key: cord-0923498-8b4shj24
authors: Chen, Tao; Lin, Yu-Xin; Zha, Yan; Sun, Ying; Tian, Jinxiu; Yang, Zhiying; Lin, Shan-Wen; Yu, Fuxun; Chen, Zi-Sheng; Kuang, Bo-Hua; Lei, Jin-Ju; Nie, Ying-jie; Xu, Yonghao; Tian, Dong-Bo; Li, Ying-Zi; Yang, Bin; Xu, Qiang; Yang, Li; Zhong, Nanshan; Zheng, Meizhen; Li, Yimin; Zhao, Jincun; Zhang, Xiang-Yan; Feng, Lin
title: A Low-Producing Haplotype of Interleukin-6 Disrupting CTCF Binding Is Protective against Severe COVID-19
date: 2021-10-12
journal: mBio
DOI: 10.1128/mbio.01372-21
sha: b6098311ddaa8832ccdc8075a8c8b88e7ecb86c0
doc_id: 923498
cord_uid: 8b4shj24

Interleukin6 (IL-6) is a key driver of hyperinflammation in COVID-19, and its level strongly correlates with disease progression. To investigate whether variability in COVID-19 severity partially results from differential IL-6 expression, functional single-nucleotide polymorphisms (SNPs) of IL-6 were determined in Chinese COVID-19 patients with mild or severe illness. An Asian-common IL-6 haplotype defined by promoter SNP rs1800796 and intronic SNPs rs1524107 and rs2066992 correlated with COVID-19 severity. Homozygote carriers of C-T-T variant haplotype were at lower risk of developing severe symptoms (odds ratio, 0.256; 95% confidence interval, 0.088 to 0.739; P = 0.007). This protective haplotype was associated with lower levels of IL-6 and its antisense long noncoding RNA IL-6-AS1 by cis-expression quantitative trait loci analysis. The differences in expression resulted from the disturbance of stimulus-dependent bidirectional transcription of the IL-6/IL-6-AS1 locus by the polymorphisms. The protective rs2066992-T allele disrupted a conserved CTCF-binding locus at the enhancer elements of IL-6-AS1, which transcribed antisense to IL-6 and induces IL-6 expression in inflammatory responses. As a result, carriers of the protective allele had significantly reduced IL-6-AS1 expression and attenuated IL-6 induction in response to acute inflammatory stimuli and viral infection. Intriguingly, this low-producing variant that is endemic to present-day Asia was found in early humans who had inhabited mainland Asia since ∼40,000 years ago but not in other ancient humans, such as Neanderthals and Denisovans. The present study suggests that an individual's IL-6 genotype underlies COVID-19 outcome and may be used to guide IL-6 blockade therapy in Asian patients.

protect the carriers from hyperinflammation in response to acute SARS-CoV-2 infection. These results point out the possibility that IL-6 genotypes underlie the differential viral virulence during the outbreak of COVID-19. The risk loci we identified may serve as a genetic marker to screen high-risk COVID-19 patients.

KEYWORDS COVID-19, CTCF, interleukin-6, genetic polymorphisms C oronavirus disease 2019 (COVID- 19) is an infectious respiratory disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an RNA virus spreading rapidly. It is the third most highly pathogenic coronavirus after SARS-CoV and Middle East respiratory syndrome (MERS)-CoV. The clinical presentation of COVID-19 varies between individuals. Most patients develop mild or no illness, but a minority of patients suffer from severe COVID-19, including acute respiratory distress syndrome (ARDS) and systemic inflammation. According to data from China, 84.3% with COVID-19 developed mild illness and 15.7% developed severe disease (1) . COVID-19 also exhibited striking geographical and ethnic disparities. The lowest fatality rates were observed in East and Southeast Asia, while the fatality rates in some European and American countries were up to ;100-fold higher than those in East Asia (according to data from the Johns Hopkins University Coronavirus Resource Center, https://coronavirus.jhu.edu/data/mortality). Variability in COVID-19 severity could be explained by many factors, including anti-epidemic measures and medical resources in different countries as well as the individual's age, sex, and comorbidity (2) . In addition, an individual's genetic background may also affect COVID-19 vulnerability, especially genetic variations that explain different immune responses to coronaviruses, such as Toll-like receptors (TLRs) (3) . Importantly, a genome-wide association study (GWAS) reported that a Neanderthal-derived region of chromosome 3 was the major genetic risk factor for severe COVID-19 in populations in Italy and Spain (4, 5) . However, the frequency of the Neanderthal risk haplotype varies widely between different populations and is almost absent from East Asia, suggesting that the genetic contribution of this haplotype to COVID-19 severity is small in East Asians. Given the immune-related risk loci often show heterogeneity between populations, the genetic susceptibility of COVID-19 in East Asian populations is worthy of investigation.

Interleukin-6 (IL-6) is a multifunctional cytokine secreted from many cell types, including monocytes/macrophages, dendritic cells, fibroblasts, endothelial cells, and B and T cells, in response to inflammatory stimuli and viral infections. IL-6 is a key player in the exacerbated inflammatory response in SARS-CoV-2 infection (6) . Elevated serum concentrations of IL-6 and other cytokines are hallmarks of severe COVID-19 (7) . The excessive IL-6 creates high levels of inflammation that often result in the development of ARDS, which is the leading cause of death from COVID-19 and other coronavirusrelated diseases, including SARS and MERS (8) (9) (10) (11) . Because IL-6 level strongly correlates with disease progression, the serum concentration of IL-6 has been used to monitor the severity of COVID-19 (7, 12, 13) , and it acts as a predictor of mortality (14) .

IL-6 expression is highly influenced by polymorphisms in promoter and regulatory regions. Some of these single-nucleotide polymorphisms (SNPs) vary significantly between different ethnic populations and are related to disparities in the response to a number of pathogens. For example, IL-6 promoter SNP rs1800796, which is highly prevalent in Asia, has been proposed to explain ethnic-specific susceptibility to some infectious diseases. Individuals of Hmong ancestry harboring the IL-6 variant haplotypes rs1800796, rs1524107, and rs2066992 had higher risk of serious fungal infection than individuals of European ancestry harboring the wild-type (WT) haplotype (15) . For hepatitis B virus (HBV) infection that is endemic to Asian countries, the rs1800796 C/C variant genotype was found to be detrimental to spontaneous clearance of HBV in Chinese (16) and associated with increased risk of chronic HBV infection in Malaysians (17) . IL-6 promoter SNPs rs1800795 and rs1800797 are exclusively polymorphic in Caucasians. The G/G genotype of rs1800795 was protective against pneumococcal pneumonia in white Spanish patients (18, 19) , but the G-G alleles at rs1800795 and rs1800797 favored a worse evolution of HCV chronic infection in Italians (20) and also conferred susceptibility to human papillomavirus (HPV)-associated cervical cancer in North Indians (21) . In summary, the impact of IL-6 polymorphisms in infectious diseases varies depending on the causative pathogens and ethnicities.

