key: cord-0892480-wadr8cbm
authors: Schooley, Robert T.; Carlin, Aaron F.; Beadle, James R.; Valiaeva, Nadejda; Zhang, Xing-Quan; Clark, Alex E.; McMillan, Rachel E.; Leibel, Sandra L.; McVicar, Rachael N.; Xie, Jialei; Garretson, Aaron F.; Smith, Victoria I.; Murphy, Joyce; Hostetler, Karl Y.
title: Rethinking Remdesivir: Synthesis, Antiviral Activity, and Pharmacokinetics of Oral Lipid Prodrugs
date: 2021-09-17
journal: Antimicrob Agents Chemother
DOI: 10.1128/aac.01155-21
sha: 28e513ecdf8e4ed66a3b2879144e40ab0d7d14ee
doc_id: 892480
cord_uid: wadr8cbm

Remdesivir (RDV; GS-5734) is currently the only FDA-approved antiviral drug for the treatment of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection. The drug is approved for use in adults or children 12 years or older who are hospitalized for the treatment of COVID-19 on the basis of an acceleration of clinical recovery for inpatients with this disease. Unfortunately, the drug must be administered intravenously, restricting its use to those requiring hospitalization for relatively advanced disease. RDV is also unstable in plasma and has a complex activation pathway which may contribute to its highly variable antiviral efficacy in SARS-CoV-2-infected cells. Potent orally bioavailable antiviral drugs for early treatment of SARS-CoV-2 infection are urgently needed, and several, including molnupiravir and PF-07321332, are currently in clinical development. We focused on making simple, orally bioavailable lipid analogs of remdesivir nucleoside (RVn; GS-441524) that are processed to RVn monophosphate, the precursor of the active RVn triphosphate, by a single-step intracellular cleavage. In addition to high oral bioavailability, stability in plasma, and simpler metabolic activation, new oral lipid prodrugs of RVn had submicromolar anti-SARS-CoV-2 activity in a variety of cell types, including Vero E6, Calu-3, Caco-2, human pluripotent stem cell (PSC)-derived lung cells, and Huh7.5 cells. In Syrian hamsters, oral treatment with 1-O-octadecyl-2-O-benzyl-glycero-3-phosphate RVn (ODBG-P-RVn) was well tolerated and achieved therapeutic levels in plasma above the 90% effective concentration (EC(90)) for SARS-CoV-2. The results suggest further evaluation as an early oral treatment for SARS-CoV-2 infection to minimize severe disease and reduce hospitalizations.

this writing, the United States remains in the center of the pandemic. Intensive and economically disruptive social distancing measures have blunted several viral surges, but this approach is not sustainable, and infection rates have increased each time restrictions have eased (7) . Fortunately, several highly effective vaccines have emerged over the past 6 months, and their distribution in the United States and many other high-income countries has had a major impact on SARS-CoV-2-associated morbidity and mortality (8, 9) . Despite these highly noteworthy successes in vaccine development, gaps and delays in global vaccine delivery, the emergence of viral variants against which vaccine protection is compromised, and a relatively sizable immunocompromised population who are unable to fully respond to vaccination make it clear that infections will continue and that highly effective antiviral therapy is required.

Remdesivir nucleoside triphosphate (RVn triphosphate) potently inhibits enzymatic activity of the polymerase of every coronavirus tested thus far, including SARS CoV-2 (10) (11) (12) (13) . The drug has recently been approved by the FDA for the treatment of adults and children aged 12 or older who are hospitalized for COVID-19 (14) . This broad activity reflects the relative molecular conservation of the coronavirus RNA-dependent RNA polymerase (RdRp). Remdesivir (RDV) is an aryloxy phosphoramidate triester prodrug that must be converted by a series of reactions to RVn triphosphate, the active antiviral metabolite (Fig. 1 ). Although RVn triphosphate is an excellent inhibitor of the viral RdRp (11, 15) , RDV's antiviral activity is highly variable in different cell types, which may be due to variable expression of the four enzymes required for conversion to remdesivir nucleoside monophosphate (RVn-P) (16) . RDV's base is a 19-cyano-substituted adenine C nucleoside (GS-441524, RVn) that is thought to be poorly phosphorylated. To bypass the perceived slow first phosphorylation, the developers relied on an aryloxy phosphoramidate triester prodrug that is converted by a complex series of four reactions to RVn-P that is then efficiently converted to RVn triphosphate, the active metabolite. RDV may be more active in some SARS-CoV-2-infected tissues than in others, a possible reason for its incomplete clinical impact on SARS-CoV-2. A recent report suggests that some tissues express low levels of the four enzymes that activate RDV, and some tissues may be responsible for tissue-specific differences in antiviral activity (13) . Yan and Muller have recently published a detailed analysis of the potential weaknesses of remdesivir and suggested that RVn (GS-441524) might be a preferable therapy (16) . Remdesivir has beneficial antiviral and clinical effects in animal models of coronavirus infection (17, 18) . These effects are primarily demonstrable when administered before or very soon after viral challenge. However, RDV is not highly bioavailable following oral administration and must be administered intravenously, functionally limiting its clinical application to hospitalized patients with relatively advanced disease. It would be clinically useful to have a highly active, orally bioavailable analog of RVn which provides sustained levels of intact antiviral drug in plasma, since RDV persistence in plasma is known to be brief. In monkeys treated with intravenous RDV, the plasma level declined by roughly two log 10 2 h after the infusion ended (16, 19) . In two patients with COVID-19 treated with intravenous RDV, 1 h after the intravenous infusion stopped, a drop of .90% was observed (20) .

