key: cord-0920596-cu4jptpg
authors: Louise-Eva, V.A.N.D.E.N.B.O.R.G.H.T.; ENAUD, Raphaël; URIEN, Charlotte; CORON, Noémie; Pierre-Olivier, G.I.R.O.D.E.T.; FERREIRA, Stéphanie; BERGER, Patrick; DELHAES, Laurence
title: Type 2-high asthma is associated with a specific indoor mycobiome and microbiome
date: 2020-09-12
journal: J Allergy Clin Immunol
DOI: 10.1016/j.jaci.2020.08.035
sha: 8da1c1b9a4a0dda811a0cdea38a8bf02f884d638
doc_id: 920596
cord_uid: cu4jptpg

Background The links between microbial environmental exposures and asthma are well documented, but no study has combined deep-sequencing results from pulmonary and indoor microbiomes of asthmatic patients with spirometry, clinical and endotype parameters. Objective The goal of this study was to investigate the links between indoor microbial exposures and pulmonary microbial communities and to document the role of microbial exposures on inflammatory and clinical outcomes of patients with severe asthma (SA). Methods Fifty-five SA patients from the national COBRA cohort were enrolled for analyzing their indoor microbial flora through the use of electrostatic dust collectors (EDCs). Among these patients, 22 were able to produce sputa during stable or pulmonary exacerbation periods and had complete pairs of EDC and sputum samples, both collected and analysed. We used amplicon targeted metagenomics to compare microbial communities from EDC and sputum samples of patients according to type 2 (T2)-asthma endotypes. Results Compared to patients with T2-low SA, patients with T2-high SA exhibited an increase in bacterial alpha-diversity and a decrease in fungal alpha-diversity of their indoor microbial floras, the latter being significantly correlated with FeNO levels. The beta-diversity of the EDC mycobiome significantly clustered according to T2 endotypes. Moreover, the proportion of fungal taxa in common between sputum and EDC samples was significantly higher when patients exhibited acute exacerbation. Conclusion These results illustrated, for the first time, a potential association between the indoor mycobiome and clinical features of SA patients, which should renew interest in deciphering the interactions between indoor environment, fungi, and host in asthma.

Microbiome and Mycobiome analysis of induced sputum samples (Respiratory samples (R)) and electrostatic dust collector located at patient's bedroom (Indoor samples (I))

The analysis were based on bacterial (V3-V4 locus of 16S gene) and fungal (ITS2 region of rDNA) amplification using a 250-bp paired-end technology on MiSeq (Illumina) platform.

Patients with type 2-high severe asthma revealed a specific indoor microbial environment 

(3) Indoor and Respiratory mycobiomes: More fungal taxa are significantly shared with indoor mycobiome during exacerbation periods, compared to clinical stability periods I I R R

(1) FeNO level is correlated with indoor fungal Chao1 indexes

(2) Beta-diversity of indoor fungal communities is clustered according to T2 endotypes

GenoScreen. POG reports personal fees and non-financial support from AstraZeneca, 26

Boehringer Ingelheim, Chiesi, GlaxoSmithKline, Novartis and Sanofi outside the submitted 27 work. PB is the medical coordinator of COBRA, which received grants from AstraZeneca, 28

GlaxoSmithKine, Roche, Chiesi, Novartis and Legs Poix foundation. Moreover, PB reports 29 grants and personal fees from Novartis; personal fees and non-financial support from Chiesi; 30 grants, personal fees and non-financial support from Boehringer Ingelheim; personal fees and 31 non-financial support from AstraZeneca; personal fees and non-financial support from Sanofi; 32 personal fees from Menarini; and personal fees from TEVA outside the submitted work. In Among these patients, 22 were able to produce sputa during stable or pulmonary exacerbation 51 periods and had complete pairs of EDC and sputum samples, both collected and analysed. We 52 used amplicon targeted metagenomics to compare microbial communities from EDC and 53 sputum samples of patients according to type 2 (T2)-asthma endotypes. 54

