key: cord-0890796-ai4upf3v
authors: Gray, Chyna C.; Biron-Girard, Bethany; Wakeley, Michelle E.; Chung, Chun-Shiang; Chen, Yaping; Quiles-Ramirez, Yael; Tolbert, Jessica D.; Ayala, Alfred
title: Negative Immune Checkpoint Protein, VISTA, Regulates the CD4(+) T(reg) Population During Sepsis Progression to Promote Acute Sepsis Recovery and Survival
date: 2022-03-24
journal: Front Immunol
DOI: 10.3389/fimmu.2022.861670
sha: 2dfa0fe2acade74a92120246421ce9d7a3731cce
doc_id: 890796
cord_uid: ai4upf3v

Sepsis is a systemic immune response to infection that is responsible for ~35% of in-hospital deaths and over 24 billion dollars in annual treatment costs. Strategic targeting of non-redundant negative immune checkpoint protein pathways can cater therapeutics to the individual septic patient and improve prognosis. B7-CD28 superfamily member V-domain Immunoglobulin Suppressor of T cell Activation (VISTA) is an ideal candidate for strategic targeting in sepsis. We hypothesized that immune checkpoint regulator, VISTA, controls T-regulatory cells (T(reg)), in response to septic challenge, thus playing a protective role/reducing septic morbidity/mortality. Further, we investigated if changes in morbidity/mortality are due to a T(reg)-mediated effect during the acute response to septic challenge. To test this, we used the cecal ligation and puncture model as a proxy for polymicrobial sepsis and assessed the phenotype of CD4(+) T(regs) in VISTA-gene deficient (VISTA(-/-)) and wild-type mice. We also measured changes in survival, soluble indices of tissue injury, and circulating cytokines in the VISTA(-/-) and wild-type mice. We found that in wild-type mice, CD4(+) T(regs) exhibit a significant upregulation of VISTA which correlates with higher T(reg) abundance in the spleen and small intestine following septic insult. However, VISTA(-/-) mice have reduced T(reg) abundance in these compartments met with a higher expression of Foxp3, CTLA4, and CD25 compared to wild-type mice. VISTA(-/-) mice also have a significant survival deficit, higher levels of soluble indicators of liver injury (i.e., ALT, AST, bilirubin), and increased circulating proinflammatory cytokines (i.e., IL-6, IL-10, TNFα, IL-17F, IL-23, and MCP-1) following septic challenge. To elucidate the role of T(regs) in VISTA(-/-) sepsis mortality, we adoptively transferred VISTA-expressing T(regs) into VISTA(-/-) mice. This adoptive transfer rescued VISTA(-/-) survival to wild-type levels. Taken together, we propose a protective T(reg)-mediated role for VISTA by which inflammation-induced tissue injury is suppressed and improves survival in early-stage murine sepsis. Thus, enhancing VISTA expression or adoptively transferring VISTA(+) T(regs) in early-stage sepsis may provide a novel therapeutic approach to ameliorate inflammation-induced death.

Despite exhaustive research on sepsis over the last 50 years (1) there remains no effective patho-physiological treatment options nor molecular methods of diagnosis. The incidence of sepsis has not improved, with sepsis accounting for~35% of non-cardiac deaths during intensive care unit hospitalization, accounting for 1 in 5 deaths worldwide (2) , and it was the consensus cause of death assigned to those dying from COVID-19 infection (3) . At >24 billion dollars in annual treatment costs, sepsis presents an economic as well as a healthcare burden (4) . Historically, sepsis clinical trials have targeted the initial pro-inflammatory response by inhibiting cytokines in septic patients (5, 6) . Efficacy was not universal, and treatment predisposed patients to fatal secondary infections (7) .

Immune checkpoint blockade (ICB) has been used to ameliorate disease pathology with greater precision and success than many immune-directed therapies (8) . Our laboratory, among others, has demonstrated that negative checkpoint regulator (NCR) targeting improves survival in preclinical sepsis models, but success has been limited in clinical trials (9) (10) (11) (12) (13) (14) (15) . Strategic targeting of non-redundant NCR pathways has the potential to cater therapeutics to the individual septic patient and improve prognosis (16) (17) (18) .

B7-CD28 superfamily member V-domain Immunoglobulin Suppressor of T cell Activation (VISTA) is an ideal candidate for such potential strategic targeting in sepsis (18, 19) . VISTA is a 55-65-kDa type 1 transmembrane protein and has unique biology that set it apart from all other NCRs (20, 21) .