Here, we report the synthesis and antiviral evaluation of three novel lipid prodrugs of RVn monophosphate that are active at submicromolar concentrations against SARS-CoV-2 infection in a variety of cell types, including Vero E6, Calu-3, Caco-2, pluripotent stem cell (PSC)-derived human lung cells, and Huh7.5 cells. These compounds are stable in human plasma in contrast to remdesivir and are orally bioavailable as predicted by our prior work with other antivirals of this general design (21, 22) . These oral remdesivir nucleoside phosphate prodrugs could allow earlier and more effective treatment at the time of diagnosis of SARS-CoV-2 infection. In addition, one of these prodrugs represents an approach that may be capable of delivering the antiviral to the lung and away from the liver, the site of remdesivir's dose-limiting toxicity, due to its route through intestinal lymph bypassing the portal vein and the liver (23, 24) .

(This article was submitted to an online preprint archive [25] .)

Synthesis of RVn monophosphate prodrugs. We synthesized the hexadecyloxypropyl-, octadecyloxyethyl-, and 1-O-octadecyl-2-O-benzyl-sn-glyceryl esters of RVn 59monophosphate. Compounds 5a to 5c were synthesized as shown in Fig. 2 . Analyses by nuclear magnetic resonance (NMR), electrospray ionization (ESI) mass spectrometry, and high-performance liquid chromatography (HPLC) were consistent with each structure and demonstrated purities of .95%.

Ex vivo stability of ODBG-P-RVn in human plasma. One of the disadvantages of remdesivir is its in vivo and ex vivo instability in plasma. In vivo, it has been reported to persist for less than 2 h after intravenous infusion in rhesus monkeys (13, 16, 19) and in COVID-19 patients (20) . Ex vivo, remdesivir is not stable in human plasma, with a reported half-life (t 1/2 ) of 69 min (26) . We tested the ex vivo stability of 1-O-octadecyl-2-O-benzyl-glycero-3-phosphate RVn (ODBG-P-RVn) in human plasma with either K 2 EDTA or sodium heparin (NaHep) as anticoagulant. ODBG-P-RVn was added to human plasma and incubated at 37°C for 24 h. ODBG-P-RVn levels were measured at the indicated times by liquid chromatography-tandem mass spectrometry (LC-MS/MS) (Fig. 3 ). ODBG-P-RVn has a t 1/2 in human plasma of .24 h versus 69 min for remdesivir.

Lipid RVn monophosphate prodrugs are potent inhibitors of SARS-CoV-2. To determine if lipid RVn monophosphate prodrugs inhibit SARS-CoV-2 RNA replication, we performed antiviral assays using a clinical isolate of SARS-CoV-2 (2019-nCoV/USA-WA1/2020) in multiple cell lines: African green monkey kidney cells (Vero E6), human PSC-derived lung (PSC-lung) cells, human lung epithelial cell line Calu-3, human colonic epithelial cell line Caco-2, and human hepatocyte cell line Huh7.5. Each cell line was treated with the above-indicated compounds for 30 min prior to infection and incubated for 48 h postinfection. Intracellular viral RNA was measured by quantitative reverse transcription-PCR (qRT-PCR). In all cell lines, there was a dose-dependent inhibition of viral RNA by ODBG-P-RVn, ODE-P-RVn, octadecyloxyethyl phosphate RVn (HDP-P-RVn), remdesivir (RDV), and remdesivir nucleoside (RVn) (Fig. 4A ). In Vero E6 cells, the average half-maximal effective concentration (EC 50 ) and average 90% effective concentration (EC 90 ) of ODBG-P-RVn were 0.14 mM and 0.16 mM, respectively ( Fig. 4B and Table 1 ). The EC 50 of ODBG-P-RVn in Vero E6 cells was significantly lower than that of RDV (Table 1) . ODE-P-RVn and HDP-P-RVn were also potently antiviral, with EC 50 values of 0.3 mM and 0.63 mM, respectively, in Vero E6 cells ( Fig. 4B and Table 1 ). The EC 50 s of ODBG-P-RVn and ODE-P-RVn were less than 0.35 mM in PSC-lung and Calu-3 cells, both models of human lung infection ( Fig. 4B ; Table 1 ). The antiviral activities of ODBG-P-RVn and ODE-P-RVn were significantly better than RVn in PSC-lung cells (Table 1) . ODBG-P-RVn, ODE-P-RVn, and HDP-P-RVn demonstrated strong antiviral activity in Huh7.5 cells with EC 50 s of less than 0.2 mM that were not significantly different from that of RDV or RVn ( Fig. 4B and Table 1 ). In the Caco-2 cell line, the EC 50 of ODBG-P-RVn was 0.3 mM, which was significantly lower than that of RVn but similar to that of RDV ( Fig. 4B and Table 1 ). In the same cell line, the EC 50 of ODE-P-RVn was 0.77 mM, which was significantly higher than that of RDV ( Fig. 4B and Table 1 ). We next measured the cytotoxicity of each compound by incubating each of these cell lines with serial dilutions of each compound from 1.23 mM to 100mM for 48 h (Fig. 4C ). The average 50% cytotoxic concentrations (CC 50 ) for all compounds were greater than 60 mM in all cell lines except for RDV, which had a CC 50 s of 32.7mM in PSC-lung cells and 15.2 mM in Huh7.5 cells, a human hepatocyte cell line ( Fig. 4C and Table 1 ). The selectivity index of ODBG-P-RV ranged from 295 to 699 in the five cell types tested ( Table 1 ). The ranges of antiviral activity and cytotoxicity of ODBG-P-RVn (EC 50 , 0.14mM to 0.30mM; CC 50 , 61.5 mM o 98.2mM) were more consistent across cell types than those for RDV (EC 50 , 0.06 mM to 1.13mM; CC 50 15.2mM to .100 mM) ( Fig. 5A to C and Table 1 ). Collectively, these data demonstrate that lipid RVn monophosphate prodrugs are potent antivirals against SARS-CoV-2 in vitro with low toxicity and excellent selectivity indexes.

