key: cord-0914506-p6u2mlxf
authors: Vellas, Camille; Del Bello, Arnaud; Gaube, Géraldine; Tremeaux, Pauline; Jeanne, Nicolas; Ranger, Noémie; Martin-Blondel, Guillaume; Delobel, Pierre; Kamar, Nassim; Izopet, Jacques
title: Impact of Casirivimab-Imdevimab on SARS-CoV-2 delta variant nasopharyngeal virus load and Spike quasispecies
date: 2022-02-21
journal: Open Forum Infect Dis
DOI: 10.1093/ofid/ofac093
sha: 01763f8b2f5d550bfb206b134d20b8056b335130
doc_id: 914506
cord_uid: p6u2mlxf

OBJECTIVES: The increasing use of monoclonal antibodies (mAbs) to treat COVID-19 raises questions about their impact on the emergence of SARS-CoV-2 mAb-resistant variants. We assessed the impact of Casirivimab-Imdevimab on SARS-CoV-2 mutations associated with reduced mAb activity in treated patients. PATIENTS AND METHODS: We measured the nasopharyngeal (NP) viral load and sequenced the haplotypes of spike gene of 50 patients infected with the SARS-CoV-2 delta variant and treated with Casirivimab-Imdevimab using single-molecule real-time sequencing (SMRT). RESULTS: The NP SARS-CoV-2 viral load of patients treated with Casirivimab-Imdevimab decreased from 8.13 [IQR, 7.06-8.59] log(10) copies/ml pre-treatment to 3.67 [IQR, 3.07-5.15] log(10) copies/ml seven days later (p<0.001). Of the 36 patients for whom follow-up time-points Spike sequencing were available, none of the Spike mutations that reduced mAb activity were detected. CONCLUSION: Casirivimab-Imdevimab is an effective treatment for patients infected with the SARS-CoV-2 delta variant. Despite selective pressure on SARS-CoV-2 Spike quasispecies, we detected no key mutations that reduced mAb activity in our patients.

Patients at risk of developing severe COVID-19 can be treated early with monoclonal antibodies (mAb) to prevent complications. Casirivimab (REGN10933) and Imdevimab (REGN10987) is a cocktail of mAbs recently developed and used to treat high-risk patients with mild to moderate COVID-19 1, 2 . This treatment prevents the virus attaching to the human cell ACE2 receptor and entering cells by targeting the receptor-binding domain (RBD) of the virus spike protein 3, 4 . The spike protein is a homotrimeric glycoprotein whose monomers consist of two subunits (S1 and S2). The S1 subunit contains the RBD, including a receptor-binding motif (RBM). The RBM binds to the host ACE2 cell surface receptor, enabling the fusion of virus and host membranes via the S2 subunit [5] [6] [7] .

Although the genomic diversity of SARS-CoV-2 has been described [8] [9] [10] , little is known about the impact of mAb therapy on the evolution of SARS-CoV-2 quasispecies 11 .

New variants containing key changes in the RBD, the region targeted by many neutralizing mAbs, have recently appeared all around the world. These new variants can be more transmissible than the original virus, more pathogenic, and more resistant to endogenous or exogenous antibodies 12 . The B.1.617.2 (delta) variant has been the dominant SARS-CoV-2 variant in France since July 2021. It is more likely to resist mAbs therapy, particularly the Bamlanivimab and Etesevimab association, because its L452R mutation confers resistance to Bamlanivimab 13, 14 .

The impact of Casirivimab-Imdevimab on SARS-CoV-2 quasispecies evolution has not been studied yet. In this study, we aimed to determine the intra-host evolution of SARS-CoV-2 Spike quasispecies by sequencing the virus in a series of NP (nasopharyngeal) samples from infected patients given Casirivimab-Imdevimab in order to detect mutations that reduced mAb activity.

A c c e p t e d M a n u s c r i p t 5

NP samples were taken from recently infected SARS-CoV-2 patients given a single intravenous infusion of Casirivimab-Imdevimab (1200mg/1200mg) at the Toulouse University Hospital between June 28 and October 29, 2021, according to the temporary authorization for use in France 15,16 . These ambulatory patients had mild to moderate COVID-19, were treated at the early stage of infection (less than five days post symptoms onset) and did not require oxygen. NP samples were collected before treatment (day 0), 3 and 7 days after infusion, and then weekly until the viral load became negative or reached the 31 cycle threshold (Ct).

SARS-CoV-2 RNA was extracted from NP samples with the MGI Easy Nucleic Acid Extraction kits (MGI, Shenzhen, China) and quantified using the Ct values (N-gene) obtained with the TaqPath COVID-19 RT-PCR assay (Thermo Fisher Scientific, Waltham, MA) and digital-droplet-RT-PCR (BioRad, Hercules, CA) as previously described 11 . Briefly, viral loads were derived from the Ct values using a standard curve quantified by digital-droplet RT-PCR (BioRad, Hercules, CA). We prepared a standard curve from a clinical strain taken from a patient's NP at the infection acute phase. Vero cells were infected with the virus suspension (6 days). The SARS-CoV-2 RNA in cell lysates was quantified simultaneously by the RT-ddPCR and TaqPath assay.