VISTA can act as a receptor or a ligand binding in VISTA : VISTA interactions, with VSIG-3, or with PSGL-1 depending on the cell it is expressed on (22, 23) . VISTA regulation is also temporally distinct, acting as the earliest NCR of peripheral tolerance. Under steady-state conditions, VISTA promotes quiescence of naïve CD4 + T cells to prevent self-reactivity (24) . Under inflammatory conditions, VISTA suppresses effector CD4 + T cell function (17, 20) , maintains the T regulatory cell (T reg ) pool size, and promotes induced T reg (iT reg ) generation (25) . This CD4 + T cell-specific modularity makes VISTA a specific and non-redundant regulator of the acute T cell response (24) (25) (26) (27) .

Septic patients experience a reduced number/frequency of splenic and thymic T cells, decreased cytokine production, and increased expression of exhaustion markers (28, 29) . In murine sepsis models, there is a significant loss of CD4 + T cell frequency which impacts survival (30) . Our laboratory, among others, has demonstrated that T regs play an indispensable role in the acute septic response, resolving inflammatory tissue damage and improving survival (31) (32) (33) (34) .

Based on the findings from our laboratory and others, we set out to determine if the immune checkpoint regulator VISTA controls T-regulatory cells (T reg ), in response to septic challenge, thus playing a protective role and reducing septic morbidity/ mortality. Further, we investigated if changes in morbidity/ mortality were due to a T reg -mediated effect during the acute response to a septic challenge.

Male C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA). Animals obtained from our outside vendor were acclimated no less than 7 days, and often longer [maximum~5 weeks], prior to utilizing these animals in the studies described here. During this period, they were housed in the Rhode Island Hospital (RIH) rodent facility (12-h: 12-h light/ dark cycle, 23°C-25°C, 30%-70% humidity) where they received standard care and diet (standard rodent chow)/water ad libitum. All protocols were carried out in the morning (8-11 a.m.) and were performed in accordance with the National Institutes of Health guidelines and as approved by the Animal Use Committee of Rhode Island Hospital (AWC# 5064-18 & 5054-21). VISTA -/mice were produced at the Brown University Transgenic Facility using CRISPR/Cas9 technology. Guide RNA sequences for the 5′ deletion site: 395_Vsir_ex2upsgRNA1: CTTAGTAACAAGACCCACAT 396_Vsir_ex2upsgRNA2: GCTTAGTAACAAGACCCACA Guide RNA sequences for the 3′ deletion site: 398_Vsir_ex7sgRNA1: ATGTGCACTTGATCTATGGC (18-mer) 399_Vsir_ex7sgRNA2: GTGCCTAAAAGACTGTCCAA The initial genotyping strategy and PCR results for G1 and F0 generations are described in Supplemental Figure 1 . A routine genotyping of VISTA -/mice was performed on tail biopsy samples collected after weaning. Tail samples were processed for PCR and treated with custom 25-nmol DNA oligos from Integrated DNA Technologies (Coralville, IA, USA). Following PCR amplification, samples were run on an SDS-Page gel and imaged for gene deletion analysis and validation. Male mice with appropriate base-pair deletion were used for downstream studies. All mice were housed, bred, and maintained at the Rhode Island Hospital Central Research Facilities.

Septic/critically ill patients who were admitted to trauma and surgical intensive care units, between July of 2018 and February of 2020, were enrolled in this study per institutional review board approval at Rhode Island Hospital (IRB study # 413013). Inclusion criteria for the study were trauma or sepsis-related critical illness requiring ICU admission. Patients were excluded from the study if they were pregnant or had previous lymphoma or leukemia diagnosis. Patient demographics from the day of blood draw were used to calculate the Acute Physiology of Chronic Health Evaluation II (APACHE II) score ( Table 1) . Healthy volunteers (age-and sex-matched) were enrolled in this study to serve as the control group.

intraperitoneal cavity. The abdomen was closed using a sterile PDO suture. Mice were treated with lidocaine on the muscle layer and a subcutaneous injection of 1 ml Lactated Ringer's solution. The choice of male animals was made to maximize our ability to initially see an experimental difference septic response based on previous reports that male mice did poorer in response to these experimental stressors of septic (CLP) challenge than pro-estrus stratified female mice (38, 39) . Mice were euthanized 24 h post procedure (based on the experiment as described in Figure 1 ), and tissues were harvested for downstream studies.

