key: cord-0899272-qb1f03hz
authors: Lentini, A.; Pereira, A.; Winqvist, O.; Reinius, B.
title: Monitoring of the SARS-CoV-2 Omicron BA.1/BA.2 variant transition in the Swedish population reveals higher viral quantity in BA.2 cases
date: 2022-03-27
journal: nan
DOI: 10.1101/2022.03.26.22272984
sha: 5af2a62a8df5aaa749875127f11c99906d6250ca
doc_id: 899272
cord_uid: qb1f03hz

Throughout the SARS-CoV-2 pandemic, multiple waves of variants of concern have swept across populations, leading to a chain of new and yet more contagious lineages dominating COVID-19 cases. Here, we tracked the remarkably rapid shift from Omicron BA.1 to BA.2 sub-variant dominance in the Swedish population during January-March 2022. By analysis of 174,933 clinical nasopharyngeal swab samples using a custom variant-typing RT-PCR assay, we uncover nearly two-fold higher levels of viral RNA in cases with Omicron BA.2. Importantly, increased viral load in the upper pharynx upon BA.2 infection may provide part of the explanation why Omicron BA.2 is more transmissible and currently outcompetes the BA.1 variant across populations.

The SARS-CoV-2 pandemic has been characterised by the emergence and subsequent dominance of new variants of concern, such as Alpha B.1.1.7 during late 2020, Delta B.1.617.2 in mid 2021, and the Omicron variant B.1.1.529.1 (BA.1) in late 2021 and early 2022 1 . It is estimated that a peak of nearly 50 million new infections occurred daily world-wide during the Omicron wave of January 2022, far exceeding the peak of 14 million daily Delta infections during April 2021 2 and signifying an unprecedented level of transmission of Omicron. In late December 2021, during the midst of the Omicron BA.1 wave in Sweden, the Omicron subvariant BA.2 (B.1.1.529.2) arrived and rapidly spread through the population. At this time, we put in place an RT-PCR assay capable of genotyping Omicron BA.1 cases directly in primary SARS-CoV-2 RT-PCR testing, enabling day-by-day tracking of the BA.1 frequency at massive scale. Here, provide details of this assay and present data from 174,933 clinical nasopharyngeal swab samples analysed with the method in the Swedish population January-March 2022, demonstrating how the Omicron BA.1 wave was outcompeted by BA.2. Importantly, we further report approximately two-fold increased viral quantities detected in Omicron BA.2 cases, suggesting that higher viral load in the upper pharynx may at least partially explain why Omicron BA.2 is more contagious than the BA.1 lineage.

We developed a modified version of the CDC SARS-CoV-2 RT-PCR assay 3 , simultaneously detecting general SARS-CoV-2 infection status (N1-FAM), human RNaseP sample integrity (RP-HEX), and Omicron BA.1-variant status (SBA1-Cy5) leveraging BA.1-specific indels in the spike (S) gene (Fig. 1a) . To attain a multiplex assay of high sensitivity and specificity, suitable for RNA-extraction-free RT-PCR on heat-inactivated samples employed in mass testing 4 , we designed and evaluated 144 combinatorial SBA1-primer-probe sets, matching CDC N1 properties and with minimized amplicon length ( Fig. S1a and Supplementary Table 1) . We obtained the first in vitro expanded Omicron BA.1 inoculate in Sweden (GISAID Accession ID: EPI_ISL_7452247) which was used as template, identifying Omicron BA.1-specific primer-probe sets ( Fig. 1a-b and Fig.  S1b) . Detection sensitivity and log-linear cycle thresholds (CT) range were similar for the N1 and SBA1 sets in the assay conditions (Fig. 1c) . Using 185 clinical nasopharyngeal swab samples of known COVID19-infection status, we validated that addition of SBA1-Cy5 probes did not affect N1 CT values and the sensitivity to detect general SARS-CoV-2 infection in primary RT-PCR ( Fig. 1d and Supplementary Table 2 ). Parallel genotyping of 133 SARS-CoV-2-positive samples using Thermo Fisher TaqMan SARS-CoV-2 Mutation Panel Assay as well as whole-genome sequencing (WGS) provided Omicron-BA.1-case classification that was 100% consistent with our direct RT-PCR assay (Fig1e-f). Omicron (both the BA.1 and BA.2 lineage) carries a C>T substitution in the third base position of the N1 probe, which we confirmed had negligible effect on CT values by tests using CDC N1 and custom Omicron N1 probes (Fig. S1c) .