Results: Compared to patients with T2-low SA, patients with T2-high SA exhibited an 55 increase in bacterial alpha-diversity and a decrease in fungal alpha-diversity of their indoor 56 microbial floras, the latter being significantly correlated with FeNO levels. The beta-diversity 57 of the EDC mycobiome significantly clustered according to T2 endotypes. Moreover, the 58 proportion of fungal taxa in common between sputum and EDC samples was significantly 59 higher when patients exhibited acute exacerbation. Asthma is a complex, chronic inflammatory disease of the airways that affects 339 million 109 people worldwide (1, 2) . Despite recent advances in new treatments and notable efforts to 110 elucidate asthma pathophysiology (2), patients with severe asthma (SA) remain at high risk 111 for complications, exacerbations, poor quality of life and increased mortality and morbidity 112 (1, 2) . According to the definition of SA proposed by the international ERS/ATS Task Force 113

(3), SA is still recognized as a major unmet need, with an overall prevalence estimated at 5-10% 114 (1-3) and accounting for approximately 50% of asthma-associated health care costs (1) . 115

Similar to non-severe asthma, SA is currently accepted as a heterogeneous disease comprising 116 multiple endotypes that combine clinical characteristics with several identifiable mechanistic 117 pathways (3). Developments in biologic medications to treat asthma have allowed for specific 118 endotypes to be targeted, such as allergic asthma, eosinophilic asthma and, more recently, 119 type 2 (T2)-high asthma. It is now standard practice to differentiate SA patients in T2-high 120 and T2-low asthma based on the levels of both the fraction of exhaled nitric oxide (FeNO) 121 and the blood eosinophil counts (4). 122 SA is also associated with microbial lung dysbiosis, which activates the inflammasome and 123 other induced pathways (5-7). In agreement with the hygiene hypothesis, recent findings have 124 demonstrated that exposure to environmental microbes significantly decreases the incidence 125 of wheezing illnesses in young children with a genetic susceptibility at chromosome 17q21 126 7 To this end, we examined whether the indoor fungal and bacterial flora (exogenous 133 mycobiome and microbiome, respectively) are associated with clinical parameters in SA 134 patients and how the exogenous and endogenous mycobiomes and/or microbiomes were 135 connected. were determined at COBRA visits as previously described (16). Patients with T2-high SA 146 were defined according to either a level of FeNO higher than 25 ppb or a blood eosinophil 147 count higher than 300 cell/mm 3 (7). In contrast, patients with T2-low SA were defined 148 according to both a FeNO level lower than 25 ppb and a blood eosinophil count lower than 149 300 cell/mm 3 . 150 151

Induced sputa were successfully collected from 22 patients, as previously described (17). 153

Indoor dust samples were collected using an electrostatic dust collector (EDC), Briefly, each 154 EDC consists of a 20 cm × 17 cm textile surface that is used to catch fungi and bacteria 155 during the exposure period (18). This textile device is mounted in a plastic folder that is left 156 open for 10 weeks in a horizontal position with the textile exposed to the room air such that France). Negative extraction controls (250 µl of DNA-free water, as an extraction blank) were 164 processed using the same protocol. The microbial diversity and taxonomic composition of 165 samples were assessed using the V3-V4 region of the bacterial 16S rRNA gene and the 166 internal transcribed spacer 2 (ITS2) region of the fungal rDNA following optimized and 167 standardized library preparation protocols from Metabiote® (Genoscreen, Lille, France) (20). 168

The primers used to amplify the V3-V4 and ITS2 loci were 16S-Forward 169 (TACGGRAGGCAGCAG) and 16S-Reverse (CTACCNGGGTATCTAAT) as well as ITS2-170

(GTGARTCATCGAATCTTT) and ITS2-Reverse 171 (GATATGCTTAAGTTCAGCGGGT), respectively. In addition to the extraction blanks, two 172 negatives controls (one library blank and one unexposed EDC but analysed following the 173 same process as the exposed EDCs) and two positive controls (artificial bacterial and fungal 174 communities) were used to valid the experimental procedures. Briefly, PCR amplification was 175 performed using barcoded primers (at 0.2 µM final concentration), with an annealing 176 temperature of 50°C for 30 cycles. PCR products were purified using magnetic beads, 177 quantified according to the protocol provided by GenoScreen, and mixed in equimolar 178 amounts. NGS sequencing was performed using 250-bp paired-end technology on a MiSeq 179 platform (Illumina, San Diego, CA, USA) at GenoScreen (GenoScreen, Lille, France). 180