The spleen, thymus, and intestine were harvested from mice 24 h following sham or CLP procedure. The spleen and thymus tissues were homogenized using frosted slides, and red blood cells were lysed using a Na + Clgradient. Small intestinal tissue was processed using the Lamina Propria Dissociation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany: cat# 130-097-410) according to the manufacturer protocol. The total cell number from each sample was assessed using Trypan blue stain and 

Whole blood was drawn from patients and healthy controls, collected in heparin-treated tubes, treated with Ficoll Histopaque-1077, and centrifuged to isolate leukocytes. The leukocyte layer was isolated, washed with PBS, and centrifuged. Cells were counted using a hemacytometer and Trypan blue then diluted to 10 6 

For adoptive transfer, the pMSCV-mouse Foxp3-EF1a-GFP-T2Apuro stable Jurkat cell line (System Biosciences, Palo Alto, CA, USA: cat# TCL110C-1), referred to as Jurkat T regs , was harvested from culture, pelleted via centrifugation, and resuspended in HBSS (Thermo Fisher: cat# 24020117) at 2 × 10 6 cells/400 µl. 400 µl of Jurkat T reg suspension or HBSS vehicle control was loaded into a syringe and administered to mouse via intraperitoneal injection. Spleen, thymus, and small intestine samples were harvested 48 h post adoptive transfer and processed as described in the previous section. Cells were stained with CD4-BV421 (BioLegend: Cat# 100438, RRID : AB_11203718) and VISTA/PD-1H-APC (BioLegend: Cat# 143709, RRID : AB_11219607). A FMO control was used to determine VISTA-positive expression gates during analysis using FlowJo software.

To assess indices of tissue injury, blood was collected from mice 24 h following sham or CLP procedure via cardiac puncture using a heparin-coated syringe. Blood sample was centrifuged at 10,000 rpm, and supernatant (plasma) was collected and stored at -80°C. For tissue injury assays, plasma was analyzed using the following kits according to the manufacturer's protocol: 

Jurkat T regs were cultured in RPMI complete medium with 13F3 (Bio X Cell, Lebanon, NH, USA, Cat# BE0310, RRID : AB_2736990) or Ig control (Bio X Cell Cat# BE0091, RRID : AB_1107773) for 30 min at 37°C, 5% CO 2 then stained with alamarBlue (Bio-Rad, Hercules, CA, USA: product code BUF012A) according to the manufacturer's protocol. Sample absorbance was measured every 24 h for 7 days using the Bio-Rad spectrophotometer. Viability was calculated according to the manufacturer's protocol.

Jurkat T regs were cultured in RPMI complete medium with 13F3 (Bio X Cell Cat# BE0310, RRID : AB_2736990) or Ig control (Bio X Cell Cat# BE0091, RRID : AB_1107773) overnight at 37°C, 5% CO 2 . Treated cells were then stimulated with 5 µl of plasma from CLP mouse for 2 h prior to harvest from culture. Cells were centrifuged, and supernatant was collected for multiplex analysis using LEGENDplex MU Th Cytokine Panel (12-plex) with VbP VO3 (BioLegend: cat# 741044) according to the manufacturer's protocol. Multiplex experiments were carried out using MACSQuant Analyzer 10 (Miltenyi Biotec). Data were analyzed using LEGENDplex software suite (BioLegend).

Statistical significance between two groups was determined using either a two-tailed Student's unpaired t test for parametric data or the Mann-Whitney U test for the non-parametric test. Statistical significance between multiple groups was determined using either an ordinary one-way ANOVA for parametric data or the Kruskal-Wallis test for non-parametric data. Alpha was set to 0.05 as the cutoff for statistical significance using Prism 9.3.0 (GraphPad Software) statistical software.

Several research groups have shown that during acute sepsis progression there is a significant loss in T cell abundance in the spleen and thymus in both the murine CLP model (29, (40) (41) (42) and septic patients (43) (44) (45) (46) . In this study, we found that C57BL/6 wild-type (WT) mice exhibited a higher VISTA expression on CD4 + T cells ( Figure 2A ) and reduced CD4 + T cell population abundance ( Figure 2B ) in the spleen following septic challenge. We enrolled a total of 8 critically ill patients from the trauma and surgical ICUs at a single level-1 trauma center. There was no significant difference between patients and healthy controls regarding gender or age. 87.5% of patients had an active ongoing source of infection at the time of draw, 62.5% required mechanical ventilation, and 37.5% were actively on vasopressor at the time of draw. 25% required dialysis due to critical illness. The average APACHE II score for the population was 19.9 ( Table 1) .