A c c e p t e d M a n u s c r i p t 6

Positive NP samples with N-gene Ct values < 25 were sequenced using the PacBio SMRT system (Pacific BioSciences, Menlo Park, CA), as previously described 11, 17 . Briefly, extracted RNAs were reverse transcribed using Superscript IV VILO MasterMix (ThermoFisher Scientific, Waltham, MA) and amplified using primers targeting the S-protein (A6-Fwd: ACAAATCCAATTCAGTTGTCTTCCTATTC, A6-Rev: TGTGTACAAAAACTGCCATATTGCA). The A6-primers target a single long amplicon named A6, encoding the S1 domain of the spike protein.

These A6-amplicon were amplified in a second PCR with barcoded primers and the resulting material sequenced by SMRT on a Sequel IIe system sequencer, according to the manufacturer's instructions (Pacific Biosciences, Menlo Park, CA) 18 . Haplotypes obtained after data processing were aligned on the reference genome (NC_045512.2) 19 to detect mutations associated with reduced mAb activity: 

The S-protein region was analyzed and reads accounting for more than 0.5% of the quasispecies were retained. We used abundance (Shannon entropy), incidence (number of observed haplotypes) and functional (population nucleotide diversity π) indices to obtain a multidimensional representation of virus quasispecies complexity 27 . The Shannon entropy, normalized to the number of reads H SN , gave a measure of diversity based on haplotype frequencies. The population nucleotide diversity (π) was used to measure the average number of nucleotide differences between two A c c e p t e d M a n u s c r i p t 7 genomes in the quasispecies. Finally, we calculated the Hill numbers, q D, to measure the complexity with variation of the weight given to rare haplotypes (q=0, q=1, q=2, q=∞) 27 .

We used a D'Agostino & Pearson normality test to determine whether the viral load values were normally distributed. Matched pairs were compared using a Wilcoxon matched-pairs signed rank test. Differences between the age and the viral loads of immunocompromised and nonimmunocompromised patients were compared using the Mann-Whitney U test. The frequency of men between immunocompromised and non-immunocompromised patients were compared using Fisher's exact test. A statistically significant difference was defined as a P value less than 0.05.

Statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software, San Diego, CA).

These analyses were conducted as part of the national SARS-CoV-2 surveillance effort. According to French law (CSP Art.L1121-1.1) anonymous retrospective studies do not require institutional review board approval.

A c c e p t e d M a n u s c r i p t 8

The 50 SARS-CoV-2-infected patients (19 (38%) women; median age: 55 years (range: 27-88 years)) were treated with Casirivimab-Imdevimab at the Toulouse University Hospital between 28 June and 29 October, 2021. The majority of them (37/50, 74%) were immunocompromised, 18 with solidorgan-transplants (SOT), another 4 (8%) patients were over 80, 3 (6%) had diabetes with a high body mass index, 2 (4%) had chronic kidney disease with hemodialysis, 2 (4%) had chronic lung diseases, one (2%) patient had type 1 diabetes and one (2%) patient had a chronic granulomatous disease (Table 1, Table 2 ).

SARS-CoV-2 RNA was detected by RT-PCR and sequencing detected the B.1.617.2 (delta) variant in all the patients.

All 50 treated patients were monitored by RT-PCR with viral clearance measured over time. The NP RT-PCR N-gene values became negative or greater than 31 Ct a median of 14 days after infusion (range: 7-28 days). The median SARS-CoV-2 NP viral load decreased from 8.13 log 10 copies/ml (interquartile range [IQR, 7.06-8.59 log 10 copies/ml]) on day 0 to 3.67 [IQR, 3.07-5.15 log 10 copies/ml] on day 7 (p<0.001) (Figure 1 ). The median difference in the NP viral loads before and 7 days postinfusion was 4.03 log 10 copies/ml [IQR, 2.58-4.94 log 10 copies/ml] (Figure 2 ). The NP viral load decreased by 3.99 log 10 copies/ml [IQR, 2.52-4.97 log 10 copies/ml] in the 37 immunocompromised patients (4.00 log 10 copies/ml [IQR, 2.33-5.08 log 10 copies/ml] in the 18 SOT), and by 4.49 log 10 copies/ml [IQR, 3.33-5.08 log 10 copies/ml] in the other patients (p=0.45) . The NP viral loads of 3/50 A c c e p t e d M a n u s c r i p t 9 (6%) patients had declined only slightly (< 1 log 10 copies/ml) 7 days after Casirivimab-Imdevimab infusion. The initial NP viral loads for those 3 individuals which showed slight decline in viral load on day 7 after Casirivimab-Imdevimab infusion were 6.51, 6.87 and 6.33 log 10 copies/ml respectively.

