key: cord-0916948-8oki8xr2
authors: Nazmi, Ali; Hauck, Rüdiger; Corbeil, Lynette B.; Gallardo, Rodrigo A.
title: The effect of diatomaceous earth in live, attenuated infectious bronchitis vaccine, immune responses, and protection against challenge
date: 2017-04-17
journal: Poult Sci
DOI: 10.3382/ps/pex093
sha: 0185df64da339e8d1b822db72fee79a25edeb759
doc_id: 916948
cord_uid: 8oki8xr2

Live virus vaccines are commonly used in poultry production, particularly in broilers. Massive application and generation of a protective local mucosal and humoral immunity with no adverse effects is the main goal for this strategy. Live virus vaccines can be improved by adding adjuvants to boost mucosal innate and adaptive responses. In a previous study we showed that diatomaceous earth (DE) can be used as adjuvant in inactivated vaccines. The aim of this study was to test DE as adjuvant in an Ark-DPI live infectious bronchitis virus (IBV) vaccine after ocular or spray application. Titrating the virus alone or after addition of DE showed that DE had no detrimental effect on the vaccine virus. However, adding DE to the vaccine did not induce higher IgG titers in the serum and IgA titers in tears. It also did not affect the frequency of CD4(+) T cells, CD8(+) T cells and monocytes/macrophages in the blood and the spleen determined by flow cytometry. In addition, protection generated against IBV homologous challenges, measured by viral load in tears, respiratory signs and histopathology in tracheas, did not vary when DE was present in the vaccine formulation. Finally, we confirmed through our observations that Ark vaccines administered by hatchery spray cabinet elicit weaker immune responses and protection against an IBV homologous challenge compared to the same vaccine delivered via ocular route.

Infectious bronchitis virus (IBV) is a Gamma coronavirus and the causal agent of IB. This disease causes significant economic losses in the poultry industry worldwide. To date, vaccination is the most widely used method to control IBV. Live, attenuated vaccines are the most commonly used in commercial poultry, particularly in broiler chickens. These vaccines are usually applied massively, through drinking water or spray and/or individually via the eye drop route. The main objective of the strategy is the generation of a protective local mucosal and humoral immunity. Secondary effects of live, attenuated IBV vaccination, such as mild respiratory signs as well as reduced egg production and eggshell quality in layers (Bwala et al., 2012) , are a common outcome of their use. Due to the dozens of recognized serotypes and even more genotypes, IBV vaccination is challenging. The constant surveillance of field strains and the use of homologous vaccines is the only strategy to avoid failed protection against heterol-C 2017 Poultry Science Association Inc. Received January 25, 2017. Accepted March 17, 2017. 1 Corresponding author: ragallardo@ucdavis.edu ogous strains (Capua et al., 1999; Cavanagh, 2003; Cook et al., 2012) . Therefore, improving live virus vaccines by adding components, such as adjuvants to boost mucosal innate and adaptive responses, is worth investigating.

Adjuvants have been used for decades in vaccine formulation. Oil-based emulsions and aluminium derivatives are routinely used in poultry inactivated vaccines to increase their immunogenicity and improve antigen delivery (Spickler and Roth, 2003) . However, the use of adjuvants substantially increases the price of inactivated vaccines (Meeusen et al., 2007) . Experimental utilization of adjuvants in live, attenuated vaccines for poultry has been previously investigated. Mucosal immune responses and protection of chickens against Newcastle disease virus (NDV) challenge after live attenuated vaccination of NDV were improved by using chitosan nanoparticles as adjuvant (Zhao et al., 2012) . In addition, better antibody responses and protection against challenge in chickens was demonstrated when a live IBV vaccine was mixed with various types of adjuvants compared with a non-adjuvanted vaccine (Deville et al., 2012) . Kjaerup and co-workers tested mannosebinding lectin ligands such as mannan, chitosan, and fructo-oligosaccharide as adjuvants in live IBV vaccines with mixed success (Kjaerup et al., 2014) . In this study, we investigated the use of diatomaceous earth (DE) as 2623 an inexpensive and readily available adjuvant to boost local mucosal and adaptive immune responses generated by an IBV live, attenuated vaccine.