The present study determined the influence of IL-6 polymorphisms on the severity of COVID-19 in Chinese patients. We found an Asian-common haplotype, C-T-T, represented by variant allele rs1800796, rs1524107, and rs2066992 loci, favored a better outcome of SARS-CoV-2 infection, associated with a reduced expression of IL-6 by inflammatory stimuli and viral infection. Our results highlight the potential of these IL-6 SNPs as biomarkers in the prognosis and treatment of COVID-19 in populations with Asian ancestry.

An Asian-common haplotype of IL-6 correlates with lower IL-6 expression. IL-6 expression is highly influenced by polymorphisms in the promoter region. Numerous studies revealed that three SNPs, rs1800797 (2597 G . A), rs1800796 (2572 G . C), and rs1800795 (2174 G . C), in the proximal promoter, affect the transcription and secretion of IL-6 and were associated with susceptibility to various infectious agents, including bacteria, fungi, and viruses (15, 17, 18, 21, 22) . We explored the SNPs and haplotype diversity in different populations worldwide provided by the 1000 Genomes Project (23) . Haplotype analysis based on the genotype information of 2,504 individuals established that the three promoter SNPs exhibited distinct linkage disequilibrium (LD) patterns. Rs1800795 and rs1800797 were in high LD (r 2 . 0.95), and rs1800796 was strongly linked with rs1524107 and rs2066992 (r 2 . 0.95; Fig. 1a ), with the latter two SNPs located in the intron of IL-6 ( Fig. 1b and 2a) . Notably, the three promoter SNPs exhibited striking ethnic disparities in comparisons of population allele frequencies worldwide. rs1800796 variation was highest in East Asians (79%), followed by South Asians (39%) and Americans (30%), but was rare in Africans (10%) and Europeans (5%) (Fig. 1c, left) . In contrast, rs1800797 and rs1800795 were highly polymorphic in Caucasians but almost monomorphic in Asians and Africans (Fig. 1c, right) . Because of the high LD of rs1800796, rs1524107, and rs2066992, two typical haplotypes exist worldwide. The wild-type haplotype G-C-G was common in Europeans and Africans, and the derived haplotype C-T-T was most prevalent in East Asians (Fig. 1d) .

Having shown the ethnic disparities in IL-6 functional SNPs, we then compared IL-6 expression levels in the three major world populations, European, African, and East Asian, by utilizing microarray expression data from the HapMap LCLs (lymphoblastoid cell lines, the EBV-transformed human B-cell lines), an international project providing genotypic data on individuals of major world populations (24). A significant higher expression level of IL-6 was observed in European population, followed by Africans, and East Asians had the lowest IL-6 levels (Fig. 1e) . We then attempted to establish the associations between the genotypes of Asian-common haplotype (rs1800796 as a tag SNP) and Caucasian-common haplotype (rs1800795 as a tag SNP) with IL-6 levels. Expression levels of IL-6 in LCLs from the HapMap Project with genotypic data at the candidate loci were analyzed. The results suggested that rs1800796 variant allele C associated with lower IL-6 expression, while rs1800795 variant allele C correlated with higher IL-6 expression than their ancestral allele, G (Fig. 1f) . Furthermore, higher DNA methylation in the IL-6 promoter was found in a minor allele (C) at rs1800796; in contrast, the derived C allele at rs1800795 was associated with lower DNA methylation in colorectal cancer tissues (Fig. 1g ) and another cancer type (see Fig. S1 in the supplemental material) in a publicity available data set, Pancan-meQTL (25) . This analysis indicated that the haplotype (represented by rs1800796, rs1524107, and rs2066992) prevalent in East Asia was associated with lower levels of IL-6, while the Caucasian-common haplotype (represented by rs1800795 and rs1800797) was associated with higher expression of IL-6.

Variant alleles for rs1800796, rs1524107, and rs2066992 represent reduced risk of developing severe COVID-19. Among the three promoter SNPs that correlate with IL-6 expression, rs1800797 and rs1800795 are exclusively ancestral G-G genotype The location of CTCF-binding sites in the IL-6 gene. Human CTCF binding motif logo was from JASPAR 2020 , and the 12-bp consensus sequences of CTCF-binding sites are in boxes. The wild-type allele is in blue and variant allele in red. Phylop basewise conservation score derived from 100 vertebrate species is shown. (d) ChIP-PCR in PBMCs of a donor with wild-type genotype at the candidate SNPs using anti-CTCF antibody or control IgG. H19 was used as a positive control. MW, molecular weight; ddH 2 O, double-distilled water. (e) CTCF binding intensity at IL-6/IL-6-AS1 locus in LCL cell lines with different genotypes at the loci of interest. (f) ChIP-qPCR assay of CTCF binding at two target regions of IL-6 locus in PBMCs of healthy donors with different genotypes. Each assay was performed for each donor (WT/WT, n = 2; WT/Var, n = 2; Var/Var, n = 2) in technical triplicate. Data represent means 6 SD per group. One-way ANOVA with Bonferroni correction for multiple comparisons. (g) Basal level of IL-6-AS1 in PBMCs of donors as in panel f. Each assay was performed for each donor in technical triplicate. Relative expression of IL-6-AS1 is normalized to GAPDH. Data represent means 6 SD per group. One-way ANOVA with Bonferroni correction for multiple comparisons was used. *, P , 0.05; **, P , 0.01; ***, P , 0.001; n.s., not statistically significant.

in East Asians. Another promoter SNP, rs1800796, and its strongly linked intronic SNPs, rs1524107 and rs2066992, were highly polymorphic in Asians (Fig. 1c) . Therefore, we assessed the genetic variations of the three loci in Chinese COVID-19 patients with mild or severe illness. A total of 105 COVID-19 cases from areas where it was not endemic (Guangdong and Guizhou province), without treatment delay, and 149 healthy controls matched for matched for age, sex, and geographic origin were enrolled in this study. Their characteristics are shown in Table 1 and Table S1 . Similar to other reports, age, sex, and underlying health conditions, such as diabetes, hypertension, and coronary artery disease, were risk factors for severe COVID-19. The median age of severe COVID-19 was 18 years older than that for the patients with mild illness (58 versus 40 years old). Men were at greater risk of more severe COVID-19 outcomes than women, with the male-tofemale ratio being 3:2 in severe cases and 1:1 in mild cases (Table 1 and Table S1 ). The factors underlying men's extra vulnerability might be due to the sex differences in the immune response. For example, males are known to produce more IL-6 than females partly because sex hormones impact IL-6 expression (26, 27) .