We sequenced the spike protein of 36 (72%) patients to monitor the changes in their quasispecies.

The NP viral loads from the remaining 14 patients were too low for sequencing (the viral loads of 6 patients were too low 3 days after mAbs-infusion and too low in 8 patients 7 days after mAbsinfusion).

None of the patients had any key mutation associated with reduced mAb activity on day 0. SMRT sequencing indicated that the NP from 3 (8%) patients had several SARS-CoV-2 spike protein haplotypes on day 0: 2 had 2 spike haplotypes and the third had 4 haplotypes.

The other 33 patients had only one spike haplotype on day 0. Non-key Spike mutations observed on day 0 were T95I, Q628K and Q477H.

On day 3 after Casirivimab-Imdevimab administration, new spike-haplotypes were observed in NP samples from 7 patients compared to day 0, with non-key Spike mutations L117P, T523I, A647V, P665L.

On day 7, we found new spike-haplotypes due to non-key mutations E132K, K147R, N164S, F175S, E224Q, Q498H, Q628K, in NP samples from 6 patients including one patient who showed NP viral loads slight decline (< 1 log 10 copies/ml) 7 days after Casirivimab-Imdevimab infusion. Although there were small changes in the Spike quasispecies after infusion of Casirivimab-Imdevimab, we detected no key mutation that reduced mAbs activity.

Casirivimab-Imdevimab leads to small changes in the SARS-CoV-2 quasispecies but does not induce the emergence of mAb-resistant variants.

A c c e p t e d M a n u s c r i p t 11 In the present study, the NP viral load decreased significantly (by 4.00 log 10 copies/ml in the SOT patients and 4.49 log 10 copies/ml in the other patients) 7 days after Casirivimab-Imdevimab infusion. This decrease was greater than the decrease observed in an historical group 11 of untreated SOT patients infected with the SARS-CoV-2 alpha variant (by 2.47 log 10 copies/ml). The virus load of only 3/50 (6%) of the patients in the present study decreased slightly after 7 days (< 1 log 10 copies/ml). Among these three patients, two were immunocompromised (one liver-transplanted-patient and one patient treated by anti-CD20), 

The English text was edited by Dr Owen Parkes. 

The authors have no relevant conflicts of interest to report.

These analyses were conducted as part of the national SARS-CoV-2 surveillance effort. According to 

SARS-CoV-2 spike quasispecies population nucleotide diversity (π) based on the S-protein region before (day 0), and 3 days and 7 days post mAbs infusion. The horizontal line represents the median of the population nucleotide diversity (π) for each group.

REGN-COV2, a Neutralizing Antibody Cocktail, in Outpatients with Covid-19

Casirivimab-Imdevimab treatment is associated with reduced rates of hospitalization among high-risk patients with mild to moderate coronavirus disease-19

Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail

Anti-SARS-CoV-2 neutralizing monoclonal antibodies: clinical pipeline. mAbs

Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation

Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor

Structural basis of receptor recognition by SARS-CoV-2

Genomic diversity of SARS-CoV-2 in Coronavirus Disease 2019 patients

Two-step fitness selection for intra-host variations in SARS-CoV-2

Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) Sequence Characteristics of Coronavirus Disease 2019 (COVID-19) Persistence and Reinfection

Influence of treatment with neutralizing monoclonal antibodies on the SARS-CoV-2 nasopharyngeal load and quasispecies. Clinical Microbiology and Infection

SARS-CoV-2 variants, spike mutations and immune escape

SARS-CoV-2 variant B.1.617 is resistant to bamlanivimab and evades antibodies induced by infection and vaccination

Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization

ANSM. ATU/RTU -CASIRIVIMAB/ IMDEVIMAB 120 mg/mL ANSM

Prediction of SARS-CoV-2 Variant Lineages Using the S1-Encoding Region Sequence Obtained by PacBio Single-Molecule Real-Time Sequencing

Procedure & Checklist -Preparing SMRTbell Libraries using PacBio Barcoded M13 Primers for Multiplex SMRT Sequencing

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

US Food Drug and Administration. Fact Sheet For Health Care Providers Emergency Use Authorization

Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7. Nature

Antibody cocktail to SARS-CoV-2 spike protein prevents rapid mutational escape seen with individual antibodies

Neutralizing monoclonal antibodies for treatment of COVID-19

The monoclonal antibody combination REGEN-COV protects against SARS-CoV-2 mutational escape in preclinical and human studies

The Impact on Infectivity and Neutralization Efficiency of SARS-CoV-2 Lineage B.1.351 Pseudovirus

Viral quasispecies complexity measures

Prospective mapping of viral mutations that escape antibodies used to treat COVID-19

Considerable Escape of SARS-CoV-2 Variant Omicron to Antibody Neutralization