DE is a natural siliceous sediment of fossilized remains of microalgae called diatoms (Dolatabadi and de la Guardia, 2011) . The surface of DE is covered with numerous porous silica capsules, increasing its total surface and allowing its use as a drug-delivery carrier (Aw et al., 2013; Wang et al., 2013) . In addition, silica, the main component of DE, has been reported to have higher colloid stability than aluminium hydroxide and to act as an adjuvant (Lincopan et al., 2009) . We have previously demonstrated that DE possess adjuvant capabilities comparable to aluminium hydroxide when used to formulate NDV inactivated vaccines (Nazmi et al., 2017) .

In this study, we investigated the use of DE as an inexpensive and readily available adjuvant to boost local mucosal and adaptive immune responses generated by an IBV live, attenuated vaccine.

A commercial live, attenuated IBV Ark Type live virus MILDVAC R -ARK vaccine (Merck, Omaha, NE) was reconstituted in sterile phosphate-buffered saline (PBS) following the manufacturer's instructions. The vaccine was titrated in 10-day-old, embryonated, specific-pathogen-free (SPF) eggs (Charles River, Franklin, CT) according to routine procedures (Villegas, 2008) . For the challenge, we used a virulent IBV Ark-DPI strain kindly provided by Dr. Haroldo Toro, Auburn University, Auburn, AL (Gallardo et al., 2011) .

To test the effect of DE on IBV ArkDPI vaccine virus viability, the vaccine was reconstituted in tryptose phosphate broth (TPB) (Becton, Dickinson and Company, Sparks, MD). Half of the vaccine final volume was mixed with 20 mg of DE (Earthworks Health, Norfolk, NE) per ml. Viral titration was performed immediately in 10-day-old, embryonated SPF eggs as described in Villegas, 2008 .

Seventy-two chicks were hatched from SPF eggs and housed in wired cages inside BSL2 rooms at the Teaching and Res. Animal Care Services at the University of California, Davis. Feed and water were provided ad libitum. All procedures and animal care were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of California, Davis (protocol #: 17863). 

At 3 d of age, SPF chickens were divided into 6 groups ( Table 1 ). The first 3 groups were vaccinated with DE+IBV, IBV alone or DE alone, using a standard hatchery spray cabinet (MSD, Gainesville, GA). The other 3 groups were vaccinated intraocularly with DE+IBV, IBV alone, or DE alone. The final vaccine titer was 10 3.7 -embryo infectious dose 50% (EID 50% ) per dose per bird, regardless of the route of delivery, and was chosen as a lower dose that would not elicit an optimal response without an adjuvant. The amount of DE in each dose was 2 mg.

Twenty-one days post-vaccination (dpv), at 24 d of age, birds from all groups were challenged with a homologous IBV Ark-DPI strain via the oculo-nasal route. The challenge virus dose titer was 2 × 10 5.8 EID 50 per bird. Chicks were weighed weekly starting at 3 d of age (0 dpv) and until 24 d of age (21 dpv).

Blood was collected from all birds via wing vein puncture at 7, 14, 21 dpv and 6 d post-infection (dpi). IBVspecific IgG titers in the sera were assessed using a commercial IBV enzyme-linked immunosorbent assay (ELISA) (IDEXX, Westbrook, ME) according to the manufacturer's instructions. All samples were tested in duplicate. Samples with titers higher than 396 were considered positive, according to the manufacturer specifications.

Tears were collected from each chicken at 14 and 21 dpv and 6 dpi. Tears were diluted 1:5 in sample diluent of ELISA kits and tested in duplicate. IBV specific IgA was measured using a commercial IgG ELISA kit (IDEXX) with substitution of the conjugated anti-chicken IgG antibody for a HRP conjugated anti-chicken IgA antibody (Gallus Immunotech, Cary, NC). The conjugated IgA antibody was used at a 1:1000 dilution. Results were reported as optical density (OD) measured at 650 nm wavelength using a spectrophotometer (BioTek, Winoosk, VA).