ODBG-P-RVn inhibits the human Alphacoronavirus 229E. To determine if ODBG-P-RVn inhibits other human coronaviruses, we performed antiviral assays in the human lung fibroblast cell line MRC-5 using a clinical isolate of human coronavirus 229E. MRC-5 cells were infected with 229E for 2 h followed by incubation in the presence of various concentrations of RDV, ODBG-P-RVn, or vehicle for 72 h postinfection. Both ODBG-P-RVn and RDV demonstrated a dose-dependent inhibition of the cytopathic effect (CPE). The EC 50 values of ODBG-P-RVn and RDV were 0.15 mM and 0.04 mM, respectively, and the EC 90 s were 0.54 mM and 0.26mM, respectively (Fig. 6A ). The CC 50 s for ODBG-P-RVn and RDV were greater than 50 mM in MRC-5 cells (Fig. 6B ). Together with the antiviral data for SARS-CoV-2, this demonstrates that ODBG-P-RVn has antiviral activity against two genetically distinct human-pathogenic coronaviruses.

Orally administered ODBG-P-RVn achieves therapeutic plasma levels in Syrian hamsters. ODBG-P-RVn administered to Syrian hamsters by oral gavage every 12 h for 7 days was well tolerated, and no adverse clinical signs were noted. Peak plasma levels of ODBG-P-RVn were noted at 1 h and fell by 50% in approximately 5 h (Fig. 7A ). Plasma curves were generally similar at days 1 and 7, except at 16.9 mg/kg body weight, the 7-day values were slightly higher than the levels at day 1. At 12 h, ODBG-P-RVn levels were higher than the EC 90 for ODBG-P-RVn in all cell lines studied, including Vero E6 cells and PSC-lung cells on both days 1 and 7 (Fig. 7A) . Levels of RVn, the nucleoside metabolite of ODBG-P-RVn, peaked at 3 h after administration and declined thereafter (Fig. 7B ). Plasma levels of RVn were less than the EC 90 for RVn in both PSClung cells and Vero E6 cells (Fig. 7B ). The observed low levels of RVn suggest that Table 1 . Error bars represent the standard errors of the means (SEMs). antiviral activity attributable to this metabolite will be minimal and are also consistent with finding of ODBG-P-RVn ex vivo stability in human plasma (Fig. 3) . Collectively, these results suggest that ODBG-P-RVn will be effective in suppressing viral replication in a variety of tissue types in vivo. 

RDV is a prodrug designed to bypass the first phosphorylation of the remdesivir nucleoside (RVn), which may be rate limiting in the synthesis of RVn triphosphate, the active metabolite. This occurs by the successive action of carboxylesterases, cathepsin A, and phosphoamidases (16, 27) . However, this approach does not appear to provide any benefit in Vero E6 cells, a monkey kidney cell line, as shown by Pruijssers et al. (28) and by our results showing the antiviral activity of RVn is greater than that of RDV. Other perceived disadvantages of RDV include a lack of oral bioavailability, a difficult synthesis, instability in plasma, inadequate delivery to lung, and hepatotoxicity (13, 16) . In patients with COVID-19 and in the Syrian hamster model of SARS-CoV-2 disease, while high viral loads are notably present in the nasal turbinate, trachea, and lung, as the infection proceeds, many other tissues also become infected, including the intestine, heart, liver, spleen, kidney, brain, lymph nodes, and vascular endothelium (29) (30) (31) (32) (33) . However, RDV antiviral activity varies widely in lung and kidney cell lines, with EC 50 values of 1.65mM in Vero E6 cells, 0.28mM in Calu-3 2B4 cells, and 0.010mM in human alveolar epithelial (HAE) cells, a 165-fold difference (28) . We found similar results in Vero E6 (EC 50 , 1.13mM) and Calu-3 (0.23mM) cells. It has been suggested that this is due to variable amounts of the enzymes which convert RDV to RVn (13, 16) . The antiviral activity of ODBG-P-RVn was consistently high in all five cell types we tested (Fig. 5A) .