Sources of infection included necrotizing soft tissue infections of the lower extremities, intra-abdominal abscesses after perforated hollow viscus injuries, and bacteremia. 75% of enrolled patients met systemic inflammatory response syndrome (SIRS) criteria, 63% met sepsis criteria, and 38% met septic shock criteria (47) .

We found that critically ill patients experience a higher VISTA expression on circulating CD3 + T cells ( Figure 2C ) despite reduced CD3 + T cell population abundance ( Figure 2D ) in circulation. These results suggest that the relationship between VISTA expression and T-cell abundance observed in our murine model of sepsis appear to have a potential correlate in the critically ill septic patient. To further explore the role of VISTA in the sepsis-induced T-cell response and better understand its potential contribution to septic morbidity, we created a global VISTA gene-deficient (VISTA -/-) mouse strain using CRISPR/Cas9 technology that could be examined to address this question ( Figures 2E, F) .

Le Tulzo et al. found that T cells become polarized into functionally distinct helper T-cell subsets in sepsis (44) , and it is well documented that the regulatory T-cell (T reg ) subset increases during the acute septic response (46, 48, 49) . In light of this, we chose to initially determine how VISTA impacted sepsis-induced T reg polarization by comparing the CD4 + Foxp3 + T reg populations in WT as opposed to VISTA -/mice via flow cytometry (Supplementary Figure 2) . We found that in the WT spleen, there is a significant increase in total proportion of CD4 + T regs and VISTA + CD4 + T regs following CLP (Figures 3A-C) . VISTA -/mice exhibit decreased abundance of total CD4 + T regs in the spleen (Figures 3B, C) .

In the thymus, we observe no change in VISTA expression on the T r e g populations between sham and CLP WT mice (Supplementary Figures 3A, D) ; however, VISTA -/mice have higher total abundance of CD4 + T regs and CD4 + CD8 + T regs compared to WT mice (Supplementary Figures 3B, E) . In the intraepithelial compartment of the small intestine, the frequency of VISTA + CD4 + T regs increases significantly following CLP ( Figure 4A ) and VISTA -/mice have less CD4 + T regs under steady-state (sham) and inflammatory (CLP) conditions compared to WT mice ( Figures 4B, C) . We did not observe any trends in the lamina propria compartment of the small intestine (Supplementary Figure 4 ).

The loss in CD4 + T regs in VISTA -/mice lead us to ask if the cellsurface expression signature, as it related to suppressive function of these cells, was altered by CLP. In the spleen, Foxp3, CTLA4, and CD25, but not CD69, are significantly upregulated on CD4 + T regs in VISTA -/mice compared to WT mice under steady-state and inflammatory conditions ( Figures 5A-D) . In the thymus ( Figures 6A-G) , CD25 is significantly upregulated on CD4 + T regs in VISTA -/mice compared to WT mice under steady state and inflammatory conditions ( Figure 6C ). CD4 + T regs upregulate CD69 following CLP in WT and VISTA -/mice ( Figure 6D ). We also found that Foxp3, CTLA4, and CD25 are significantly upregulated on CD4 + CD8 + T regs in WT mice compared to VISTA -/mice under steady-state and inflammatory conditions ( Figures 6E-G) . In the lamina propria compartment, we observe a significant upregulation of CTLA4 on CD4 + T regs in VISTA -/mice (Supplementary Figure 5B) . However, this trend is not observed in the small intestinal intraepithelial compartment (Supplementary Figure 6 ).

To expand from the T reg phenotyping described above, we sought to measure the abundance of several cytokines in circulation implicated in the helper T cell response ( Figures 7A-J) . We found that VISTA -/mice have significantly higher circulating IL-17F and IL-23 compared to WT mice post CLP ( Figures 7G, I) .

Based on the apparent compensatory upregulation of suppressive T reg mediators, we decided to compare the mortality and morbidity of VISTA -/as opposed to WT mice when subjected 

To establish the contribution of VISTA + T regs to survival in murine sepsis, we chose to adoptively transfer pMSCV-mouse Foxp3-EF1a-GFP-T2A-puro stable Jurkat cells, hereby referred to as Jurkat T regs , into VISTA -/mice prior to CLP. 48 h post adoptive transfer, Jurkat T regs accumulate in the spleen, thymus, and small intestine (Supplementary Figures 7A-D) and express high levels of VISTA ( Supplementary Figures 7E-H) . Based on these results, we performed the adoptive transfer 48 h before CLP and then subsequently assessed overall survival. We found that, following Jurkat T reg adoptive transfer, VISTA -/mice had comparable survival to WT mice post CLP ( Figure 10A ).