The resulting raw sequences were subjected to a cleaning process as follows: i) sorting the 181 sequences according to the indexes and the 16S and ITS2 primers using CutAdapt, with no 182 mismatch allowed within the primers sequences; ii) quality-filtering using the PRINSEQ-lite 183 PERL script by truncating bases at the 3' end with Phred quality scores <30; and (iii) 184 generating a paired-end read assembly using FLASH with a minimum overlap of 30 bases and 185 a >97% identity. The bioinformatic analysis was performed on a fully automated (Metabiote® 186 OnLine v2.0) pipeline using QIIME v 1.9.1 software (21). Following pre-processing steps, the 187 full-length 16S and ITS2 amplicons were assessed for chimeric sequences using an in-house 188 method based on Usearch 6.1. Then, a clustering step was performed to group similar 189 sequences with a defined nucleic identity threshold (97% identity for an affiliation at least at 190 the genus level for the V3-V4 locus and at the species level for the ITS2 locus) using Uclust Fifty-five SA patients were enrolled, but only 22 SA patients had complete pairs of EDC and 238 sputum collected and analysed (Supplemental Figure E1 ). Patient characteristics from the T2-239 high and T2-low groups are summarized in Table 1 . Except for FeNO levels, the 240 characteristics of patients with T2-high SA were not significantly different from those with 241 T2-low SA. Similarly, sputum microbial cultures and indoor fungal loads measured by qPCR 242

were not significantly different between the two SA groups (Table 1) . 243 244

Patients with T2-high SA showed an increase in the three alpha diversity metrics for the EDC 246 bacterial communities compared to those observed for the T2-low SA patients, but only the 247 Shannon and Simpson indexes were statistically significant (Fig 1, A) . In contrast, the same 248 three alpha diversity metrics for the EDC fungal communities were lower for the patients with 249 T2-high SA compared to those observed for the T2-low SA patients, but only the Shannon 250 indexes were statistically significant (Fig 1, B) . FeNO levels were significantly correlated 251 with the alpha-diversity of the mycobiome as measured by Chao1 index values (Fig 1, C) versicolor (see Fig E3) . All bacterial and fungal OTUs were then submitted to the LEfSe 264 method using T2 endotypes as covariables. 265

LEfSe analysis results indicated significant community enrichment of EDCs from patients 266 with FeNO >25 ppb and T2-high SA as a covariable, which was composed of 7 families and 267 10 genera of bacterial OTUs (Fig 2, A) and 2 genera plus 5 species of fungal OTUs (Fig 2, B) . 268

While enrichments of EDCs from patients with low FeNO levels were primarily composed of 269 environmental Basidiomycota OTUs (Fig 2, B) Twenty-two patients were able to produce induced sputum during clinically "stable" (n=10, 278 including 9 T2-high SA and 1 T2-low SA patients) or "exacerbated" (n=12, including 7 T2-279 high SA and 5 T2-low SA patients) periods defined at COBRA visit. Both the bacterial and 280 fungal diversities of these sputa were lower than those of the corresponding EDCs (Fig 3, A) . 281

The taxonomic composition of these two types of samples was significantly different (Fig 3,  282 B-D; see Fig E2-E5) . These results revealed the highly individual signature of sputum 283 mycobiomes and microbiomes compared to that observed for EDCs, which exhibited a very 284 closely spaced clustering of samples (Fig 3, C and D) . For instance, the proportion of 285 Ascomycota, which includes medically relevant fungi, was higher in EDCs compared to sputa 287 (Fig 3, B) , highlighting the complex microbial ecology of the human respiratory tract. 288

We did not observe any differences in the bacterial and fungal diversities of these sputum 289 samples according to T2 endotypes (data not shown). In contrast, the proportion of common 290 bacterial taxa between the EDCs and sputa was similar when sputa were collected during 291 exacerbation or at a stable state (Fig 3, E) , whereas the proportion of common fungal taxa 292 between EDCs and sputa was significantly higher when sputa were collected during 293 exacerbation period compared to the stable period (Fig 3, F) . The Venn diagram results 294 confirmed a limited bacterial core composed of 5 OTUs (Fig 4, A) and a large fungal core 295 composed of 27 OTUs (Fig 4, B) . 296

We identified the core microbes between pairs of sputa and EDCs according to the absence or 297 presence of an asthma exacerbation and confirmed that only one OTU was shared between the 298 bacterial core and the clinical states (i.e., Sphingomonas genus, Fig 4, A) . Surprisingly To the best of our knowledge, this pilot study is the first to report that the indoor mycobiomes 313 and microbiomes of SA patients exhibit distinct signatures according to T2 endotypes. Based 314 on pairs of EDC and sputum samples, we compared exogenous and endogenous microbial 315 communities and identified a fungal core comprising medically relevant fungi that was 316 significantly more pronounced when sputa were collected during asthma exacerbations. 317