We chose to design prodrugs of RVn which could provide oral bioavailability, because an effective oral drug would allow for much earlier treatment of persons diagnosed with SARS-CoV-2 infection, when active viral replication is believed to be the key driver of the subsequent course of the illness. We accomplished this by constructing liponucleotides of RVn resembling lysophospholipids that are normally highly absorbed intact in the gastrointestinal (GI) tract (34, 35) . Liponucleotides of this type are not metabolized in plasma and gain rapid entry to the cell, often exhibiting greatly increased antiviral activity (36) (37) (38) (39) . In contrast to the activation of RDV, which requires four transformations, intracellular kinase bypass with ODBG-P-RVn generates the RVn monophosphate directly when the lipid ester moiety is cleaved in a single reaction catalyzed by acid phospholipase C (40, 41) or acid sphingomyelinase (sphingomyelin phosphodiesterase I) (K. Sandhoff and K. Y. Hostetler, unpublished). ODBG-P-RVn is likely to deliver relatively more drug to the lung and less to the liver, as shown previously in lethal mousepox infection, because of its apparent route to circulation via intestinal lymph rather that the portal vein (23, 24) . Finally, the synthesis of these lipid prodrugs is much simpler than that of RDV and is readily scalable. The limitations of RDV, including a lack of oral bioavailability, a difficult synthesis, instability in plasma with rapid conversion to RVn, a less active metabolite, inadequate delivery to lung, and dose-limiting hepatotoxicity, provide opportunities to improve its clinical utility. As reported here, we synthesized three lipid prodrugs of RVn which were highly active in five cell types infected with SARS-CoV-2. The most active compound, ODBG-P-RVn, is 8 times more active than RDV in Vero E6 cells, and the activity is equivalent to that of RDV in four other cell types. The cytotoxicity of ODBG-P-RVn is generally lower than that of RDV, is more consistent across 5 cell lines, and is not selectively higher in Huh7.5 cells, a hepatocyte cell line (Fig. 5) . Selectivity indexes are excellent and range from 295 to 699 in the five cell lines studied. ODBG-P-RVn achieved therapeutic levels in Syrian hamsters by twice daily oral gavage and was well tolerated over a 7-day period of administration. Collectively, our data support the development of lipid prodrugs of RVn as potent oral antivirals that could be used orally early in the course of COVID-19 to prevent serious disease requiring hospitalization.