We then genotyped rs1800796, rs1524107, and rs2066992 in patients and the healthy matched controls. All genotypes were in Hardy-Weinberg equilibrium. Because of the low frequency of wild-type alleles in East Asians, samples harboring ancestral alleles (rs1800796 G/G and G/C, rs1524107 C/C and C/T) were combined for analysis in the dominant model. The allele and genotype frequencies were similar between healthy controls and COVID-19 patients (Table S2) . However, the mild and severe COVID-19 groups showed different patterns of IL-6 polymorphisms. The wild-type allele G of rs1800796 exhibited a higher frequency in severe cases than mild cases (38.6% versus 22.9%, P = 0.017), and because of the high LD of rs1800796 with rs1524107 and rs2066992, the wild-type allele C of rs15240107 was also overrepresented in severe cases (37.1% versus 22.9%, P = 0.029) ( Table 2) . Consistent with allelic analysis, rs1800796 C/C (odds ratio [OR] = 0.264, P = 0.009) and rs1524107 T/T (OR = 0.319, P = 0.013) were identified as protective genotypes after adjustment for sex and age (Table 3) . At the haplotypic level, 29.0% of severe cases and 58.0% of mild cases were homozygous for the C-T-T haplotype (OR = 0.256, 95% confidence interval [CI] = 0.088 to 0.739, P = 0.007) ( Table 4 ). These data suggest that the variant C-T-T haplotype of rs1800796, rs1524107, and rs2066992 has a protective role with regard to COVID-19 outcome.

Genotype of the susceptibility loci determines CTCF binding at the IL-6/IL-6-AS1 locus. To determine whether the risk-associated loci we identified were functionally relevant, we sought to characterize genotype-specific changes in protein binding to the risk loci. The candidate SNP rs1800796 is located in the promoter of IL-6, and rs1524107 and rs2066992 are located in intron 2 of IL-6 and the transcription regulatory region of IL-6-AS1, a long noncoding RNA (lncRNA) that overlaps IL-6 on the antisense strand. The other two candidate SNPs linked with rs1800796, rs1524107, and rs2066992 are intronic in IL-6 and upstream of IL-6-AS1 (Fig. 2a) . The three susceptibility SNPs did not locate in any known transcription factor binding sites according to previous studies (19) (Fig. 1b) and prediction approaches. We then characterized the genotype-specific epigenetic changes around the risk loci. By analyzing the regulatory potential of these loci using ENCODE data in the UCSC Genome Browser (28), we found the three candidate loci reside at CCCTC-binding factor (CTCF) binding regions ( Fig. 2b ). CTCF is an architectural protein that helps establish the three-dimensional organization of the eukaryotic genome and regulates gene expression in various ways (29) , and a recent report suggests that CTCF is required for full-blown upregulation of inflammatory genes, including IL-6, in acute inflammatory response (30) . Analysis of publicly available chromatin immunoprecipitation sequencing (ChIP-seq) data in multiple cell lines revealed that CTCF binding to two regions in the IL-6/IL-6-AS1 locus encompassed rs1800796, rs1524107, and rs2066992 (Fig. 2b) . Scanning of CTCF binding motifs by Find Individual Motif Occurrences (FIMO) found two CTCF binding sites within the human IL-6/IL-6-AS1 locus. Binding site 1 was located upstream of the promoter SNPs rs1800797 and rs1800796, but the sequences of this binding site were not conserved in mammals (Fig. 2c , top). Binding site 2, located in the intron region encompassing rs2066992, and the sequences of this motif were highly evolutionarily conserved, indicating the second CTCF-binding motif has more conserved functional roles across mammals than the first binding motif (Fig. 2c , bottom). Consistent with publicly available ChIP-seq data sets, the binding of CTCF to the two target regions was verified in our ChIP assay in peripheral blood mononuclear cells (PBMCs) from healthy donors (Fig. 2d) .

Notably, rs2066992 was located in the second CTCF binding motif of IL-6. Wild-type allele of rs2066992 is a cytosine (C) residue at position 12 of the CTCF consensus sequence on the reverse strand orientation of IL-6 (forward strand orientation of IL-6-AS1). C to A variation was predicted to disrupt CTCF binding to that motif (Fig. 2c , bottom). Indeed, the presence of the second CTCF ChIP-seq peak in the IL-6/IL-6-AS1 locus seemed to be polymorphism dependent. Cell lines derived from Africans and Caucasians with wild-type genotypes at the three SNPs showed two evident CTCF binding peaks, such as HeLa-S3 (African), MCF7 (Caucasian), A549 (Caucasian), and K562 (Caucasian) (Fig. 2b, top) . In sharp contrast, the CTCF binding peaks, especially the second peak encompassing rs2066992, were largely diminished in cell lines derived from East Asians with a homozygous IL-6 variant allele genotype, such as Ishikawa and KU812 (Fig. 2b, bottom) . The heterozygote behaved as the wild-type homozygote, such as Kasumi-1, which was also derived from Asians (Fig. 2b, middle) . The genotype of each cell line is listed in Table S3 .

We also generated ChIP-seq data from LCLs to ascertain the CTCF binding disparities were indeed genotype but not cell type dependent. Consistent with this, LCLs established from Chinese donors with variant genotype (Donor1 and Donor2) lost the second CTCF binding peak, which was intact in GM12878, an LCL derived from a Caucasian with wild-type genotype at the candidate susceptibility loci (Fig. 2e ). Next, we verified the genotype-dependent CTCF binding in healthy donors grouped by genotypes of the 3 loci. In line with the ChIP-seq data, the binding of CTCF to the IL-6 intron region (target 2) was diminished in PBMCs of individuals who were homozygous for the variant haplotype C-T-T (Fig. 2f, right) . In contrast, the first CTCF binding peak within the IL-6 promoter region (target 1) was not obviously affected by the genotypes of these IL-6 SNPs (Fig. 2f, left) , likely because none of the SNPs were located in or in close proximity to the first CTCF binding motif of IL-6 ( Fig. 2c) . In vivo, carriers with the homozygous C-T-T genotype were found to have the lowest IL-6-AS1 expression, followed by the heterozygous genotype, and the wild-type G-C-G homozygote had the highest expression (Fig. 2g) . These results suggest that the risk-associated SNPs prevalent in Asian populations regulate IL-6/IL-6-AS1 expression by controlling CTCF-mediated chromatin interactions.