At 11 dpv and 6 dpi, blood was collected in a heparinized tube from 2 to 3 birds per group for isolation of peripheral blood mononuclear cells (PBMC). The same birds were euthanized and the spleen was removed. A single cell suspension was obtained from the spleens by mechanical disruption as described (van Ginkel et al., 2008) . Blood or spleen suspensions were layered over a histopaque 1077 gradient (Sigma-Aldrich, St. Louis, MO) at room temperature and centrifuged. The interface was removed and washed. Live cells were counted by trypan blue exclusion. Cells were adjusted to 1 × 10 6 per mL and stained with mouse anti-chicken monocyte/macrophage-FITC, CD4-PE, and CD8α-Alexa Fluor 647 conjugated antibodies (Southern Biotech, Birmingham, AL) to detect monocytes/macrophages, CD4 T cells and CD8α T cells, respectively. After staining, cells were washed and fixed in 4% paraformaldehyde. Immune cell populations were detected using a Becton Dickinson FACScan (Franklin Lake, NJ).

IBV RNA was isolated from tears obtained 7 dpv and 6 dpi using the QIAamp Viral RNA Mini Kit in a QIAcube (Qiagen, Redwood, CA), following the manufacturer's instructions. Viral load was assessed by RT-qPCR as described in (de Quadros, 2011), using the QuantiTect Multiplex PCR Master Mix (Qiagen). In a 20 μL reaction, 5 μL of isolated RNA was added to 15 μL of master mix (10 μL 2× buffer, 0.2 μL enzyme mix, 1 μL primer mix, and 3.8 nuclease-free water). The primer mix contained primers HmqF2 (ATACTCCTAACTAATG-GTCAACAATG) and HmqR (GGCAAGTGGTCTG-GTTCAC) at a concentration of 10 pmol/μL. These primers amplify a 134 base-pair fragment of the IBV M gene. In addition, we used the probe HmQs (CAAGCCACTGACCCTCACAATAA) modified with 6-FAM and Black Hole Quencher at a concentration of 5 pmol/μL. The thermal profile consisted of an initial denaturation step of 15 min at 95 • C and 45 cycles of denaturation for 60 seconds at 94 • C, annealing for 30 seconds at 50 • C and extension for 30 seconds at 60 • C. Fluorescent data were collected after annealing and reported as Cq values.

Each chicken was evaluated for respiratory sounds at 4, 5, and 6 dpi as we previously described (Toro et al., 2012) . In brief, severity scores were recorded as (0) no signs, (1) mild nasal rales or upper respiratory tract sounds, (2) moderate tracheal rales, or (3) severe respiratory sounds audible from a 20-cm distance. An index was calculated based on the severity of the signs.

Respiratory index = ( respiratory scores per group / number of birds per group × 3) ×100, where 3 is the highest respiratory score.

At 6 dpi, birds were euthanized, tracheas were collected, and slides were prepared and stained with haematoxylin and eosin for histopathological analysis. Tracheal histomorphometry was performed on trachea sections at 40× magnification measuring mucosal thickness using the NIH Image J software. In addition, tracheal deciliation was assessed on a scale from 1 to 4 where 1 represented normal, 2 focal, 3 multifocal, and 4 diffuse cilia loss as described by Jackwood et al. (2015) .

Data was statistically analyzed using Prism Graphpad 5. Body weights were analyzed by two-way analysis of variance (ANOVA) followed by Tukey test for group comparisons. All other measurements were analyzed using Kruskal-Wallis test, followed by Dunn test for group comparisons. Significance was determined at P < 0.05. Flow cytometry data was analyzed using FlowJo software (Ashland, OR).

Viral titers of the vaccine viruses with and without the addition of 20 mg/mL DE were measured in order to detect the effect of DE on virus viability. The titer of the vaccine virus reconstituted in TPB was 10 5.38 EID 50% per milliliter compared to 10 5.77 EID 50% per milliliter for the virus reconstituted in TPB with DE under the same conditions.

No significant differences (P > 0.05) were detected in live body weights between the different chicken groups at 0, 7, and 14 dpv (data not shown). At 21 dpv, the ocular and spray IBV groups showed lower body weights compared with ocular and spray DE and DE-IBV groups.

Two chickens, one from the ocular IBV+DE and the second from the ocular IBV group, died due to causes not related to the experiment.

