency of positive tests for viruses was slightly higher in spring than in autumn (χ 2 = 4.373, P = 0.037), but no significant difference was observed between summer and winter 

The most common symptoms associated with viral SALRTI were cough (95.1%), fever (≥ 38.0º =°C) (92.9%), difficulty breathing (71.8%), and sputum production (67.5%). Compared with negative cases, more patients were observed to have a runny nose, sputum, tachypnea, difficulty breathing, and wheezing (all P < 0.05) ( Table 2) . were statistically significant differences in the prevalence of sputum production, tachypnea, difficulty breathing, wheezing, pulmonary rales, and radiographic evidence of pneumonia according to whether a patient was infected by ADV or negative (all P < 0.05). Higher APACHE II scores were found in patients infected with RSV or ADV than in those infected with HRV, and more mechanical ventilation strategies were adopted in ADV-infected cases ( In humans, HRV causes not only respiratory tract infection, including the most common cold but also severe respiratory illness such as pneumonia and bronchiolitis in children. 24 HRV was the third most frequently detected respiratory virus type in the present study.

HRV isolates were detected each month of the year, and the highest positive rates were in September. This result was consistent with that of a previous study in Suzhou, 25 but different from that of a study in Changsha. 26 Radiography could be helpful in the early diagnosis of ADV pneumonia even when lung rales were not evident on auscultation.

Severe ADV pneumonia has been frequently described in immunocompromised patients. 28 Respiratory infection caused by ADV in immunocompetent patients was usually thought to be mild and self-limited. 32 Further studies will thus be required to clarify their roles in SALRTI.

Third, it should be considered that some respiratory viruses can be shed for long periods of time after infection or detection in asymptomatic children. 36 Hence, the investigation of respiratory specimens from asymptomatic children would make the role of these viruses in SALRTI clearer.

In summary, despite the aforementioned limitations, this 3-year surveillance provides a basic profile of the spectrum, seasonality, age, and sex distribution as well as the clinical association of viral respiratory infections in the PICU at the medical center where the study was conducted. This profile would be useful in the examination of viruses as well as the development of novel strategies in managing viral infections in SALRTI.

We appreciate Professor Bo Peng for proofing our manuscript. We are most grateful to the clinicians and nurses for their assistance in sample collection. This study was supported by the National Mega 

Child and adolescent health from 1990 to 2015: findings from the Global Burden of Diseases, Injuries, and Risk Factors 2015 Study

Global, regional, and national incidence, prevalence, and years lived with disability for 328 diseases and injuries for 195 countries, 1990-2016: a systematic analysis for the Global Burden of Disease Study

Global, regional, and national estimates of pneumonia morbidity and mortality in children younger than 5 years between 2000 and 2015: a systematic analysis

Global and regional burden of hospital admissions for severe acute lower respiratory infections in young children in 2010: a systematic analysis

Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study

Global, regional, and national age-sex specific mortality for 264 causes of death, 1980-2016: a systematic analysis for the Global Burden of Disease Study

Epidemiology and etiology of childhood pneumonia in 2010: estimates of incidence, severe morbidity, mortality, underlying risk factors and causative pathogens for 192 countries

Respiratory viral infections in infants: causes, clinical symptoms, virology, and immunology

The global problem of antibiotic resistance

World Health Organization WHO Recommended Surveillance Standards

World Health Organization Handbook: IMCI Integrated Management of Childhood Illness. WHO

Epidemiology characteristics of human coronaviruses in patients with respiratory infection symptoms and phylogenetic analysis of HCoV-OC43 during 2010-2015 in Guangzhou

Etiology of diarrhea among children under the age five in China: results from a five-year surveillance

Epidemiology characteristics of respiratory viruses found in children and adults with respiratory tract infections in southern China

Epidemiology of acute respiratory infections in children in Guangzhou: a three-year study

Surveillance and genome analysis of human bocavirus in patients with respiratory infection in Guangzhou

Frequency of respiratory viruses among patients admitted to 26 Intensive Care Units in seven consecutive winter-spring seasons (2009-2016) in Northern Italy

Prevalence of respiratory viruses among adults, by season, age, respiratory tract region and type of medical

Detection of viruses and mycoplasma pneumoniae in hospitalized patients with severe acute respiratory infection in Northern China

Characteristics of patients with hospital-acquired influenza A (H1N1)pdm09 virus admitted to the intensive care unit

Acute viral lower respiratory tract infections in Cambodian children: clinical and epidemiologic characteristics

Disease burden of the most commonly detected respiratory viruses in hospitalized patients calculated using the disability adjusted life year (DALY) model

Viral etiologies of hospitalized acute lower respiratory infection patients in China

Update on human rhinovirus and coronavirus infections

Clinical and epidemiological profiles including meteorological factors of low respiratory tract infection due to human rhinovirus in hospitalized children

Prevalence of human rhinovirus in children admitted to hospital with acute lower respiratory tract infections in Changsha

Clinical features and complete genome characterization of a distinct human rhinovirus (HRV) genetic cluster, probably representing a previously undetected HRV species, HRV-C, associated with acute respiratory illness in children

Adenovirus infections in immunocompetent and immunocompromised patients

Viral and atypical bacterial detection in acute respiratory infection in children under five years

Fatal pneumonia cases caused by human adenovirus 55 in immunocompetent adults

The prognostic significance of respiratory rate in patients with pneumonia: a retrospective analysis of data from 705,928 hospitalized patients in Germany from

Severe community-acquired pneumonia caused by human adenovirus in immunocompetent adults: a multicenter case series

Emergent severe acute respiratory distress syndrome caused by adenovirus type 55 in immunocompetent adults in 2013: a prospective observational study

Outbreak of adenovirus type 1 severe pneumonia in a French intensive care unit

Viral etiology of community-acquired pneumonia among adolescents and adults with mild or moderate severity and its relation to age and severity

Viral and bacterial causes of severe acute respiratory illness among children aged less than 5 years in a high malaria prevalence area of western Kenya

The spectrum of viral pathogens in children with severe acute lower respiratory tract infection: A 3-year prospective study in the pediatric intensive care unit

The authors declare that there are no conflict of interests.

http://orcid.org/0000-0001-6109-9946