The protective variant haplotype associated with reduced transcription of IL-6's antisense transcript IL-6-AS1. Given that the rs2066992-containing CTCF binding motif is located upstream of the IL-6-AS1 coding region but in the intron of IL-6 ( Fig. 2a) , we speculated that the rs2066992 C to A variation would primarily affect IL-6-AS1 expression. We analyzed the Genotype-Tissue Expression (GTEx) status of the three SNPs (rs1800796, rs1524107, and rs2066992) in the lung tissue, and the cis-expression quantitative trait loci (eQTL) of three SNPs were associated with expression for IL-6-AS1 but not for IL-6 in the GTEx portal, likely because IL-6 level is highly unstable in postmortem tissues. Using transcriptome sequencing (RNA-seq) data of 515 individuals worldwide from the GTEx project (31), we found the genotypes of the three SNPs strongly associated with IL-6-AS1 expression. The protective genotype carriers were associated with lower expression of IL-6-AS1 in an allelic dose-dependent manner (i.e., the lowest for the variant homozygote) (Fig. 3a) . Because the variant allele of rs1800796 also associated with lower expression of IL-6 (15, 32) (Fig. 1f) , we hypothesized that the three SNPs would affect the transcription of both IL-6 and IL-6-AS1 simultaneously. Indeed, a strong correlation between IL-6-AS1 and IL-6 levels was observed in several cell lines via analysis of their transcriptomic data from the ENCODE project (r = 0.819, P , 0.0001; Fig. 3b ). We also examined the profiles of IL-6-AS1 and IL-6 expression with inflammatory stimulators, including tumor necrosis factor alpha (TNFa) and poly(IÁC), an analogue of exogenous RNA that mimics RNA virus infection. The results suggested that TNF-a and poly(IÁC) upregulated IL-6-AS1 and IL-6 in a dose-dependent manner (Fig. 3c to e) . Measurement of the time course also showed rapid a Data are presented as frequency (percent). P values were determined using x 2 test. OR and 95% CI were calculated using logistic regression, adjusted for sex and age. Two rare haplotypes (2 G-T-T and 3 C-C-G alleles) were not included due to low frequencies.

poly(IÁC) induction in IL-6-AS1 and IL-6 expression that peaked at ;3 h in HeLa cells (Fig. 3f) and ;12 h in A549 cells (Fig. 3g) . Thus, the induction of the lncRNA IL-6-AS1 mirrored that of the nearby gene IL-6, although the upregulation of IL-6-AS1 was less robust than IL-6 in inflammation response. The protective variant haplotype impairs IL-6 induction upon inflammatory stimuli. Based on their genomic position and the strong correlation with IL-6-AS1 expression, variations at the risk-associated loci, particularly rs1524107 and rs2066992, are highly likely to affect the promoter or enhancer activity of the lncRNA IL-6-AS1. To distinguish whether the putative lncRNA loci rs1524107 and rs2066992 functioned as enhancers of DNA elements or as lncRNA promoters, H3K4me3 ChIP-seq and DNaseseq data in CD14 1 resting monocytes were downloaded from the ENCODE database, and the read coverage surrounding the candidate SNPs was assessed. The H3K4me3 signature in the promoter region often defines the promoter, and enhancer elements are marked by DNase hypersensitivity or H3K27Ac but do not overlap a promoter. Using these criteria, rs1524107 and rs2066992 were considered enhancer elements because the two loci are marked by a DNase hypersensitivity signature (Fig. 4a, yellow) but lack H3K4me3 signal (Fig. 4a, green) . In contrast, the three promoter SNPs (rs1800795, rs1800796, and rs1800797) did locate at the active promoter, as H3K4me3 signals were enriched at these loci. Of note, the DNase I signal exhibited positional overlap with the CTCF-binding peaks, indicating that CTCF binding at the IL-6/IL-6-AS1 locus functions as an enhancer of IL-6-AS1 rather than an insulator or repressor in this context (29) . The epigenetic data suggest that variations at the lncRNA locus rs2066992, and likely rs1524107 locus, disrupt the CTCF-mediated enhancer-promoter interactions and the establishment of the functional domain of IL-6-AS1.

We noticed the differences in baseline serum IL-6 levels were not significant among individuals with different genotypes at the three loci ( Fig. S2 and Table S4 ). In fact, like other inflammatory genes, IL-6 expression was very low under unstimulated conditions but robustly upregulated by inflammatory stimuli and viral infections. It has been shown that IL-6 is significantly affected by its neighboring lncRNA IL-6-AS1 under lipopolysaccharide (LPS) treatment (33) . We tried to determine whether the genotypes of the candidate loci affect the transcriptional activation of IL-6 under stimulated conditions. To this end, PBMCs of healthy donors were treated with LPS for different times, and the expression of IL-6 and IL-6-AS1 pair was determined by quantitative PCR (qPCR). We found that the induction of IL-6-AS1 was most significantly affected by the genotypes of the donor, and the induction extent in the wild-type carriers was over 3fold higher than the carriers with homozygous variant genotype (Fig. 4b) . On the other hand, the upregulation of IL-6 upon LPS stimulation was also affected by the candidate polymorphisms, and the induction extent in the WT genotype was over 2-fold higher than the variant counterpart (Fig. 4c ). In addition, we investigated the effect of IL-6 genotype on IL-6/IL-6-AS1 expression after RNA virus infection. As primary PBMCs are notoriously hard to transfect, we were unable to detect the effect of the RNA virus mimic poly(IÁC) in PBMCs. Alternatively, we chose to infect with Sendai virus (SeV), an RNA virus, to stimulate IL-6 synthesis in PBMCs. Consistent with these findings, the extent of IL-6-AS1/IL-6 induction was higher in the variant donors than in the WT donors ( Fig. 4d and e) . Therefore, the haplotype comprised of rs1800796, rs1524107, and rs2066992 influences IL-6 expression via affecting the transcription of its antisense RNA IL-6-AS1, especially in acute inflammation and viral infection.