All IBV-vaccinated groups (spray DE+IBV, spray IBV, ocular DE+IBV, and ocular IBV) showed a slight increase in IgG titers compared to Spray DE and ocular DE groups at 7, 14, and 21 dpv (Table 2 ). Six d after the challenge, both ocular DE+IBV and ocular 18.1 ± 9.5 a,b 44.2 ± 15.2 ns 29 ± 9.9 ns 317.6 ± 87.9 a,b Ocular IBV 46.6 ± 9.3 a 28.2 ± 6.8 ns 60.4 ± 33.7 ns 357.9 ± 76.6 a Ocular DE 0 ± 0 b 0 ± 0 ns 8 ± 4.9 ns 0 ± 0 c Lowercase superscripts indicate significant differences between groups (P < 0.05). ns Not statistically significant. IBV groups showed higher IgG responses (P < 0.05) than spray vaccinated and DE only groups (Table 2) .

Similar to the serum IgG responses, the ocular DE+IBV and ocular IBV only groups exhibited higher tear IgA responses at all time points (Table 3) . At 14 dpv, the ocular DE+IBV group showed the highest net IgA response (OD: 0.047) followed by the ocular IBV group (OD: 0.040). After the challenge, the intraocularly vaccinated groups continued to show the highest IgA values (0.052 and 0.060, respectively), even though differences were not significant (Table 3) .

Flow cytometric analysis of PBMCs showed that the spray DE+IBV group had the highest frequen-cies of CD4 + and CD8 + T cells, as well as monocytes at 11 dpv (Table 4 ). In contrast, ocular DE vaccinated chickens had the lowest CD4 + and CD8 + T cells frequencies. There were no statistical differences between the groups in the frequencies of CD4 + T cells, CD8 + T cells and macrophages at 11 dpv in the spleen. The spray DE+IBV group had higher percentages of cell populations (CD4 + , CD8 + T cells and macrophages) than the spray IBV group, while the opposite was observed between the groups that had been intraocularly vaccinated with DE+IBV or IBV only. Table 5 illustrates the percentage of CD4 + T cells, CD8 + T cells and monocytes/macrophages in blood and spleen at 6 d following the challenge. There were no significant changes in the frequency of cells in blood and splenic tissues between groups. Table 5 . Percentage of CD4 + T cells, CD8 + T cells, and monocytes/macrophages of the total isolated cells from chicken blood and spleen at 6 dpi.

Spray DE+IBV 15.6 ± 6 ns 3.4 ± 1 ns 5.4 ± 1.7 ns 16.1 ± 2.1 ns 21.8 ± 4.6 ns 3.3 ± 0.4 ns Spray IBV 12.2 ± 1.5 ns 3.3 ± 0.6 ns 3.7 ± 0.7 ns 11.5 ± 1.5 ns 13.1 ± 1.6 ns 1.7 ± 0.5 ns Spray DE 8.8 ± 0.6 ns 2 ± 0.4 ns 3.2 ± 0.3 ns 15.6 ± 2.2 ns 17.3 ± 2.9 ns 2.3 ± 0.6 ns Ocular DE+IBV 6.5 ± 1.4 ns 1.8 ± 0.4 ns 1.7 ± 0.2 ns 18.2 ± 3.4 ns 21 ± 5 ns 3 ± 0.6 ns Ocular IBV 8.1 ± 1 ns 2.9 ± 0.8 ns 1.7 ± 0.3 ns 9.3 ± 1.7 ns 8.1 ± 1.9 ns 2.5 ± 0.5 ns Ocular DE 8.9 ± 0.8 ns 2.4 ± 0.1 ns 2.7 ± 0.4 ns 14 ± 2.9 ns 12.5 ± 3.1 ns 2.2 ± 0.2 ns Data are shown as mean ± standard error. ns Not statistically significant.

(A) (B) Figure 1 . IBV viral load in tears detected by RT-qPCR. A: viral load at 7 dpv (10 d of age); B: viral load at 6 dpi (27 dpv, 30 d of age). Error bars represent the standard error. Letters represent significant differences among groups.