In addition to establishing the relevance of VISTA-expressing T regs in septic mouse morbidity/mortality, we wanted to uncover how VISTA expression/ligation might be directly impacting T reg function. To do this, we again utilized the Jurkat T reg cell line for mechanistic in vitro studies. Jurkat T regs were pretreated with a commercially available VISTA-neutralizing antibody, 13F3, or antibody control then stained with alamarBlue. alamarBlue is a redox indicator used to measure metabolic activity as a readout for viability. The concentration of alamarBlue was assessed via a spectrophotometer every 24 h for 7 days. We found that there was a significant reduction in viability following treatment and this reduction was maintained for 7 days without additional 13F3 treatment ( Figure 10B ). Upon in vitro acute stimulation of Jurkat T regs with plasma from septic mice, these cells produce several helper T cell-related cytokines (Figures 10C-I) but failed to produce IFN-g, IL-4, or IL-17A (Supplementary Figure 8) .

Interestingly, 13F3-treated Jurkat T regs produce lower levels of IL-9, IL-10, and IL-17F following acute stimulation ( Figures 10E, F, H) .

Since its initial discovery, VISTA has been implicated in diverse immune-related pathologies driven by both innate and adaptive cells (20) (21) (22) (23) (24) (25) (26) (27) (50) (51) (52) (53) (54) . In a preliminary study, we found that septic mice and critically ill patients exhibit a higher proportion of VISTA + T cells as compared to healthy controls. Based on these results, we set out to determine the impact of VISTA expression on regulatory T cells (T regs ) in murine sepsis. The CD4 + T reg plays a vital role in peripheral tolerance, regulation of effector cells, and prevention of bystander tissue damage under inflammatory and steady-state conditions as reviewed by Corthay (55) . In sepsis, peripheral T regs increase significantly 

The T reg classification as a distinct T cell lineage has been a point of contention due to the inherent plasticity of T regs and the lack of a definitive "T reg " marker as effector T cells can transiently express T reg markers upon activation. Forkhead/winged-helix transcription factor box P3 (Foxp3) is arguably the most reliable T reg marker in mice and was used to delineate effector T cells and T regs in this study (55, 58, 59) . CD4 + Foxp3 + T cells are potent suppressors of effector CD4 + T cells, CD8 + T cells, natural killer (NK) cells, dendritic cells (DCs), and B cells under inflammatory conditions (55).

In this study, we found that VISTA expression and total CD4 + T reg abundance increase significantly during the acute septic response. Further, this increase in peripheral T reg abundance is dependent on VISTA expression. We also found that VISTA expression plays a role in orchestrating the cytokine response to septic challenge. Cytokines provide contextual immunologic cues that shape cell lineage determination and plasticity. Higher levels of IL-17F, IL-6, and IL-23 promote CD4 + T cell polarization toward a Th17 phenotype, and higher concentrations of these cytokines may explain the reduced T reg abundance observed in VISTA -/mice (60, 61) . Previous studies found that VISTA regulated the T reg -Th17 polarization axis in mice (25) , further supporting our results in the context of sepsis. Interestingly, CTLA4 expression regulates the turnover and maintenance of T regs at steady state while Foxp3 regulates T reg function and lineage commitment (62) (63) (64) . A steady-state T reg pool is requisite for preventing autoimmune lymphoproliferative pathology (65) . Several groups have shown that VISTA -/mice do not exhibit overt autoimmune pathologies under tolerogenic conditions (26, 53, 66) . Therefore, we posit that the higher baseline expression of CTLA4, Foxp3, and CD25 in VISTA-deficient CD4 + T regs represents an inherent compensatory mechanism to sustain peripheral tolerance under tolerogenic conditions.

In the Acute Immune Response to Infection, as Observed With Our Murine Model of Sepsis, Compensatory Upregulation of CTLA4, Foxp3, and CD25 by CD4 + T regs Is Insufficient