Chemistry. All reagents were of commercial quality and used without further purification unless indicated otherwise. Chromatographic purification was performed using the flash method with silica gel 60 (EMD Chemicals, Inc.; 230 to 400 mesh). 1 H, 13 C, and 31 P nuclear magnetic resonance (NMR) spectra were recorded on either a Varian VX-500 or a Varian HG-400 spectrometer and are reported in units of parts per million relative to internal tetramethylsilane at 0.00 ppm. Electrospray ionization mass spectra (ESI-MS) were recorded on a Finnigan LCQDECA mass spectrometer at the small-molecule facility in the Department of Chemistry at University of California, San Diego. Purity of the target compounds was characterized by high-performance liquid chromatography (HPLC) using a Beckman Coulter System Gold chromatography system. The analytical column was Phenomenex Synergi Polar-RP (4.6 by 150 mm) equipped with a SecurityGuard protection column. Mobile phase A was 95% water-5% methanol, and mobile phase B was 95% methanol-5% water. At a flow rate of 0.8 ml/min, gradient elution was as follows: 10% B (0 to 3 min), 10% to 95% B (3 to 20 min), 95% B (20 to 25 min), and 95% to 10% B (25 to 34 min). Compounds were detected by UV light absorption at 274 nm. Purity of compounds was also assessed by thin-layer chromatography (TLC) using Analtech silica gel-GF (250 mm) plates and the fol- [19] ), HDP phosphate (compound 4a; 414 mg, 1.10 mmol, prepared as described by Kim et al. [42] ), and 4-dimethylaminopyridine (DMAP; 122 mg, 1.0 mmol) in 25 ml of dry pyridine, and then the mixture was heated to 90°C and stirred for 24 h. Pyridine was then evaporated, and the residue was purified by flash column chromatography on silica gel 60. Gradient elution (CH 2 Cl 2methanol, 10% to 20%) afforded 423 mg (67% yield) of 29,39-isopropylidene derivative of compound 5a. Concentrated HCl (0.1 ml) in tetrahydrofuran (THF) was added to a stirred solution of 29,39-isopropylidene-5a (100 mg, 0.14 mmol) in THF (10 ml) at room temperature. The mixture was stirred for 3 h, and then sodium bicarbonate (50 mg) and water (2 ml) were added. After stirring an additional 15 min, the solvents were evaporated, and cold water (10 ml) was added to the residue. The solid product was collected by vacuum filtration and dried under vacuum to yield compound 5a (79 mg, 87% yield) as an offwhite solid. 1 , 0.68 mmol) , and 4-dimethylaminopyridine (DMAP; 0.07 g, 0.6 mmol) in 10 ml of dry pyridine, and then the mixture was heated to 90°C and stirred for 3 days. Pyridine was then evaporated, and the residue was purified by flash column chromatography on silica gel 60. Gradient elution (CH 2 Cl 2 -methanol, 10% to 20%) afforded 0.22 g (45% yield) of 29,39-isopropylidene-5b. Concentrated HCl (0.3 ml) was added slowly to a stirred solution of 29,39-isopropylidene-5b (0.2 g, 0.28 mmol) in tetrahydrofuran (2 ml) at 0°C. The mixture was allowed to warm to room temperature overnight and then was diluted with water (2 ml) and adjusted to pH 8 by adding saturated sodium bicarbonate. The product was extracted with chloroform (3 Â 30 ml), and the organic layer was concentrated under reduced pressure. The residue was purified by flash chromatography on silica gel. Elution with 20% MeOH-CH 2 Cl 2 gave 0.10 g (55% yield) of compound 5b. 1 Cells. Vero E6, Caco-2, and Calu-3 cell lines were obtained from ATCC. Huh7.5 cells were obtained from Apath LLC. Calu-3 and Caco-2 cells were propagated in minimal essential medium (MEM) (Corning) with 10% fetal bovine serum (FBS) and penicillin-streptomycin (Gibco). Vero E6 and Huh7.5 cells were propagated in Dulbecco's minimal essential medium (DMEM; Corning) with 10% FBS and penicillin-streptomycin (Gibco). For human PSC-lung cell generation, human lung organoids were generated as previously described (43) . H9 embryonic stem cells (WiCell) were cultured under feeder-free conditions upon Matrigel (Corning number 354230)-coated plates in mTeSR medium (STEMCELL Technologies number 85850). Medium was changed daily, and stem cells were passaged using enzyme-free dissociation reagent ReLeSR (STEMCELL Technologies number 05872). Cultures were maintained in an undifferentiated state, in a 5% CO 2 incubator at 37°C. For proximal lung organoid generation, human PSCs were dissociated into single cells and then seeded on Matrigel-coated plates (BD Biosciences) at a density of 5.3 Â 10 4 cells/cm 2 in definitive endoderm (DE) induction medium (RPMI 1640 medium, 2% B27 supplement, 1% HEPES, 1% GlutaMAX, 50 U/ml penicillin-streptomycin) supplemented with 100 ng/ml human activin A (R&D Systems), 5mM CHIR99021 (Stemgent), and 10 mM ROCK inhibitor, Y-27632 (R&D Systems) on day 1. On days 2 and 3, cells were cultured in DE induction medium with only 100 ng/ml human activin A. Anterior foregut endoderm (AFE) was generated by supplementing serum-free basal medium (3 parts Iscove's modified Dulbecco's medium [IMDM] to 1 part F12, B27 plus N2 supplements, 50 U/ml penicillin-streptomycin, 0.25% bovine serum albumin [BSA], 0.05 mg/ml Lascorbic acid, and 0.4 mM monothioglycerol) with 10 mM SB431542 (R&D Systems) and 2 mM dorsomorphin (Stemgent) on days 4 to 6. On day 7, AFE medium was changed to lung progenitor cell (LPC) induction medium, containing serum-free basal medium supplemented with 10 ng/ml human recombinant BMP4 (R&D Systems), 0.1 mM all-trans retinoic acid (Sigma-Aldrich), and 3 mM CHIR99021. Medium was changed every other day for 9 to 11 days. To generate three-dimensional (3D) human proximal lung organoids, we modified a previously published protocol (44) . LPCs were dissociated in Accutase for 10 min and resuspended in Matrigel in a 12-well, 0.4-mm-pore-size Transwell (Corning) culture insert at 5.0 Â 10 4 cells/200ml of Matrigel. Cells were cultured in proximal lung organoid maturation medium using serum-free basal medium supplemented with 250 ng/ml basic fibroblast growth factor (FGF2), 100 ng/ml recombinant human fibroblast growth factor 10 (rhFGF10), 50 nM dexamethasone (Dex), 100 mM 8-bromoadenosine 39,59-cyclic monophosphate sodium salt (Br-cAMP), 100mM 3-isobutyl-1-methylxanthine (IBMX), and 10 mM ROCK inhibitor (Y-27632). Proximal lung organoid medium was changed every other day for 3 weeks. Human PSCderived lung organoids were dissociated into single cells and seeded at 20,000 cells per well of a Matrigelcoated 96-well plate 1 day before transfection. Transwells containing the proximal organoids in Matrigel were incubated in 2 U/ml dispase for 30 min at 37°C. Cold phosphate-buffered saline (PBS) was added to the mixture and then centrifuged at 400 Â g for 5 min. Supernatant was carefully removed and resuspended in 2 to 3 ml of TrypLE Express (Gibco number 12605010) for 20 min at 37°C. The reaction was quenched with 2% FBS in DMEM/F12 and then centrifuged at 400 Â g for 5 min. The supernatant was aspirated, and the cell pellet was resuspended in 1 ml of quenching medium supplemented with 10mM ROCK inhibitor (Y-27632). A cell count was performed, and the respective volumes of cells were transferred into a reagent reservoir trough, resuspended in proximal lung organoid maturation medium, and plated via multichannel pipette into 96-well plates at 100 ml per well as monolayers.