Based on the above-described evidence, we concluded that in WT carriers, viral infection or tissue damage-induced inflammatory response triggered bidirectional activation of the IL-6/IL-6-AS1 locus, resulting in full activation of IL-6 through direct promoter activation and the lncRNA-mediated transcription of closely located genes in cis (Fig. 4f, left) ; in individuals carrying the variant allele that disrupting CTCF-binding locus at the enhancer of IL-6-AS1, the impact of IL-6-AS1 on IL-6 upregulation was minimal, and IL-6 is mainly regulated by its promoter activation. As a result, IL-6 was only modestly elevated upon inflammatory stimulation (Fig. 4f, right) .

Evolutionary origin of the risk-associated rs1800796, rs1524107, and rs2066992 polymorphisms. Given IL-6 plays a general role in host defense against pathogens, the evolutionary origins of rs1800796, rs1524107, and rs2066992 variations, which are carried in greater than 76% of modern East Asians and at high frequencies in other populations of Asian descent, are worthy of investigation. Comparing the sequences in Interestingly, a recent study reported a Neanderthal-derived region of chromosome 3 as the major genetic risk factor for severe COVID-19 in European and South Asian populations (4) . Archaic humans such as Neanderthals (occupied Europe and Western Asia) and Denisovans (ranged from Siberia to Southeast Asia) contribute genetically to the immune systems of modern human outside Africa (34) . This Neanderthal risk haplotype occurs at relatively high frequency in South Asia (30%) and Europe (8%) but is almost absent from East Asia (4), so it is unlikely to contribute COVID-19 susceptibility in East Asian populations. We then investigated whether the risk-associated IL-6 polymorphisms occurring at high frequency in modern East Asia were inherited from any ancient humans. Genomic DNA data for Neanderthals and Denisovans showed that both hominids harbored ancestral sequences at the 5 SNPs (Table 6 ). Next, we analyzed the genome data of early humans who inhabited the East Asia mainland. A 40,000-year-old human from Tianyuan Cave outside Beijing, China, yielded the oldest human genome sequence for early East Asians on record. The Tianyuan individual was derived from a population that was ancestral to many present-day Asians and Native Americans (35) . Interestingly, the Tianyuan man was heterogeneous at rs1524107 and rs2066992 and carried a T-T variant allele, suggesting this derived allele occurred 40,000 years ago in East Asia. The Tianyuan man has affinity to Native American populations. Indeed, a 12,000-year-old individual from North America (Anzick-1) was found to be a C-T-T homozygote. GoyetQ116-1, a 35,000-year-old European individual who shares more alleles with the Tianyuan man than other ancient Europeans, carried the variant T-T allele at rs1524107 and rs2066992 (Table 6 ). GoyetQ116-1 did not contribute to ancestry of present-day Europeans (35) , in agreement with the low frequency of this variant haplotype in modern Europeans (Fig. 1c) . We also analyzed the recently published genomic data of prehistoric humans who lived 4,000 to ;8,000 years ago in the China mainland (36) . Among 4 individuals with reads at the candidate polymorphic loci, all carried the variant T-T allele at rs1524107 and rs2066992 (no reads at the promoter SNPs rs1800795, rs1800796, and rs1800797), and 3 out of 4 were likely to be T-T homozygote (Yumin, LD1, and L5705) ( Table 6 ), supporting the continuity of these IL-6 polymorphisms in human history in East Asia. The ancient DNA evidence supports the idea that variations at rs1524107 and rs2066992 loci that disrupt an evolutionarily conserved CTCF binding site were derived from archaic humans who were ancestral to present-day mainland Asians and Native Americans. Unlike the Neanderthal risk haplotype (4), the IL-6 haplotype from ancient East Asians seems to have positive consequences for SARS-CoV-2 infection. In summary, this study provides evidence that an Asian-common IL-6 variant haplotype correlated with the lower production of IL-6 upon inflammatory stimuli, which provides a mechanism for the observed reduced risk of severe COVID-19 illness in patients carrying the variant alleles at rs1800796, rs1524107, and rs2066992 loci. It is conceivable that individuals with the low-producing variant genotype would avoid the prolonged and uncontrolled IL-6 synthesis in the disease progression of COVID-19 (Fig. 4f) .

Genetic differences underlie the differential susceptibility to infectious diseases. Numerous studies have shown that IL-6 polymorphisms were linked to the outcome of viral infections by affecting IL-6 protein production (17, 20, 21, 37, 38) . COVID-19 is a pulmonary disease caused by SARS-CoV-2 that exhibits varied severity, ranging from asymptomatic, mild to severe, and life-threatening lower respiratory tract infections, including the development of ARDS (39) . Elevated serum concentration of IL-6 is a hallmark of severe COVID-19, and the serum concentration of IL-6 is a predictive biomarker for disease severity of COVID-19 (7, (12) (13) (14) . These clinical observations suggest that IL-6 genotype underlies the differential outcomes of SARS-CoV-2 infection. The present study reported a novel association of SNPs rs1800796, rs1524107, and rs2066992 at the IL-6 locus with COVID-19 severity in a Chinese population. The wild-type haplotype G-C-G predisposed individuals to severe COVID-19, and the variant haplotype C-T-T was the protective allele. Variations of the three highly linked SNPs were associated with reduced expression and attenuated the induction of IL-6 and its antisense lncRNA IL-6-AS1 by poly(IÁC) and LPS treatment, suggesting the variant haplotype plays a protective role against severe COVID-19 by preventing excessive IL-6 production. To our knowledge, this study is the first report on IL-6 polymorphisms in clinical presentations of COVID-19 in Asian populations.

IL-6 is a pleiotropic cytokine that has anti-inflammatory and proinflammatory functions. Studies using an IL-6 knockout mouse model suggested that IL-6 was essential for viral clearance and/or T-and B-cell responses against influenza virus, vaccinia virus, and lymphocyte choriomeningitis virus (37) . However, numerous pieces of clinical and in vivo evidence suggest negative consequences of the exaggerated synthesis of IL-6 on the immune response. Increased systematic IL-6 was observed in patients infected with Andes virus, influenza virus, HBV, HCV, HIV, and coronaviruses SARS-CoV-2, SARS-CoV, and MERS (8) (9) (10) (11) 37) . High levels of IL-6 are often associated with the acute severe systemic inflammatory response known as a cytokine storm, and persistent elevation of IL-6 is a predictive factor of poor prognosis of patients with ARDS (40) and COVID-19 (7, (12) (13) (14) . Because of the conflicting effects of IL-6 during the progression of different infectious diseases, it is not surprising that the protective allele (rs1800796-C, rs1524107-T, and rs2066992-T) for COVID-19 identified in this study was the risk allele for blastomycosis in individuals of Hmong ancestry, in which high levels of IL-6 are beneficial for the development of antifungal T helper 17 (Th17) cells (15) . This low-producing IL-6 genotype was also detrimental for the spontaneous clearance of HBV and increased the risk of chronic HBV infection (16, 17, 41) , largely due to the inhibitory role of IL-6 in HBV entry and replication (38) . The prevalence of this variant genotype in East Asia may partially explain why China has the world's largest burden of HBV infection (42) . Considering the known plethoric effects of IL-6 on immunological outcomes, we expect polymorphisms at these loci to influence other infectious diseases.