Seven d after the vaccination, the IBV viral load in the DE+IBV and IBV ocular groups was higher (P < 0.05) than in the spray IBV and DE-IBV vaccinated groups ( Figure 1A ). Six d after the challenge (6 dpi), the DE+IBV and IBV ocular vaccinated groups displayed lower IBV loads in tears (P < 0.05) compared to the spray IBV vaccinated and control groups ( Figure 1B ). There were no significant viral load differences between DE+IBV groups and IBV vaccinated groups.

Spray DE and ocular DE groups showed the highest respiratory index on all d after the IBV challenge. In contrast, the ocular IBV group had no respiratory sounds at all times. Ocular DE+IBV showed the highest level of respiratory sounds of all the IBV vaccinated groups with a reduction at 6 dpi ( Figure 2 ). The spray DE+IBV group had a higher respiratory index than the spray IBV group at 4 dpi. Respiratory sounds decreased at 5 dpi, disappearing at 6 dpi. Spray DE+IBV showed decreased respiratory signs from 4 to 6 dpi, whereas spray IBV group showed increasing signs. Respiratory signs index at 4, 5, and 6 dpi. Low case letters represent significant differences among groups. Respiratory index was calculated using the formula R = ( respiratory scores per group / number of birds per group × 3) ×100.

Six d after the homologous IBV challenge, differences among groups were not significant. The addition of DE as adjuvant to the vaccine slightly increased mucosal thickness and deciliation score in both spray and ocular vaccinated groups (Table 6 ).

In this study, we formulated an experimental Ark-DPI live vaccine using DE as an adjuvant to improve the antigen delivery in the mucosa enhancing the mu- During the in-vivo study, we tested whether DE had any detrimental effect on live body weight following vaccination. No effects on body weight between chicken groups were detected at 7 and 14 d. Similar results were obtained when we used DE as an adjuvant in an experimental NDV inactivated vaccine (Nazmi et al., 2017) . We saw differences in body weight between the groups at d 21; however, groups with heavier body weights contained higher male-to-female ratio. Most likely these differences in weight were not related to the vaccination treatment.

We characterized the effect of adding DE to the IBV vaccine on different immunological parameters. The IBV-IgG titers in serum of all birds after vaccination were below the threshold specified in the commercial ELISA. This result can be attributed to a low experimental vaccine dose of 10 3.67 EID 50% , however the RT-qPCR results showed that birds took the vaccine. After a homologous viral challenge, we saw a better response in birds inoculated intraocularly than in spray vaccinated groups.

The ocular DE+IBV group showed the highest IBVspecific IgA responses in tears at 14 dpv followed by the ocular IBV group, while the spray-vaccinated groups had lower titers (Table 3) . While most of these results showed to be non-statistically significant the Ocular IBV IgA values showed to be statistically higher than spray DE+IBV and Spray DE. After the viral challenge, no differences were detected between the groups. The better efficacy of the ocular vaccination, compared with the spray cabinet, was shown by the higher increase of IgG and IgA titers in the groups vaccinated by that route after the challenge. Other studies also found that ocular vaccination of broiler chickens with IBV Ark gave sufficient protection compared to vaccination with a hatchery spray cabinet (Roh et al., 2013; Roh et al., 2015) .

The flow cytometric analysis did not show differences in the frequencies of CD4 + T cells, CD8 + T cells and monocytes/macrophages in blood and spleen at 11 dpv and 6 dpi. Considering that the route of vaccination and challenge was mucosal, it is possible that immune cells were predominantly recruited at local mucosal sites rather than at systemic organs. For instance, the frequency of effector T cells was significantly increased in Harderian glands at 11 dpv of an ocular IBV vaccine, but not in spleen (Gurjar et al., 2013) . Intra-tracheal and intra-nasal infection with IBV recruited natural killer cells to lung at 1 dpi and to blood at 1 and 4 dpi (Vervelde et al., 2013) . Macrophages also increased in trachea and lung at 1 dpi (Kameka et al., 2014) . Collectively, selection of different tissues and time points might lead to a better understanding of the role of immune cells in IBV protection.

In view of the poor antibody responses after vaccination and in order to confirm vaccine take, we tested IBV viral load in tears by RT-qPCR at 7 dpv. We found that both spray-vaccinated groups had a lower viral load at 7 dpv than the groups that had been vaccinated intraocularly. This correlates with results by others in which they correlate higher vaccine load early after vaccination with adequate protection (Roh et al., 2013) . A goal of an ideal vaccine is to decrease viral shedding after challenge. In this work we found that both ocular groups had lower viral loads in tears at 6 dpi. As the immunological results, this shows a better protection when the vaccine is applied intraocularly.