Regarding the indoor environment, we clearly demonstrated that a higher bacterial alpha-318 diversity together with a lower fungal alpha-diversity was associated with T2-high SA 319 patients and that the fungal beta-diversity of EDC communities was clustered according to T2 320 endotypes. Moreover, the indoor mycobiomes and microbiomes of patients with FeNO >25 321 ppb and T2-high SA were significantly enriched for medically relevant fungi and bacteria. 322

Among them, we identified changes in the relative abundances of Sphingomonadaceae, 323

Methylocystaceae, Erwinia, Sphingomonas, Pseudomonas, and Candida, which is in 324 agreement with previously published data on the gut microbiota and allergy/asthma (27). 325

Although not exclusively focused on T2 endotypes, several studies have previously 326 investigated the respiratory microbiomes or mycobiomes of patients with varying degrees of 327 asthma severity (28-42). Among these studies, an association between Firmicutes and 328

Actinobacter with SA has been reported (33,35). In addition, an excess of Proteobacteria was 329 shown to be associated with moderately severe to severe asthmatics (33,35), while an excess 330 of Streptococcus was shown to be associated with eosinophilic asthma (42). However, little is 331 known regarding the lung mycobiome in chronic respiratory diseases. Malassezia yeasts have 332 been shown to be significantly associated with asthma and more recently with exacerbation in 333 cystic fibrosis (26,29). The mycobiomes of SA patients were shown to harbour higher loads of 334 fungi compared to non-severe asthmatic or healthy individuals (28), with a lower diversity 335 observed in T2-high asthma patients (7). A low indoor fungal diversity has been proposed to 336 considered adult patients with asthma with respect to its severity and control, none of them 338 referred to T2 endotypes and combined exogenous to endogenous mycobiome and 339 microbiome analyses. 340

The first studies of indoor microbial ecology used culture-based techniques (44) patients. Moreover, our indoor data are congruent with the recent identification of patients with T2-high asthma (7). 362

In addition to viral infections, fungal sensitization and fungal exposure have been shown to be 363 highly associated with asthma exacerbations and was recently reviewed (46). We confirmed 364 that fungal exposure may be a key player during exacerbation, as the fungal OTU proportion 365 shared by EDCs and sputa was significantly higher when sputa were collected during asthma 366 exacerbation. These results support the idea that microbial analysis should not be restricted to 367 a specific type of microorganism (viruses, bacteria, or fungi) but rather should involve 368 analyses of inter-kingdom interactions that may be involved in promoting exacerbations 369 (7,26). 370

FeNO is an endogenous gaseous molecule incorporated into the clinical management of 371 chronic respiratory diseases and is currently recognized as a biomarker of T2 airway 372 inflammation (54). Using conventional mycological methods (i.e., cultures and PCR), FeNO 373 levels of patients with asthma have been related to environmental exposure (55), while the 374 indoor isolation of A. versicolor and Cladosporium have been associated with higher FeNO 375 levels (56,57), which is in agreement with our results. FeNO levels were shown to be 376 positively correlated with T2 cytokine levels in asthmatics and with serum IL-17A levels in 377 SA patients (58). As adaptive antifungal immunity includes both Th2 and Th17-type CD4+ T 378 cells, we hypothesize that a number of the fungi isolated from the indoor mycobiome of SA 379 patients (such as Aspergillus and Cladosporium species) should contribute to a detrimental 380 immunopathology in SA patients. Once fungi are inhaled and colonize the respiratory airways 381 of patients, they participate in complex microbial-host interactions by producing secondary 382 metabolites that are well-known to be involved in this immune response, such as cell-wall 383 components (β-glucan and/or chitin) or secreted enzymes (proteases and/or glycosidases, or and the limited number of fully analysed pairs of EDC plus sputum, which reflects sampling 387 difficulties of the respiratory tract. Indeed, the small number of patients limits the 388 generalizability of our results, especially regarding LEfSe results. For instance, the absence of 389 difference between the T2-low and T2-high SA groups with respect to the exacerbation rate is 390 probably underpowered. We used induced sputa to analyse the endogenous microbiomes and 391 mycobiomes, a sampling method recently proposed as an acceptable and less invasive 392 alternative compared to bronchoalveolar lavage (BAL) samples but with several biases (60-393 62). In addition, since only patients with higher than 50% predicted post-bronchodilator FEV-394 1 were allowed to achieve induced sputum, which can be considered to be a bias of selection. 395