The susceptibility loci we identified regulate IL-6 expression mainly by affecting the regulatory antisense lncRNA IL-6-AS1. The intronic SNP rs2066992-T allele disrupted a very conserved CTCF binding site at the enhancer elements of IL-6-AS1 (Fig. 2) , an antisense transcript of IL-6 that mirrors the expression of IL-6 (15, 32) (Fig. 3) . lncRNAs including IL-6-AS1 have been shown to influence the expression of a neighboring protein-coding gene in cis during the inflammatory response (43, 44) . Furthermore, a recent study reported that CTCF-dependent genome organization is required for rapid and robust activation of inflammatory genes, including IL-6, in an acute inflammatory response (30) . In this study, we found that carriers with the variant genotype were associated with lower expression of IL-6-AS1 under both unstimulated and stimulated conditions, while the IL-6 level was only affected by the genotype after inflammatory stimuli (Fig. 4) . Given the pivotal role of CTCF in the formation and maintenance of three-dimensional (3D) chromatin structure, the CTCF motif-altering SNP may fine-tune IL-6 expression mainly via differentially organized chromatin interactions in inflammatory conditions (30) . Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) assay is an emerging technology to study long-range chromatin interactions (45) . Using CTCF ChIA-PET data from the GM12878 cell line, we found that the IL-6 locus had strong remote interactions with multiple genes, including STEAP1B, AC002480.1, AC002480.2 (lncRNAs antisense to STEAP1B), and a pseudogene, AC073072.2 (see Fig. S3 in the supplemental material). Due to a lack of chromatin interaction data derived from individuals carrying the variant genotype at the three loci, the exact chromatin loop(s) and promoter-enhancer interactions disrupted by the motif-altering SNP are currently unknown. Future epigenetic studies, including spatial contact maps derived from different genetic backgrounds before and after inflammatory stimulations, will be needed to fully understand the role of the Asian-common haplotype on the IL-6 system.

A major limitation of the present study is the small sample size (n = 105), which decreased the statistical power of this study. Further study with a larger sample size must be conducted to obtain conclusive evidence of the association between IL-6 polymorphisms and IL-6 production and disease severity in Asian COVID-19 patients.

On the other side, GWAS had been carried out in European populations but did not find an association of IL-6 polymorphisms with severe COVID-19 (4, 5) . Instead, a Neanderthal-derived region of chromosome 3 had been suggested to be the major genetic risk factor (4). This haplotype in relatively common in European and South Asian populations but was almost absent from East Asia, indicating this Neanderthal haplotype underwent negative selection in East Asia in the past. IL-6 polymorphisms vary significantly between Caucasians and Asians. In East Asia, the low-producing IL-6 haplotype inherited from ancient East Asians, such as Tianyuan man, has beneficial effects with respect to the COVID-19 pandemic (Tables 4 and 6 ). The exact driving force for this low-producing IL-6 variant is currently unknown but likely is a pathogen-driven balancing selection to the historical pathogen prevalence in East Asia. In Europe, a high-producing IL-6 haplotype consisting of rs1800797 (2597 G . A) and rs1800795 (2174 G . C) occurs at a frequency of 30 to ;40% (Fig. 1) . rs1800797 and rs1800795 are located in the active promoter marked by H3K4me3 signature (Fig. 4a) , and the variant alleles correlated with higher expression of IL-6 ( Fig. 1) (19, 46) . Therefore, the haplotype endemic to Europe likely influences IL-6 expression by simple promoter activation and may be associated with higher expression of IL-6 in both unstimulated and stimulated conditions, so its regulatory mechanisms are different from those of the haplotype prevalent in East Asia. The net effect of this high-producing Caucasian IL-6 genotype on COVID-19 outcome might be neutral, as higher basal levels of IL-6 are beneficial for the activation of immune response and viral clearance, but continual synthesis of IL-6 exerts a pathological effect (37) , which may explain the lack of IL-6 polymorphisms association with COVID-19 in European populations.

The SNPs we identified may serve as a useful genetic tool to screen high-risk COVID-19 patients in Asian populations. Because of the high LD, rs1800796 or rs2066992 may be selected as a tag SNP to evaluate the risk of progression to severe symptoms. More attention should be paid to the IL-6 serum levels in patients harboring the high-producing IL-6 genotype, and appropriate treatment is needed, such as dexamethasone, a glucocorticoid compound that suppresses IL-6 transcription by binding to GRE at the IL-6 promoter (47, 48) (Fig. 1b) , or a humanized anti-IL-6 receptor antibody that directly inhibits IL-6 signaling, such as tocilizumab. Clinical trials showed that dexamethasone and tocilizumab improved hospital survival of severely ill COVID-19 patients (48) (49) (50) . We hypothesized that COVID-19 patients carrying the high-producing IL-6 genotype were more likely to benefit from dexamethasone and IL-6 blockade therapy. In contrast, patients carrying the low-producing genotype should avoid such therapy in the early phase of infection, as it may lead to inefficient immune activation. Therefore, IL-6 genotyping of rs1800796 could be included in dexamethasone and tocilizumab trials to maximize drug efficacy and safety in Asian populations.

Patient enrollment and sample collection. The study included 105 laboratory-confirmed COVID-19 cases and 149 healthy controls of Chinese ethnicity who were matched for age, sex, and geographic origin (Guangdong and Guizhou provinces). Their main demographic characteristics are listed in Table 1 . The laboratory-confirmed COVID-19 patients (aged $22 years) were hospitalized in the First Affiliate Hospital of Guangzhou Medical University (n = 25), People's Hospital of Yangjiang (n = 13), Qingyuan People's Hospital (n = 9), and Guizhou Provincial People's Hospital (n = 58) between 26 January and 4 May 2020. Patients with severe pneumonia who were admitted to the intensive care unit and required mechanical ventilation were enrolled in the severe illness group. Patients with a mild clinical presentation (primarily fever, cough, malaise, and headache, including nonpneumonia or mild pneumonia) were enrolled in the mild illness group. Among 105 patients, 35 patients were classified as severe cases, and 70 patients were mild cases. Informed consent was obtained from patients and healthy donors. The present study had IRB approval from the Health Commission of Guangdong Province and the ethics committees of each of the hospitals used to obtain patient and healthy donor samples. Written informed consent was obtained from all participants.