SARS-CoV-2 infection. SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources) was propagated and infectious units were quantified by plaque assay by using Vero E6 (ATCC) cells. Approximately 12,000 cells from each cell line were seeded per well in a 96-well plate. Vero E6 and Huh7.5 cells were seeded approximately 24 h prior to treatment/infection. Calu-3 and Caco-2 cells were seeded approximately 48 h prior to treatment/infection. Human PSC-lung cell infections and cytotoxicity experiments were performed when cells reached 100% confluence. Compounds or controls were added at the concentrations indicated in the figures and text 30 min prior to infection, followed by the addition of SARS-CoV-2 at a multiplicity of infection equal to 0.01. After incubation for 48 h at 37°C and 5% CO 2 , cells were washed twice with PBS and lysed in 200 ml TRIzol (Thermo Fisher). All work with SARS-CoV-2 was conducted under biosafety level 3 conditions at the University of California San Diego with approval from the Institutional Biosafety Committee.

Human coronavirus 229E infection. Human coronavirus 229E (ATCC) was propagated and infectious units were quantified by 50% tissue culture infective dose (TCID 50 ) using MRC-5 cells. For antiviral testing, approximately 10 4 MRC-5 cells were seeded per well in Eagle's minimal essential medium (EMEM) (10% fetal calf serum [FCS]) at 37°C in a 96-well plate overnight. Medium from each well was removed, and cells were infected with 100 TCID 50 virus in 100 ml medium for 2 h. Cells were washed one time with medium, and then compounds or controls were added at the concentrations indicated in the text and figures. After 3 days, CPE was observed under a microscope and quantified using a 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) cell proliferation assay kit (Abcam) and read on an ELx800 universal microplate reader (BioTek Instruments, Inc.). The percent inhibition was calculated as (A tv 2 A cv )/(A cd 2 A cv ) Â 100, where A tv indicates the absorbance of the test compounds with virus-infected cells, and A cv and A cd indicate the absorbance of the virus control and the absorbance of the cell control, respectively. The average half-maximal effective concentration (EC 50 ) was defined as the concentration which achieved 50% inhibition of virus-induced cytopathic effects.

RNA extraction, cDNA synthesis, and qPCR. RNA was purified from TRIzol lysates using Direct-zol RNA microprep kits (Zymo Research) according to manufacturer's recommendations that included DNase treatment. RNA was converted to cDNA using the iScript cDNA synthesis kit (Bio-Rad), and qPCR was performed using iTaq universal SYBR green supermix (Bio-Rad) and an ABI 7300 real-time PCR system. cDNA was amplified using the following primers: RPLP0 F, GTGTTCGACAATGGCAGCAT; RPLP0 R, GACACCCT CCAGGAAGCGA; SARS-CoV-2 spike F, CCTACTAAATTAAATGATCTCTGCTTTACT; SARS-CoV-2 spike R, CAAG CTATAACGCAGCCTGTA. Relative expression of SARS-CoV-2 spike RNA was calculated by the comparative threshold cycle (DDC T ) method by first normalizing to the housekeeping gene RPLP0 and then comparing to SARS-CoV-2-infected Vero E6 cells that were untreated (reference control). Curves were fit using the nonlinear regression minus log(inhibitor) versus response (four parameter) model using Prism 9. To calculate effective concentrations (EC 50 and EC 90 values), qRT-PCR values were normalized to percent inhibition and curves were fit using the nonlinear regression minus log(agonist) versus response (four parameter) model with the bottom and top constrained to 0 and 100, respectively, using Prism 9.

Cell viability assay. Cell types were seeded as per SARS-CoV-2 infection studies in opaque-walled 96-well cell culture plates or as per 229E infection studies in clear 96-well cell culture plates and incubated overnight. Compounds or controls were added at the concentrations indicated in the text and figures. For SARS-CoV-2-related studies, cells were incubated for 48.5 h at 37°C and 5% CO 2 ; then, equal volumes of CellTiter-Glo reagent (catalog number G7570; Promega, Madison, WI) were added and mixed, and luminescence was recorded on a Veritas microplate luminometer (Turner BioSystems) according to the manufacturer's recommendations. For 229E-related studies, cells were incubated for 72 h at 37°C and 5% CO 2 ; then, supernatants were removed and 50 ml of serum-free medium and 50 ml of MTT reagent (Abcam ab211091) were added to each well and incubated for 3 h at 37°C. Absorbance was measured on an ELx800 universal microplate reader (BioTek Instruments, Inc.) according to the manufacturer's recommendations. Percent viability was calculated compared to that of untreated controls, and CC 50 values were calculated using Prism 9.