An explanation may lie in the efficacy of CTLA4, Foxp3, and/or CD25-mediated suppression in our model. CD4 + T regs utilize diverse contact-dependent and independent mechanisms to exert immune suppression (35-37, 67, 68) . For example, CTLA4-expressing T regs bind to B7-1/2 on antigen-presenting DCs, promoting transendocytosis of B7-1/2 and preventing DC-mediated activation of effector T cells. CD25 scavenges IL-2 from the environment, reduces IL-2 activation of effector T cells via competitive inhibition, and regulates the function of mature DCs (69) . Another mechanism by which T regs exert immune suppression is by directly polarizing the monocyte lineage commitment from M1 to M2 macrophages (69, 70) . M1 macrophages produce proinflammatory cytokines and exacerbate inflammation-derived tissue injury in sepsis (71). Two potent M1 cytokines, IL-6 and MCP-1, are highly upregulated in VISTA -/mice following septic challenge. M1-mediated pathology is particularly profound in the liver during infection (72) , which may explain the increased acute liver injury observed in septic VISTA -/mice. overexpressing Jurkat T regs into VISTA -/mice prior to septic challenge. We found that addition of Jurkat T regs into VISTA -/mice rescues survival to wild-type levels. Upon VISTA blockade in vitro, the Jurkat T regs exhibited reduced proliferative capacity and production of IL-9 and IL-10. T reg -derived IL-9 plays a significant role in recruiting other suppressive immune cells, such as mast cells, to suppress bystander tissue damage as observed in a murine nephrotoxic serum nephritis model (73) . T reg -derived IL-10 is required to regulate effector T cells during acute inflammation (74, 75) . A recent study was published demonstrating a survival benefit upon VISTA antibody blockade prior to CLP (76) . Importantly, in the Tao et al. study they utilized WT mice. However, it has also been shown that VISTA-gene-deficient mice have a predisposition to proinflammatory immune activation in several disease contexts (17, 20, 26, 66) . Based on prior studies and our results, we believe that the VISTA-gene-deficient mice develop a predisposition to proinflammatory tissue injury that is exacerbated by CLP, thus resulting in a survival deficit. Consequently, acute VISTA blockade with an exogenous antibody in a developmentally normal WT mouse, as used in the Tao et al. study, might yield different results than observed in VISTA -/mice in our study.

In conclusion, we found that WT mice have increased VISTA + CD4 + T regs and increased total CD4 + T regs in the spleen and small intestine post CLP. This increase in total CD4 + T reg abundance is lost in VISTA -/mice; however, VISTA -/-CD4 + T regs have a higher expression of Foxp3, CTLA4, and CD25 relative to WT mice. VISTA -/mice also have an altered cytokine profile including higher IL-6, IL-10, TNF-a, IL-17F, IL-23, and MCP-1 relative to WT mice. VISTA -/mice have higher indices of acute liver injury (i.e., bilirubin, ALT, and AST) and reduced survival post CLP compared to WT mice. Interestingly, we were able to rescue VISTA -/survival to WT levels by adoptively transferring VISTA-expressing Jurkat T regs into VISTA -/mice prior to CLP. In addition, treating Jurkat T regs with a VISTA-neutralizing antibody in vitro, reduced viability and cytokine production. We can conclude from these experiments that VISTA expression plays a pivotal role in promoting acute CD4 + T reg survival/stability and regulating the cytokine milieu in acute sepsis to confer a survival benefit.

This study has raised questions as to the mechanism by which VISTA promotes T reg survival. Interestingly, Foxp3 and VISTA are both under the transcriptional regulation of p53 and HIF-1a.

In fact, p53-Foxp3 and HIF1a-Foxp3 induction are indispensable for protective T r e g suppression under inflammatory conditions (24, (77) (78) (79) . The tentative relationship between VISTA and Foxp3 expression provide an additional line of query regarding T reg plasticity. Another area for further investigation concerns the effector immune cells that are non-redundantly regulated by VISTA + T regs . Based on results from this study, VISTA may act as a nonredundant marker for the T reg subset responsible for regulating M1/M2 polarization and limiting acute liver injury in sepsis. More work must be done to fully elucidate these mechanisms; however, we think this study contributes a novel perspective on checkpoint regulator, VISTA, in the acute sepsis response.

The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author. 

The studies involving human participants were reviewed and approved by institutional review board approval at Rhode Island Hospital (IRB study # 413013). The patients/participants provided their written informed consent to participate in this study. All protocols were performed in accordance with the National Institutes of Health guidelines and as approved by the Animal Use Committee of Rhode Island Hospital (AWC# 5064-18 and 5054-21).

CG provided substantial contribution to the conception of this project, experiment design, data acquisition, and data analysis. CG also wrote the initial draft of the manuscript and participated in the revision steps of the manuscript. BB-G provided initial contribution to the conception of this project. MW enrolled patients and healthy controls, collected samples, and acquired human data. C-SC aided in small intestine sample isolation for flow cytometry studies. YC performed the initial survival study of VISTA -/and WT mice and performed routine genotyping and husbandry of VISTA -/mice. YQ-R performed initial ELISAs that supported multiplex experiments and results. JT generated preliminary data that contributed to the initial conception of this project. AA provided guidance throughout the conception and execution of this project.