DNA extraction and SNP genotyping. Genomic DNA was extracted from blood samples using the QIAamp DNA blood minikit (Qiagen, Germany) according to the manufacturer's protocol. DNA fragments encompassing the SNPs of interest were amplified from genomic DNA samples, and the amplified PCR products were genotyped using Sanger sequencing.

Cell culture. The lung cancer cell line A549 and the cervical cancer cell line HeLa were purchased from ATCC (Manassas, VA) and cultured in DMEM (Dulbecco's modified Eagle medium) with 10% fetal calf serum (GIBCO). Epstein-Barr virus-transformed B lymphoblastoid cell lines (LCLs) from healthy donors were established as previously described (51) . Human peripheral blood mononuclear cells (PBMCs) were isolated via differential centrifugation using Ficoll-Paque (GE Healthcare, Shanghai, China) from buffy coats of healthy blood donors. PBMCs and LCLs were cultured in RPMI 1640 supplemented with 10% fetal calf serum (GIBCO). Cells were incubated at 37°C in a humidified environment with 5% CO 2 .

Quantitative real-time PCR. Cells were treated with TNF-a (300-01A-10; PeproTech) or LPS (L2880; Sigma) or transfected with poly(IÁC) (B5551; Apexbio) using Lipofectamine 3000 (L3000015; Thermo Fisher Scientific) for 12 h or infected with Sendai virus (kindly provided by Deyin Guo) for the indicated time points. Total RNA was isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol and reverse transcribed into cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Tokyo, Japan). Quantitative real-time PCR was carried out using Hieff qPCR SYBR green master mix (Yeasen, Shanghai, China) with gene-specific primers and cDNA templates according to the manufacturer's protocol. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a reference gene. The relative fold change in expression was calculated using the 2 2DDCT method. The primer sequences were IL-6-AS1-F, CGTCGAGGATGTACCGAATT; IL-6-AS1-R, GCAGCACAAGGCAAACCTCT; IL-6-F, TCCAGGAGCCCAGCTATGAAC; IL-6-R, CAGGACTTTTGTACTCATCTGC; GAPDH-F, GATGACCTTGCCCACAGCCT; and GAPDH-R, ATCTCTGCCCCCTCTGCTGA.

ChIP assay. ChIP in LCLs and human PBMCs were performed as described previously (44) . Six to eight million PBMCs were harvested and cross-linked with 1% formaldehyde. Cell lysates were incubated with 1 mg anti-CTCF rabbit antibody (10915-1-AP; Proteintech). Normal rabbit IgG was used as a negative control. Real-time PCR was used to quantify CTCF binding, and data are presented as permillage relative to the input. Primers for qPCR were the following: IL-6 target 1 primers, 2712 bp to 2470 bp, IL-6-T1-F, CCTCCTCTAAGTGGGCTGAAGC; IL-6-T1-R, TGAGTTTCCTCTGACTCCATCG; IL-6 target 2 primers, 11364 bp to 11535 bp, IL-6-T2-F, GGATGCCAATGAGTTGTAGCT; IL-6-T2-R, TGCCTCTTTGCTGCTTTCAC; IL-6 nontarget (NT) primers, 1329 bp to 1553 bp, IL-6-NT-F, ATTCCAAAGATGTAGCCGCCC; IL-6-NT-R, CTACAGTGCTCTAGAACCCAGC; and H19 primers, H19-F, CCCATCTTGCTGACCTCAC; H19-R, AGACCTGGGACGTTTCTGTG. For ChIP-seq analysis, sequenced reads were mapped to the human reference genome hg19 using bowtie2. The signal track visualized on Integrative Genomics Viewer (IGV) was fold enrichment over the control. The signal track of GM12878 (an LCL with homozygous WT genotype at the IL-6 candidate loci) was downloaded from ENCODE with accession number ENCFF271YKQ. ChIP-seq data of two LCLs harboring the IL-6 homozygous variant genotype were generated in-house and are available upon request.

Software and database. IL-6 expression data of LCLs was downloaded from the Gene Expression Omnibus (GEO) website with accession number GSE6536. From the 1000 Genomes Project data, we extracted genotypes of 174 individuals whose gene expression data were available in GSE6536. LD analysis was performed on HaploView, and the population frequencies of SNPs were from the 1000 Genomes Project. Visualization of SNP worldwide frequency was done using GGV (http://www.popgen .uchicago.edu/ggv). Processed and normalized data of DNA methylation quantitative trait loci (meQTL) in colorectal cancer (CRC) was acquired from Pancan-meQTL (http://gong_lab.hzau.edu.cn/Pancan -meQTL/). The genotype-specific expression of rs1800796, rs1524107, and rs2066992 in lung tissues via cis-expression quantitative trait loci (cis-eQTL) analysis was evaluated using the Genotype-Tissue Expression (GTEx) portal (https://gtexportal.org/home/). IL-6-AS1 and IL-6 expression profiles of several cell lines were downloaded from the ENCODE project (https://www.encodeproject.org/). CTCF ChIP-seq data were downloaded from ENCODE and Sequence Read Archive (SRA) (the accession numbers are listed in Table S3 in the supplemental material). Data for H3K4me3 ChIP-seq and DNase-seq in resting CD14 1 monocytes were downloaded from ENCODE with accession numbers ENCFF231OTU and ENCFF861JZY, respectively. To analyze IL-6-AS1 and IL-6 expression profiles, RNA-seq data of human monocytes treated with LPS or nonstimulated (NS) cells were downloaded from study E-MTAB-2399 in the EBI database (https://www.ebi.ac.uk/arrayexpress) with accession numbers ERR458839 and ERR458836, respectively. All sequencing data were visualized using IGV.

Aligned sequences of Altai Neanderthal, Denisovan, Tianyuan, GoyetQ116-1, and Vestonice16 were obtained from the European Nucleotide Archive (ENA; https://www.ebi.ac.uk/ena/browser/home). Sequences of Anzick-1 was acquired from the SRA. Sequences of Yumin, BS, LD1, and L5705 were from the Genome Sequence Archive in the BIG Data Center (GSA; https://bigd.big.ac.cn/gsa-human). The accession numbers for the ancient human genome data are listed in Table 6 .