Ex vivo stability in human plasma. Pooled mixed-gender human plasma samples were obtained from BioIVT (Westbury, NY). ODBG-P-RVn was incubated in human plasma with K 2 EDTA or sodium heparin as the anticoagulant at a final concentration of 2.00 mg/ml. After incubation at 37°C, duplicate samples of the test article incubations were taken at 0 (preincubation), 0.5, 1, 2, 4, 8, and 24 h and immediately frozen at 270°C. The extracts were prepared by a solid-phase extraction using a Waters Sep Pak tC 18 25 mg SPE plate and analyzed as described below.

Analytical methods. (i) ODBG-P-RVn. Hamster plasma samples (10 ml) containing ODBG-P-RVn and K 2 EDTA as the anticoagulant were added to polypropylene tubes containing water (100 ml), internal standard solution ( . After elution, 100 ml of water was added to each sample. The ODBG-P-RVn extracts were analyzed using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA) coupled to an API5500 mass analyzer (SCIEX, Foster City, CA). Analytes were chromatographically separated using a Dacapo DX-C 18 MF column (100 by 2 mm, 2.5 mm; Imtakt USA, Portland, OR) using a mobile phase system consisting of mobile phase A (water-formic acid-[water-ammonium formate-citric acid; 25:5:0.5 {vol/wt/wt}], 1,000:1:1 [vol/ vol/vol]) and mobile phase B (acetonitrile-isopropyl alcohol-formic acid-[water-ammonium formate-citric acid; 25:5:0.5 {vol/wt/wt}], 800:200:1:1 [vol/vol/vol/vol]). The total analytical run time was 4.5 min. The mobile phase was nebulized using heated nitrogen in a Turbo-V source/interface set to electrospray positive ionization mode. The ionized compounds were detected using multiple-reaction monitoring with transitions m/z 788.4 . 229 (V2043) and 668.4 . 467.2 (V2041). This method is applicable for measuring ODBG-P-RVn concentrations ranging from 6.25 to 3,000 ng/ml using 10.0 ml of plasma for extraction. The peak areas of ODBG-P-RVn and RVn were acquired using Analyst v. 1.6.2 (SCIEX, Framingham, MA). The calibration curve was obtained by fitting the peak area ratios of the analyte/internal standard (IS) and the standard concentrations to a linear equation with 1/x 2 weighting, using Analyst. The equation of the calibration curve was then used to interpolate the concentrations of the analyte in the samples using their peak area ratios. The peak areas used for the calculations were not rounded.

(ii) RVn (GS-441524). Hamster plasma samples (20 ml) containing GS-441524 and K 2 EDTA as the anticoagulant were added to Eppendorf LoBind microcentrifuge tubes containing acetonitrile (300 ml) and water-acetonitrile (2:8 [vol/vol]; 60 ml). The solutions were mixed and centrifuged at 16,000 Â g for 5 min. The supernatant (300 ml) was then filtered through an Ostro protein precipitation and phospholipid removal plate (25 mg; Waters, Milford, MA). Filtration occurred under positive pressure conditions using nitrogen. Collected filtered samples were capped, mixed, and stored at 10°C pending analysis. The GS-441524 extracts were analyzed using an Acquity ultraperformance liquid chromatography (UPLC) system (Waters) coupled to a G2-S quadrupole time of flight (QTOF) mass analyzer (Waters). Analytes were chromatographically separated using a Unison-UK Amino HT column (100 by 2 mm, 3 mm; Imtakt USA, Portland, OR) using a mobile phase system consisting of mobile phase A (0.008% ammonium hydroxide, 0.012% acetic acid in water [vol/vol/vol]) and mobile phase B (0.008% ammonium hydroxide, 0.012% acetic acid in acetonitrile [vol/vol/vol]). The total analytical run time was 12.5 min. The mobile phase was nebulized using heated nitrogen in a Z-spray source/interface set to electrospray positive ionization mode. The ionized compounds were detected using TOF MS scan monitoring in sensitivity mode scanning from 50.0 to 700 m/z. This method is applicable for measuring GS-441524 concentrations ranging from 1.00 to 1,000 ng/ml using 20.0 ml of plasma for extraction. The peak areas of GS-441524 were acquired using MassLynx V4.2 (Waters). The calibration curve was obtained by fitting the peak area ratios of the analyte and the standard concentrations to a linear equation with 1/x 2 weighting using MassLynx. The equation of the calibration curve was then used to interpolate the concentrations of the analyte in the samples using their peak areas. The peak areas used for the calculations were not rounded.