Estimating Ten-Year Trends in Septic Shock Incidence and Mortality in United States Academic Medical Centers Using Clinical Data

Global, Regional, and National Sepsis Incidence and Mortality, 1990-2017: Analysis for the Global Burden of Disease Study

Clinical Course and Risk Factors for Mortality of Adult Inpatients With COVID-19 in Wuhan, China: A Retrospective Cohort Study

Incidence and Trends of Sepsis in US Hospitals Using Clinical vs Claims Data

Sepsis-Induced Immunosuppression: From Cellular Dysfunctions to Immunotherapy

A Genomic Storm in Critically Injured Humans

Immunosuppression in Patients Who Die of Sepsis and Multiple Organ Failure

Lessons Learned From the Blockade of Immune Checkpoints in Cancer Immunotherapy

Improved Survival After Induction of Sepsis by Cecal Slurry

Mechanisms of Indirect Acute Lung Injury: A Novel Role for the Coinhibitory Receptor, Programmed Death-1

Identification of B7-H1 as a Novel Mediator of the Innate Immune/ Proinflammatory Response as Well as a Possible Myeloid Cell Prognostic Biomarker in Sepsis

Herpes Virus Entry Mediator (HVEM): A Novel Potential Mediator of Trauma-Induced Immunosuppression

Blockade of Endothelial, But Not Epithelial, Cell Expression of PD-L1 Following Severe Shock Attenuates the Development of Indirect Acute Lung Injury in Mice

Kupffer Cells Potentiate Liver Sinusoidal Endothelial Cell Injury in Sepsis by Ligating Programmed Cell Death Ligand-1

A Novel Role for Programmed Cell Death Receptor Ligand-1 (PD-L1) in Sepsis-Induced Intestinal Dysfunction

Immunosuppression in Sepsis: A Novel Understanding of the Disorder and a New Therapeutic Approach

Coinhibitory Receptor PD-1H Preferentially Suppresses CD4(+) T Cell-Mediated Immunity

A New VISTA on Combination Therapy for Negative Checkpoint Regulator Blockade

Differential Contribution of Three Immune Checkpoint (VISTA, CTLA-4, PD-1) Pathways to Antitumor Responses Against Squamous Cell Carcinoma

VISTA, a Novel Mouse Ig Superfamily Ligand That Negatively Regulates T Cell Responses

Structure and Functional Binding Epitope of V-Domain Ig Suppressor of T Cell Activation

VISTA Is an Acidic pH-Selective Ligand for PSGL-1

VSIG-3 as a Ligand of VISTA Inhibits Human T-Cell Function

VISTA Is a Checkpoint Regulator for Naive T Cell Quiescence and Peripheral Tolerance

Programmed Death One Homolog Maintains the Pool Size of Regulatory T Cells by Promoting Their Differentiation and Stability

Immune-Checkpoint Proteins VISTA and PD-1 Nonredundantly Regulate Murine T-Cell Responses

VISTA Is an Immune Checkpoint Molecule for Human T Cells

A Prospective Analysis of Lymphocyte Phenotype and Function Over the Course of Acute Sepsis

Sepsis-Induced Human Lymphocyte Apoptosis and Cytokine Production in "Humanized" Mice

Differential Alterations of Tissue T-Cell Subsets After Sepsis

Active Players in Resolution of Shock/Sepsis Induced Indirect Lung Injury: Immunomodulatory Effects of Tregs and PD-1

Adoptive Transfer of In Vitro-Stimulated CD4+CD25+ Regulatory T Cells Increases Bacterial Clearance and Improves Survival in Polymicrobial Sepsis

Foxp3+ Regulatory T Cells Are Required for Recovery From Severe Sepsis

Endotoxin Tolerance Modulates TREG and TH17 Lymphocytes Protecting Septic Mice

Immunodesign of Experimental Sepsis by Cecal Ligation and Puncture

Male Sex Steroids are Responsible for Depressing Macrophage Immune Function After Trauma-Hemorrhage

Females in Proestrus State Maintain Splenic Immune Functions and Tolerate Sepsis Better Than Males

Overexpression of Bcl-2 in Transgenic Mice Decreases Apoptosis and Improves Survival in Sepsis