As most of the published studies on this topic have focused on asthma-associated 396 microbiomes and mycobiomes, this study suffers from small size limitations and a lack of 397 longitudinal data. Furthermore, amplicon deep-sequencing represents a promising method, but 398 protocols need to be improved and standardized. Indeed, there are many potential biases, 399 ranging from the primer, amplification protocol and NGS machine used to the pipeline and 400 databases selected for analysis (10,63). Thus, further studies are warranted to confidently 401 determine the relationships between the indoor environment, the lung mycobiome and 402 microbiome, the inflammatory response, and the development and severity of asthma. 403

In summary, in the present study, we identified a correlation between the indoor mycobiome 404 and FeNO levels of patients with SA (Fig 1C) , between EDCs (green section) and sputa collected either during an EXA (sputa collected 627 during an exacerbation, red section) or an STB period (sputa collected during a stable state, 628 blue section). Only OTUs present at least in 20% of each group of sputa (clustered according 629 the presence or absence of an EXA when sputa were collected) and at least in 90% of EDCs 630 were taken into account and represented in the Venn diagrams. The bacterial core (A) showed 631 only one OTU corresponding to Sphingomonas sp. shared between EDCs and sputa collected 632 during an exacerbation, and four OTUs belonging to Streptococcus, Paracoccus and 633

Haemophilus species were shared independently from the clinical state of the patients. The 634 fungal core (B) was larger than the bacterial core and was composed of nine OTUs associated 635 with sputa collected during an exacerbation (EXA), one (Alternaria brassicae) associated 636 with sputa collected at stable state (STB), and seventeen OTUs (including several medically 637 relevant fungi, such as Malassezia, Aspergillus, and Cladosporium species) belonging to the 638 fungal core independent from the clinical state. 639 

GINA annual report

The State of Asthma Research: Considerable Advances, but Still a Long 418

ERS/ATS guidelines on definition, evaluation and treatment of severe asthma

Investigation of 423 the relationship between IL-6 and type 2 biomarkers in patients with severe asthma

Sputum microbiota in severe 426 asthma patients: Relationship to eosinophilic inflammation

Potential Role of the Lung Microbiome in Shaping Asthma Phenotypes

Next-generation DNA sequencing reveals that low fungal diversity in house dust is 443 associated with childhood asthma development

Indoor fungal diversity and 445 asthma: a meta-analysis and systematic review of risk factors

Indoor 448 fungal diversity in primary schools may differently influence allergic sensitization and 449 asthma in children

Early-451 life home environment and risk of asthma among inner-city children

Innate 454 Immunity and Asthma Risk in Amish and Hutterite Farm Children

standard operating procedure for measuring microorganisms in dust from dwellings in 465 large cohort studies

DNA metabarcoding to assess indoor fungal 467 communities: Electrostatic dust collectors and Illumina sequencing

Genes and Bacterial Communities During Organohalide Respiration of Chloroethenes in 471 Microcosms of Multi-Contaminated Groundwater

QIIME allows analysis of high-throughput community sequencing data

Search and clustering orders of magnitude faster than BLAST

Naive Bayesian classifier for rapid 478 assignment of rRNA sequences into the new bacterial taxonomy

Functional relevance of microbiome signatures: The correlation era 488 requires tools for consolidation

Corticosteroid treatment is associated with increased filamentous fungal burden in 491 allergic fungal disease

Differences in fungi present in induced sputum samples from asthma patients and non-494 atopic controls: a community based case control study

T-helper cell type 2 496 (Th2) and non-Th2 molecular phenotypes of asthma using sputum transcriptomics in U

Linking microbiota and respiratory disease

Analysis of the fungal microbiome in exhaled breath condensate of patients with asthma

Airway Microbiota 504 in Severe Asthma and Relationship to Asthma Severity and Phenotypes

The upper 586 respiratory tract as a microbial source for pulmonary infections in cystic fibrosis

Mycobiome 589 diversity: high-throughput sequencing and identification of fungi

* p-value according to Man-Whitney test used for quantitative variables analysis and Fisher's exact test for qualitative 643 variables. The values are presented as the mean [SD] or total count (%). **Asthma control as per the ACQ-7. ***ICS