In order to assess the protection conferred by our experimental vaccines we assessed respiratory sounds after challenge. Only the ocular IBV group did not show respiratory signs confirming the effectiveness of this vaccination route in protecting chickens but also suggesting that the addition of DE to the live IBV Ark vaccine does not confer better protection to the homologous challenge. An interesting trend was found in the respiratory signs assessment; a decrease in respiratory signs in the Spray DE+IBV group from d 4 to 6 post infection. This trend correlates with increasing IgG antibodies. Unfortunately, no statistical significance was encountered.

The histopathology confirmed the respiratory sounds assessment. The groups mock vaccinated with DE alone either by spray cabinet or intraocularly showed higher mucosal thickness and deciliation scores, indicating the efficacy of the vaccination. The lack of significant differences might be due to the reduced number of birds per group.

In conclusion, there were few indications that adding DE to Ark-DPI live vaccines had any advantages in the immune responses and protection against IBV homologous challenges under experimental conditions. Ark vaccines administered by hatchery spray cabinet elicit weaker immune responses and protection against an IBV homologous challenge compared to the same vaccine delivered via the ocular route.

Surface-functionalized diatom microcapsules for drug delivery of water-insoluble drugs

Determination of the distribution of lentogenic vaccine and virulent Newcastle disease virus antigen in the oviduct of SPF and commercial hen using immunohistochemistry

Co-circulation of four types of infectious bronchitis virus (793/B, 624/I, B1648 and Massachusetts)

Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus

The long view: 40 years of infectious bronchitis research

Das Infektiöse Bronchitis Virus (IBV): Molekularbiologische untersuchungen zur diagnostik und zum vorkommen sowie zur pathogenität des genotyps IBV QX in spezifisch pathogenfreien (SPF) broilern [Infectious bronchitis virus (IBV): molecular biological investigations on diagnosis and prevalence as well as on the pathogenicity of the genotype QX

Efficacy of intranasal and spray delivery of adjuvanted live vaccine against infectious bronchitis virus in experimentally infected poultry. 5th Vaccine and ISV Annual Global Congress

Applications of diatoms and silica nanotechnology in biosensing, drug and gene delivery, and formation of complex metal nanostructures

Infectious bronchitis virus in testicles and venereal transmission

Cellmediated immune responses in the head-associated lymphoid tissues induced to a live attenuated avian coronavirus vaccine

Evaluating protection against infectious bronchitis virus by clinical signs, ciliostasis, challenge virus detection, and histopathology

Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens

Adjuvant effects of mannose-binding lectin ligands on the immune response to infectious bronchitis vaccine in chickens with high or low serum mannose-binding lectin concentrations

Silica-based cationic bilayers as immunoadjuvants

Current status of veterinary vaccines

Diatoms and diatomaceous earth as novel poultry vaccine adjuvants

Evaluation of infectious bronchitis virus Arkansas-type vaccine failure in commercial broilers

Hatchery spray cabinet administration does not damage avian coronavirus infectious bronchitis virus vaccine based on analysis by electron microscopy and virus titration

Adjuvants in veterinary vaccines: Modes of action and adverse effects

Infectious bronchitis virus subpopulations in vaccinated chickens after challenge

Infectious bronchitis virus in the chicken Harderian gland and lachrymal fluid: viral load, infectivity, immune cell responses, and effects of viral immunodeficiency

Rapid NK-cell activation in chicken after infection with infectious bronchitis virus M41

Titration of biological suspensions

Preparation of biosilica structures from frustules of diatoms and their applications: current state and perspectives

Preparation and efficacy of a live Newcastle disease virus vaccine encapsulated in chitosan nanoparticles

We would like to thank the members of the Poultry Medicine Laboratory at UC Davis Alejandra Figueroa, Ana Paula Da Silva, and Theodore Derksen for great assistance during the animal and laboratory portions of this experiment. This work was supported by the USDA National Institute of Food and Agriculture, Hatch project #1011490.