Having optimised and validated the assay, it was deployed to monitor the Omicron BA.1 wave across central Sweden day-by-day, totalling 174,933 nasopharyngeal samples analysed between January 26 -March 8, 2022 (Supplementary Table 3 ). While BA.1 was the dominant variant among COVID19positive cases during January, the BA.1 fraction steadily decreased to as low as 11% by March (Fig.  2a) . This trend was observed in all monitored healthcare districts across central Sweden (Fig. 2b) , indicating that Omicron BA.1 was being outcompeted by another lineage. To trace this variant switch, we whole-genome sequenced and assigned variants to 698 samples picked among SARS-CoV-2-positive cases. Strikingly, 100% of clinical samples typed as Omicron BA.1 negative in our direct RT-PCR assay were found to be of the Omicron BA.2 lineage by WGS (Fig. 2c) , lacking the BA.1-specific "EPE" insertion in S gene targeted by our S BA1-probe (Fig. S1a) , demonstrating that Omicron BA.2 was the variant outcompeting BA.1 in the Swedish population. Combining these clinically sequenced cases with the validation set of 133 samples mentioned in a previous section, we had classified a total of 801 cases by WGS (Supplementary Table 4) , demonstrating >99% agreement with the BA.1 calls obtained directly in the RT-PCR (796/801 samples) (Fig. 2d) . Why Omicron BA.2 is more contagious and outcompetes BA.1 is not well understood, indeed the BA.1/BA.2 transition is still ongoing across the world. Our massive RT-PCR dataset allowed us to compare viral levels detected in BA.1 and BA.2 cases. Intriguingly, samples genotyped as BA.1-negative in RT-PCR contained 1.9-fold higher levels of viral RNA than BA.1-positive samples (24.50 vs. 25.43 median N1 C T; P = 1.54x10 -180 , Mann-Whitney U-test) (Fig. 2e) , pointing to a substantial difference in viral load in the pharynx of patients infected with the two different Omicron variants. Importantly, this difference was observable across day-by-day timepoints (Fig. S2c) and was clearly attributable to the Omicron BA.2 variant, as BA.2 completely dominated non-BA.1 cases and viral copy-numbers were similar in Omicron BA.1 and Delta cases sampled in mid-December (P = 0.77, Mann-Whitney U-test) (Fig. 2f) . Similar viral loads between Delta and BA.1 has previously been observed 5,6 whereas the increased viral load in BA.2 cases was surprising. To ensure that the difference in viral quantity detected in samples of Omicron BA.1 and BA.2 cases was not attributed to our specific RT-PCR assay nor due to difference in amplification of the 3'-end of the SARS-CoV-2 genome (where the N gene is located) due to unequal discontinuous transcription found in coronaviruses 7 , we subjected 3,392 samples to both our N1/RP/SBA1 assay and an extraction-based assay (SARS-CoV-2 One-Step RT-PCR Kit, RdRp and N Genes, IVD, NZYTech; Supplementary Table 5 ) targeting N as well as RdRp, located further 5' inside ORF1ab. Our RT-PCR assay for the N gene showed a strong linear correlation for both N and RdRp in the extraction-based assay (R 2 > 0.949) (Fig. S2d) and we indeed confirmed increased copy numbers in BA.1-negative COVID19 samples in both assays and genes probed (Fig. S2e) . Furthermore, lineage classification by WGS for 118 of these samples confirmed that BA.1-negative samples were indeed of BA.2 lineage in this analysis (81/81) (Fig. S2f) .