Prevention of Lymphocyte Cell Death in Sepsis Improves Survival in Mice

PD-1 Expression by Macrophages Plays a Pathologic Role in Altering Microbial Clearance and the Innate Inflammatory Response to Sepsis

Sepsis-Induced Apoptosis Causes Progressive Profound Depletion of B and CD4+ T Lymphocytes in Humans

Early Circulating Lymphocyte Apoptosis in Human Septic Shock Is Associated With Poor Outcome

Failure to Normalize Lymphopenia Following Trauma Is Associated With Increased Mortality, Independent of the Leukocytosis Pattern

Early Interleukin-6 and Slope of Monocyte Human Leukocyte Antigen-DR: A Powerful Association to Predict the Development of Sepsis After Major Trauma

SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference

Marked Elevation of Human Circulating CD4+CD25+ Regulatory T Cells in Sepsis-Induced Immunoparalysis

Increased Proportion of CD4(+)CD25 (+)Foxp3(+) Regulatory T Cells During Early-Stage Sepsis in ICU Patients

VISTA Regulates the Development of Protective Antitumor Immunity

Characterization of Programmed Death-1 Homologue-1 (PD-1H) Expression and Function in Normal and HIV Infected Individuals

Immunoregulatory Functions of VISTA

PD-1h (VISTA)-Mediated Suppression of Autoimmunity in Systemic and Cutaneous Lupus Erythematosus

VISTA Is a Novel Broad-Spectrum Negative Checkpoint Regulator for Cancer Immunotherapy

How Do Regulatory T Cells Work?

Circulating Regulatory T Cells (CD4(+)CD25 (+)

Contribute to Lymphocyte Anergy in Septic Shock Patients

The Role of Regulatory T Cells in the Pathogenesis of Sepsis and Its Clinical Implication

Foxp3 Programs the Development and Function of CD4+CD25+ Regulatory T Cells

Regulatory T Cell Lineage Specification by the Forkhead Transcription Factor Foxp3

Identification of IL-17-Producing FOXP3+ Regulatory T Cells in Humans

IL-17-Producing Human Peripheral Regulatory T Cells Retain Suppressive Function

CTLA4 Expression Is an Indicator and Regulator of Steady-State CD4+ FoxP3+ T Cell Homeostasis

Foxp3-Dependent Programme of Regulatory T-Cell Differentiation

Control of Regulatory T Cell Lineage Commitment and Maintenance

Cutting Edge: Depletion of Foxp3+ Cells Leads to Induction of Autoimmunity by Specific Ablation of Regulatory T Cells in Genetically Targeted Mice

Disruption of the Immune-Checkpoint VISTA Gene Imparts a Proinflammatory Phenotype With Predisposition to the Development of Autoimmunity

Minimum Quality Threshold in Pre-Clinical Sepsis Studies (MQTiPSS): An International Expert Consensus Initiative for Improvement of Animal Modeling in Sepsis

Past, Present, and Future of Regulatory T Cell Therapy in Transplantation and Autoimmunity

CD4+CD25+Foxp3+ Regulatory T Cells Induce Alternative Activation of Human Monocytes/Macrophages

Cavaillon JM, Adib-Conquy M. Monocytes/macrophages and Sepsis

The Role of Monocytes and Macrophages in Acute and Acute-On-Chronic Liver Failure

IL-9 Production by Regulatory T Cells Recruits Mast Cells That Are Essential for Regulatory T Cell-Induced Immune Suppression

Characterization of Foxp3+CD4+CD25+ and IL-10-Secreting CD4+CD25+ T Cells During Cure of Colitis

Regulatory T Cell-Derived Interleukin-10 Limits Inflammation at Environmental Interfaces

High-Affinity Anti-VISTA Antibody Protects Against Sepsis by Inhibition of T Lymphocyte Apoptosis and Suppression of the Inflammatory Response

Foxp3 Is a Key Downstream Regulator of P53-Mediated Cellular Senescence

/T(reg) Balance by Hypoxia-Inducible Factor

Hypoxia-Inducible Factor-1 Alpha-Dependent Induction of FoxP3 Drives Regulatory T-Cell Abundance and Function During Inflammatory Hypoxia of the Mucosa

All authors reviewed this manuscript. All authors contributed to the article and approved the submitted version. 

The VISTA -/mouse model was created at the Brown University Mouse Transgenic and Gene Targeting Facility that is supported by a grant from the National Institute of General Medical Sciences (P30 GM103410) from the National Institutes of Health.

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2022.861670/ full#supplementary-material Conflict of Interest: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.