key: cord-0896943-mkc4g3jk
authors: Zhang, Lu; Gan, Mian; Zhang, Zhaoyong; Li, Xin; Liu, Wenkuan; Zhu, Airu; Sun, Jing; Li, Fang; Wang, Yanqun; Zhang, Fuchun; Zhao, Jingxian; Zhou, Rong; Zhao, Jincun
title: Complete Genome Sequences of Five Human Coronavirus NL63 Strains Causing Respiratory Illness in Hospitalized Children in China
date: 2020-02-20
journal: Microbiol Resour Announc
DOI: 10.1128/mra.01597-19
sha: 74e492f5464ab2ba5cc8d99b33223b6bc71956d8
doc_id: 896943
cord_uid: mkc4g3jk

We report the complete genome sequences of five human coronavirus NL63 (HCoV-NL63) strains obtained using next-generation sequencing. The five HCoV-NL63 strains were obtained from hospitalized children with severe acute respiratory infection detected in Guangdong, China. This study provides several complete genomes of HCoV-NL63 and improves our understanding of HCoV-NL63 evolution in China.

H uman coronavirus NL63 (HCoV-NL63) is a member of the family Coronaviridae, genus Alphacoronavirus, and was first discovered in 2004 (1) . HCoV-NL63 is mainly associated with the common cold in children, the elderly, and immunocompromised patients (2, 3) . The genome of HCoV-NL63 is about 27 kb with a conserved gene order of 5=-orf1ab-spike (S)-orf3-envelope (E)-membrane (M)-nucleocapsid (N)-poly (A). The species tropism of HCoV-NL63 is determined by spike glycoprotein. HCoV-NL63 and severe acute respiratory syndrome coronavirus (SARS-CoV) share the same cell receptor, angiotensin converting enzyme 2 (ACE-2) (4, 5), for entry into host cells, and HCoV-NL63 is recognized as a common cause of upper respiratory tract infection and has been prevalent worldwide.

Here, nasopharyngeal swab samples were collected from hospitalized children with severe acute respiratory infection in Guangzhou, China, in 2018. This study was performed in strict accordance with human subject protection guidance provided by the Research Ethics Committee of Guangzhou Medical University. The respiratory samples were filtered with 0.22-m filters, RNA extraction was performed using a Qiagen viral RNA extraction kit, and extracted RNA was used for sequenceindependent single-primer amplification (SISPA) (6, 7) as follows: a reverse transcription reaction was performed with SuperScript III reverse transcriptase using a primer containing a fixed sequence, followed by a random hexamer at the 3= end (FR26RV, GCCGGAGCTCTGCAGATATCNNNNNN). Then, Klenow fragment polymerase (New England Biolabs) was used for DNA synthesis. Finally, PCR amplification was conducted using primers consisting of the fixed portions of the random primers (FR26, GCCGGAGCTCTGCAGATATC). Purified DNA was used for next-generation sequencing (NGS). Libraries were prepared with the Nextera XT kit (Illumina), and paired-end reads (2 ϫ 125 bp) determined using a HiSeq 2500 instrument were used for cleaning and assembling using CLC Genomics Workbench version 11.0. Illumina sequencing yielded about 10 million reads per sample. Reads were assembled into contigs with a de novo assembly model, and the contig sequences were then extracted for subsequent analysis. Partial genome sequences of five HCoV-NL63 strains were obtained by NGS methods. Meanwhile, sets of specific primer pairs were designed and used to amplify the gap region of HCoV-NL63, which was used for genome assemblies using the SeqMan subprogram of the DNAStar software version 7.1.0 with default parameters (Table 1) . Finally, five complete genome sequences of HCoV-NL63 were obtained using next-generation sequencing and Sanger sequencing methods together and were designated strains ChinaGD01 (27,531 bp), ChinaGD02 (27,516 bp), Chi-naGD03 (27,516 bp), ChinaGD04 (27,532 bp), and ChinaGD05 (27,544 bp). The five HCoV-NL63 strains presented here were aligned using MAFFT version 7.158 (8) and showed 98.5 to ϳ99.1% nucleotide homology with the prototype HCoV-NL63 virus (GenBank accession number NC_005831.2) as estimated using MEGA version 5.10 software (9) (Fig. 1) .

Only two complete genome sequences of HCoV-NL63 associated with acute respiratory illness have been obtained and reported in China. The complete genome sequence data from our study will provide insight into the evolution and genetic diversity of HCoV-NL63 in China. 

Identification of a new human coronavirus

Human coronavirus NL63, a new respiratory virus

Human coronavirus NL63 associated with lower respiratory tract symptoms in early life

Human coronavirus NL63 employs the severe acute respiratory syndrome coronavirus receptor for cellular entry

A crucial role of angiotensin converting enzyme 2 (ACE2) in SARS coronavirus-induced lung injury

Sequence-independent, single-primer amplification (SISPA) of complex DNA populations

Metagenomic analysis of viral genetic diversity in respiratory samples from children with severe acute respiratory infection in China

MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization

MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods

This research was supported by grants from the National Key Research and Development Program of China (2018YFC1200100), National Natural Science Foundation of