Finally, we observed the BA.2-specific ORF3a:H78Y mutation (Supplementary Table 6 ), found primarily in Denmark 8 , in around 40% (172/425) of BA.2 cases classified by WGS (Fig. S3a) . These cases were found almost exclusively in the southern-most Swedish region in our analysis where it accounted for around 72% of cases (103/144) (Fig.  S3b) , suggesting a common Danish/Swedish origin. We further found no Delta/Omicron recombination in our WGS data ( Fig. S3c ) which has been previously reported for few cases in southern Europe 9 . All rights reserved. No reuse allowed without permission. perpetuity. preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in The copyright holder for this this version posted March 27, 2022. ;  3 Together, we present an effective RT-PCR assay to simultaneously and robustly call general COVID19 status and Omicron BA.1 variant status in a single RT-PCR reaction, which enabled real-time tracking of the Omicron BA.1/BA.2 transition in Sweden at immense scale. We observed that the predominant Omicron BA.1 variant was gradually and consistently outcompeted by Omicron BA.2 throughout Swedish healthcare districts. Importantly, we report that cases of BA.2 infection presented nearly two-fold higher quantities of viral RNA in nasopharyngeal sabs compared to BA.1 infection, suggesting that increased viral load in the upper pharynx may contribute to BA.2 being more contagious than the BA.1 lineage. Our direct Omicron BA.1-typing assay is a directly compatible addition to the well-established CDC N1/RNaseP probe sets and can thus easily be deployed for instant monitoring of the Omicron BA.1/BA.2 transition where needed, avoiding the time-lag and sample-number bottleneck of genotyping by WGS sequencing.

Ethical oversight and approval were obtained by the Swedish Ethical Review Authority (Dnr 2020-01945 and 2022-01139-02, Etikprövningsmyndigheten).

Ola Winqvist is a shareholder of ABC Labs where the clinical diagnostics were performed. Björn Reinius has worked as a consultant on extraction-free SARS-CoV-2 RT-PCR and is shareholder of GeneBeats, which provides such services.

AL performed WGS data processing, performed data analysis and visualisation, prepared figures, and wrote the manuscript. AP performed Thermo Fisher TaqMan SARS-CoV-2 Mutation Panel Assay. OW provided resources and coordinated the project. BR provided resources, coordinated the project, designed the BA.1 assay and performed RT-PCR, analysed the data, prepared figures, and wrote the manuscript. All authors approved the final version of the manuscript. 

The SARS-CoV-2 RT-PCR assay used in this study represents an improved, multiplex-version of our previously described RNA-extraction-free protocol 4 with increased sample and reaction volume and increased sensitivity. For each reaction, 24 uL RT-PCR master mix was prepared, containing 7.5 µL TaqPath (Fig.  1d) . In the parallel genotyping of 133 SARS-CoV-2positive samples, performed using Thermo Fisher TaqMan SARS-CoV-2 Mutation Panel Assay (according to the manufacturers instructions) and

All rights reserved. No reuse allowed without permission.

perpetuity.

preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in 

The in vitro expanded Omicron BA.1 reference sample used for the evaluation of SBA1 primer-probe sets ( Fig. S1a-b) was obtained from the Public Health Agency of Sweden (sample isolated Nov 30, 2021; GISAID Accession ID: EPI_ISL_7452247), and the non-Omicron BA.1 reference sample (lacking "S:N211IN212-" and "S:214:EPE") was an Alpha B. Table 3) , were subjected to heat inactivation by 70 °C for 50 min in a hot air oven. These samples were analysed for presences of SARS-CoV-2 as part of clinical diagnostics performed at ABC Labs, Stockholm, by demand of the Public Health Agency of Sweden. The use of the Omicron BA.1 screening protocol was validated at ABC Labs and approved by the Public Health Agency of Sweden. For the purpose and analyses of the current study, sample identities were anonymised, and IDs were replaced by a randomized code (i.e., those listed in supplementary tables). Informed consent for the use of anonymized CT values or samples obtained in routine clinical diagnostics was not obtained and is not required, and is in accordance with the study permit obtained by the Swedish Ethical Review Authority (Dnr 2020-01945 and 2022-01139-02, Etikprövningsmyndigheten).

For sequencing of SARS-CoV-2 genomes, we used the Illumina COVIDSeq Test kit and sequencing was performed on the Illumina NextSeq 550 Sequencing System.

Raw data was quality trimmed using fastp 10 v0.20.0 and de novo assembled using MEGAHIT 11 v1.2.9 [-min-contig-len 5000]. Disjoint contigs were scaffolded against the SARS-CoV-2 reference genome [ASM985889v3] using RagTag 12 v2.1.0 and SARS-CoV-2 lineage was assigned using pangolin 13 v3. preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in Table 2) . f. Agreement between N1+SBA1 RT-PCR assay and WGS lineage calls for n = 103 biological replicates.

All rights reserved. No reuse allowed without permission. perpetuity. preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in Omicron (BA.1)

Reverse primer (See also Supplementary  Table 1c ). Data is stra�fied by BA.1 RT-PCR calls and shown as paired individual dots and median for n = 69 biological replicates.

All rights reserved. No reuse allowed without permission.

perpetuity.

preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in c. Viral load (N1 qPCR Ct) for BA.1-posi�ve and nega�ve SARS-CoV-2-posi�ve samples based on RT-PCR calls over �me for n = 93,126 biological replicates. Density plot with marked medians shown to the right. d. Linear rela�onship between Omicron extrac�on-free (N1+SBA1, OXF) and extrac�on-based (N1+RdRp, NZT) RT-PCR results for different primer-probe sets for n = 3,323 biological replicates. e. Difference in viral RNA quan�ty (RT-PCR Ct for different primer-probe sets) for BA.1-posi�ve and nega�ve SARS-CoV-2 posi�ve samples based on RT-PCR calls for n = 1,252 biological replicates. OFX: Omicron extrac�on-free (N1+SBA1). NZT: Extrac�on-based SARS-CoV-2 One-Step RT-PCR Kit, RdRp and N Genes, IVD (NZYTech). P-values calculated using one-tailed Mann-Whitney U-tests. f. Same as e. but based on WGS lineage calls for n = 87 biological replicates. All rights reserved. No reuse allowed without permission. perpetuity. preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in b. Same as a. but shown as muta�on prevalence across Swedish healthcare regions. c. Full SARS-CoV-2 muta�onal spectrum (top) or S-specific muta�ons (bo�om) for n = 712 biological replicates. Shown as heatmap with arbitrarily coloured muta�ons (le�) or PCA analysis (right).

All rights reserved. No reuse allowed without permission.

perpetuity.

preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in

The copyright holder for this this version posted March 27, 2022. ; https://doi.org/10.1101 https://doi.org/10. /2022 

S:214:EPE GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-Omicron BA.1 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf1 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf2 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf3 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf4 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf6 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf7 _ right GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOf8 _ left GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOp1-Cy5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOP2-Cy5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOP3-Cy5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOp4 _ right-Cy5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOp5 _ left-Cy5 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr1 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr2 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr3 GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr4 _ right GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr5 _ right GAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTATAGTGCGTGAGCCAGAAGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGT-SOr6 _ left

We are grateful to members of the Reinius lab and ABC Labs, helping at various stages of the project. In vitro expanded Omicron BA.1 inoculate was kindly provided by the Public Health Agency of Sweden and we thank Sandra Söderholm and Shaman Muradrasoli facilitating transfer of this sample. We thank Jessica Alm at the National Pandemic Centre (NPC), Karolinska Institutet for providing anonymized control samples.

This research was supported and funded by the SciLifeLab/KAW national COVID-19 research program project grant (2020.0182, 2020.0241, V-2020-0699), the Swedish Research Council (2017-01723) and the Ragnar Söderberg Foundation (M16/17) to BR.