Supplemental material is available online only. SUPPLEMENTAL FILE 1, PDF file, 0.5 MB.

Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People's Republic of China

Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia

China Novel Lipid Prodrugs of Remdesivir in SARS-CoV-2 Infection Antimicrobial Agents and Chemotherapy

Coronavirus Investigating and Research Team. 2020. A novel coronavirus from patients with pneumonia in China

Clinical characteristics of refractory COVID-19 pneumonia in

Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study

Unique SARS-CoV-2 clusters causing a large COVID-19 outbreak in Hong Kong

Efficacy and safety of the mRNA-1273 SARS-CoV-2 vaccine

C4591001 Clinical Trial Group. 2020. Safety and efficacy of the BNT162b2 mRNA Covid-19 vaccine

Broad-spectrum antiviral GS-5734 inhibits both epidemic and zoonotic coronaviruses

Remdesivir is a direct-acting antiviral that inhibits RNA-dependent RNA polymerase from severe acute respiratory syndrome coronavirus 2 with high potency

Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro

Advantages of the parent nucleoside GS-441524 over remdesivir for Covid-19 treatment

ACTT-1 Study Group Members. 2020. Remdesivir for the treatment of Covid-19-final report

The antiviral compound remdesivir potently inhibits RNA-dependent RNA polymerase from Middle East respiratory syndrome coronavirus

Comprehensive summary supporting clinical investigation of GS-441524 for Covid-19 treatment

Prophylactic and therapeutic remdesivir (GS-5734) treatment in the rhesus macaque model of MERS-CoV infection

Clinical benefit of remdesivir in rhesus macaques infected with SARS-CoV-2

Therapeutic efficacy of the small molecule GS-5734 against Ebola virus in rhesus monkeys

COVID 19 INMI Study Group. 2020. Pharmacokinetics of remdesivir and GS-441524 in two critically ill patients who recovered from COVID-19

Enhanced oral absorption and antiviral activity of 1-O-octadecyl-sn-glycero-3-phospho-acyclovir and related compounds in hepatitis B virus infection, in vitro

Antiviral activities of oral 1-O-hexadecylpropanediol-3-phosphoacyclovir and acyclovir in woodchucks with chronic woodchuck hepatitis virus infection

Efficacy of oral active ether lipid analogs of cidofovir in a lethal mousepox model

Oral 1-O-octadecyl-2-O-benzyl-sn-glycero-3-cidofovir targets the lung and is effective against a lethal respiratory challenge with ectromelia virus in mice

Rethinking remdesivir: synthesis, antiviral activity and pharmacokinetics of oral lipid prodrugs

Discovery and synthesis of a phosphoramidate prodrug of a pyrrolo[2,1-f][triazin-4-amino] adenine C-nucleoside (GS-5734) for the treatment of Ebola and emerging viruses

Remdesivir: a review of its discovery and development leading to emergency use authorization for treatment of COVID-19

Remdesivir inhibits SARS-CoV-2 in human lung cells and chimeric SARS-CoV expressing the SARS-CoV-2 RNA polymerase in mice

Simulation of the clinical and pathological manifestations of coronavirus disease 2019 (COVID-19) in a golden Syrian hamster model: implications for disease pathogenesis and transmissibility

Multiorgan and renal tropism of SARS-CoV-2

Pulmonary vascular endothelialitis, thrombosis, and angiogenesis in Covid-19

Extrapulmonary manifestations of COVID-19

Progress report on the coronavirus pandemic

Incorporation of dietary lecithin and lysolecithin into lymph chylomicrons in the rat

Fat digestion and absorption

Alkoxyalkyl prodrugs of acyclic nucleoside phosphonates enhance oral antiviral activity and reduce toxicity: current state of the art

Synthesis and early development of hexadecyloxypropyl-cidofovir: an oral antipoxvirus nucleoside phosphonate

Oral treatment of murine cytomegalovirus infections with ether lipid esters of cidofovir

Ether lipid-ester prodrugs of acyclic nucleoside phosphonates: activity against adenovirus replication in vitro

Properties of phospholipase C isolated from rat liver lysosomes

Phospholipase C activity of rat tissues

A novel cytarabine crystalline lipid prodrug: hexadecyloxypropyl cytarabine 39,59-cyclic monophosphate for proliferative vitreoretinopathy

Snyder EY Generation of complete multi-cell type lung organoids from human embryonic and patient-specific induced pluripotent stem cells for infectious disease modeling and therapeutics validation

Efficient derivation of functional human airway epithelium from pluripotent stem cells via temporal regulation of Wnt signaling

This research was supported by NIAID grant R01 AI131424 and the San Diego Center for AIDS Research as well as an NIH grant (K08 AI130381) and Career Award for Medical Scientists from the Burroughs Welcome Fund to A.F.C., and by CIRM (DISC2COVID19-12022) to S.L.L.The following reagent was deposited by the Centers for Disease Control and Prevention and obtained through BEI Resources, NIAID, NIH: SARS-related coronavirus 2, isolate USA-WA1/2020, NR-52281.