Statistical analyses. Pearson correlation analysis was used to evaluate the association between IL-6-AS1 and IL-6 expression in several cell lines. The allele and genotype frequencies were determined via direct counting. When comparing baseline information of the subjects, P values were determined using Mann-Whitney U test, Pearson chi-square (x 2 ) test, or Fisher's exact test. The Pearson x 2 test was used to compare allele and genotype distributions in patients with mild and severe symptoms. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using logistic regression to evaluate the association of IL-6 genotypes and COVID-19 severity, adjusted for sex and age. All computations were done using SPSS software (version 22.0). Comparisons of IL-6 expression in different populations and genotypes were performed with nonparametric Kruskal-Wallis tests. Data analysis of CTCF enrichment and IL-6-AS1 expression in different groups was performed using one-way analysis of variance (ANOVA) with Bonferroni correction for multiple comparisons. Bivariate analyses comparing gene expression in PBMC with different genotypes and LPS stimulation were performed using multiple t test with Bonferroni correction for multiple comparisons in GraphPad Prism 8. P values of ,0.05 were defined as statistically significant. *, P , 0.05; **, P , 0.01; ***, P , 0.001; and ****, P , 0.0001.

Data availability. The data that support the findings of this study are available upon request.

Supplemental material is available online only. We thank the participants who contributed to this study and to the medical staffs who recruited the subjects. We thank Tong-Min Wang and Tuoheti Reheman for assistance with biostatistics. We thank Qiaomei Fu for helpful comments on the manuscript.

L.F. conceived the project. L.F., X.Y.Z., J.Z., Y.L., N.Z., T.C., Y.X.L., and Y.Z. designed the study and analyzed the data. Y.X.L. and T.C. performed most experiments. Y.X.L. conducted statistical analyses. Y.Z., T.C., S.W.L., F.Y., Z.S.C., B.H.K., J.J.L., Y.N., Y.X., D.B.T., B.Y., Q.X., L.Y., Y.L., X.Y.Z., and J.Z. collected clinical samples. Z.Y., J.T., Y.S., and Y.Z.L. helped with genomic DNA extraction, PCR, and PBMC preparation. M.Z. helped with epigenetic data analysis. T.C., Y.X.L., and L.F. wrote the manuscript.

We declare that no conflict of interest exists.

Clinical characteristics of coronavirus disease 2019 in China

Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study

Presence of genetic variants among young men with severe COVID-19

The major genetic risk factor for severe COVID-19 is inherited from Neanderthals

Genomewide association study of severe Covid-19 with respiratory failure

IL-6: relevance for immunopathology of SARS-CoV-2

The role of interleukin-6 in monitoring severe case of coronavirus disease 2019

The balance between the serum levels of IL-6 and IL-10 cytokines discriminates mild and severe acute pneumonia

The role of IL-6 in host defence against infections: immunobiology and clinical implications

IL-6 in inflammation, immunity, and disease

Clinical progression and cytokine profiles of Middle East section

Clinical features of patients infected with 2019 novel coronavirus in Wuhan

Clinical value of immune-inflammatory parameters to assess the severity of coronavirus disease 2019

Clinical predictors of mortality due to COVID-19 based on an analysis of data of 150 patients from Wuhan, China

Investigation of genetic susceptibility to blastomycosis reveals interleukin-6 as a potential susceptibility locus

IL-6 promoter functional polymorphism -572C/G affects spontaneous clearance of hepatitis B virus infection

Interleukin-6 gene variants are associated with reduced risk of chronicity in hepatitis B virus infection in a Malaysian population

Variants at the promoter of the interleukin-6 gene are associated with severity and outcome of pneumococcal community-acquired pneumonia

Cooperative influence of genetic polymorphisms on interleukin 6 transcriptional regulation

Interleukin 6 promoter polymorphisms influence the outcome of chronic hepatitis C

Cytokine gene polymorphisms and their association with cervical cancer: a North Indian study

A functional single-nucleotide polymorphism in the promoter of the gene encoding interleukin 6 is associated with susceptibility to tuberculosis

A global reference for human genetic variation

Relative impact of nucleotide and copy number variation on gene expression phenotypes

Pancan-meQTL: a database to systematically evaluate the effects of genetic variants on methylation in human cancer

Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production

Differential expression of inflammatory cytokines and stress genes in male and female mice in response to a lipopolysaccharide challenge

The ENCODE (ENCyclopedia of DNA Elements) Project

CTCF: an architectural protein bridging genome topology and function

CTCF is dispensable for immune cell transdifferentiation but facilitates an acute inflammatory Interleukin-6 Polymorphisms in COVID-19 Severity ® response

The Genotype-Tissue Expression (GTEx) pilot analysis: multitissue gene regulation in humans

Interleukin-6 gene polymorphisms correlate with the progression of nephropathy in Chinese patients with type 2 diabetes: a prospective cohort study

AS-IL6 promotes glioma cell invasion by inducing H3K27Ac enrichment at the IL6 promoter and activating IL6 transcription

The shaping of modern human immune systems by multiregional admixture with archaic humans

000-year-old individual from Asia provides insight into early population structure in Eurasia

Ancient DNA indicates human population shifts and admixture in northern and southern China

The role of interleukin 6 during viral infections

IL-6 plays a crucial role in HBV infection

Molecular pathology of emerging coronavirus infections

Persistent elevation of inflammatory cytokines predicts a poor outcome in ARDS. Plasma IL-1 beta and IL-6 levels are consistent and efficient predictors of outcome over time

Interleukin-6 promotor gene polymorphisms and susceptibility to chronic hepatitis B virus in Egyptians

The global burden of liver disease: the major impact of China

Local regulation of gene expression by lncRNA promoters, transcription and splicing

Long non-coding RNAs and enhancer RNAs regulate the lipopolysaccharide-induced inflammatory response in human monocytes

CTCF-mediated human 3D genome architecture reveals chromatin topology for transcription

Genetic polymorphism directs IL-6 expression in fibroblasts but not selected other cell types

Glucocorticoids inhibit the production of IL6 from monocytes, endothelial cells and fibroblasts

Dexamethasone in hospitalized patients with Covid-19-preliminary report

Effective treatment of severe COVID-19 patients with tocilizumab

Tocilizumab among patients with COVID-19 in the intensive care unit: a multicentre observational study

Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines