key: cord-0884408-8llmriik
authors: Greaney, Allison J.; Starr, Tyler N.; Eguia, Rachel T.; Loes, Andrea N.; Khan, Khadija; Karim, Farina; Cele, Sandile; Bowen, John E.; Logue, Jennifer K.; Corti, Davide; Veesler, David; Chu, Helen Y.; Sigal, Alex; Bloom, Jesse D.
title: A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy
date: 2022-02-08
journal: PLoS Pathog
DOI: 10.1371/journal.ppat.1010248
sha: faa798112f6e42562e0a9854b15b2ac2373191d7
doc_id: 884408
cord_uid: 8llmriik

Many SARS-CoV-2 variants have mutations at key sites targeted by antibodies. However, it is unknown if antibodies elicited by infection with these variants target the same or different regions of the viral spike as antibodies elicited by earlier viral isolates. Here we compare the specificities of polyclonal antibodies produced by humans infected with early 2020 isolates versus the B.1.351 variant of concern (also known as Beta or 20H/501Y.V2), which contains mutations in multiple key spike epitopes. The serum neutralizing activity of antibodies elicited by infection with both early 2020 viruses and B.1.351 is heavily focused on the spike receptor-binding domain (RBD). However, within the RBD, B.1.351-elicited antibodies are more focused on the “class 3” epitope spanning sites 443 to 452, and neutralization by these antibodies is notably less affected by mutations at residue 484. Our results show that SARS-CoV-2 variants can elicit polyclonal antibodies with different immunodominance hierarchies.

a1111111111 a1111111111 a1111111111 a1111111111 a1111111111

Over the past year, SARS-CoV-2 viral variants have emerged with mutations that alter the antigenicity of spike and erode neutralization of the virus by infection-and vaccine-elicited polyclonal antibodies [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] . While it is well established that many SARS-CoV-2 variants are less susceptible to antibody immunity generated by early 2020 infections, it is unknown if the antibodies elicited by infection with these variants have different specificities and epitope immunodominance hierarchies. For influenza virus, it has been demonstrated that immunodominance of different epitopes changes over time as the virus evolves antigenically [14] [15] [16] . If a similar phenomenon occurs for SARS-CoV-2, then the sites of important antigenic mutations will change over time.

Here we address this question by combining serology and deep mutational scanning to compare the specificity of the polyclonal antibody response elicited by infection with early 2020 viruses versus the B.1.351 variant (also referred to as Beta or 20H/501Y.V2). The B.1.351 variant was first detected in Nelson Mandela Bay, South Africa and likely emerged in August 2020 after the country's first epidemic wave [17] . B.1.351 was the dominant lineage in South Africa by the end of 2020, although it has subsequently been displaced by the B.1.617.2 (Delta) lineage [18] . B.1.351 has mutations throughout the spike protein, including at key epitopes in both the RBD and NTD [1, 2, 6, 9] . The B.1.351 variant has among the largest reductions in neutralization by convalescent plasmas of any SARS-CoV-2 variant to date [7, 8, [19] [20] [21] . Additionally, prior work has demonstrated that B.1.351 convalescent plasmas can neutralize early 2020 viruses better than early 2020 plasmas can neutralize B.1.351 viruses [1, 22] , suggesting that there may be a shift in the specificity of the antibody response. Our results described below expand this understanding by showing that while neutralization by B.1.351-elicited plasma antibodies is still heavily focused on the RBD, their site-specificity within the RBD is somewhat shifted compared to antibodies elicited by early 2020 viruses. Specifically, within the RBD, B.1.351-elicited sera is relatively more targeted to the class 3 epitope (in the classification scheme of [23] ) and relatively less targeted to the class 1 and 2 epitopes.

The B.1.351 SARS-CoV-2 variant lineage has mutations in multiple spike epitopes antibodies [8, 23] , although it enhances the RBD's affinity for its receptor, angiotensin converting enzyme 2 (ACE2) [11, 25, 26] .

We obtained plasma samples collected approximately 30 days post-symptom onset (mean 33, range 27-40 days) from 9 individuals infected with SARS-CoV-2 during the "second wave" of COVID-19 in South Africa from late December 2020 through late January 2021 ( Table 1) . During this timeframe, B.1.351 virus accounted for >90% of sequenced infections in the area [1, 17, 18] . None of the individuals had evidence of prior SARS-CoV-2 infection, so we presume these individuals experienced a primary B.1.351 infection.

To enable comparison of B.1.351-elicited antibodies to those elicited by infection with an early 2020 virus, we reexamined a set of convalescent plasma samples collected approximately 30 days post-symptom onset (mean 32, range 15-61 days) from 17 individuals with symptom onset on or prior to March 15, 2020 in Washington State, USA (Table 1 ) [27, 28] . At that time, most sequenced viral isolates in Washington State had spike sequences identical to Wuhan-Hu-1, although D614G viruses were also present at a low level [29, 30] . No other spike mutations were present at appreciable frequencies at that time. [17] . L18F is only present in some B.1.351 isolates. Visualization generated by https://covdb.stanford.edu/sierra/sars2/by-patterns/. (C) Sites where mutations occur in the spike ectodomain are highlighted in blue on the Wuhan-Hu-1 one-RBD open spike trimer (left, PDB 6ZGG) [75] or RBD (right) (PDB 6M0J) [76] . The surface of one spike monomer is shown; the other two protomers are transparent.

https://doi.org/10.1371/journal.ppat.1010248.g001

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy Infection with B.1.351 elicits a neutralizing antibody response at least as RBD-focused as early 2020 viruses Early 2020 viruses induce a neutralizing antibody response that largely targets the RBD [28, 31, 32] , although some neutralizing antibodies also bind the NTD [9, [33] [34] [35] . Because B.1.351 has mutations in both the RBD and NTD, it is important to determine if the specificity of the neutralizing antibody response elicited by this virus is similarly RBD-focused.

We depleted plasmas from B.1.351-infected individuals of B.1.351 RBD-binding antibodies, or performed a mock depletion, and measured neutralization of B.1.351 spike-pseudotyped lentiviral particles (Figs 2A and S1 and S1 Data). The median neutralization titer (NT50) of these plasmas against the B.1.351-spike-pseudotyped lentiviral particles for the mock depletion was 2,459 (range 259-5,081). For 7 out of 9 samples, greater than 90% of neutralizing activity was ablated by removal of RBD-binding antibodies (Fig 2A) .

We compared these B.1.351 results to previous measurements of the RBD-focused neutralizing activity of plasmas from individuals infected with early 2020 viruses. These prior measurements were made using Wuhan-Hu-1 RBD depletions and D614G spike-pseudotyped lentiviral particles [28] . The neutralizing activity of the B.1.351 plasmas was at least as RBDfocused as the early 2020 virus plasmas, with most neutralizing activity of most plasmas from both cohorts attributable to RBD-binding antibodies (Fig 2B and 2C ). There was a slight trend for the neutralizing activity of the B.1.351 plasmas to be more RBD-focused than the early 2020 plasmas, but the difference was not statistically significant (Fig 2C) . One caveat is that all neutralization assays were performed in 293T cells overexpressing ACE2, which tend to emphasize the effect of RBD-binding, ACE2-competitive antibodies more than assays performed on cells with lower levels of ACE2 expression [7, 35, 36] .

To determine how mutations within the RBD affect plasma antibody binding, we used a previously described deep mutational scanning approach. Briefly, this approach involves generating comprehensive mutant libraries of the RBD, displaying the mutant RBDs on the surface of yeast, and using fluorescence-activated cell sorting (FACS) and deep sequencing to quantify how mutations impact antibody binding [28, 37] .

Previously, we have performed such deep mutational scanning using the RBD from the Wuhan-Hu-1 isolate to map mutations that affect binding by polyclonal antibodies elicited by infection or vaccination that involves a RBD identical to that in Wuhan-Hu-1 [24, 28, 38] . However, for the current work we wanted to determine the specificity of antibodies elicited by B.1.351 infection to the B.1.351 RBD. Therefore, we generated new duplicate libraries containing 99.7% (3,807 of 3,819) of the possible single amino-acid mutations in the B.1.351 RBD. We displayed these libraries on the surface of yeast, and measured the effects of mutations on RBD expression and binding to ACE2 (S2 Fig and S2 Data [25] ). We used computational filters based on these measurements as well as a pre-sort of the library for RBDs that bind ACE2 with at least 1% the avidity of the unmutated B.1.351 RBD to filter spurious antibody-escape mutations that were highly deleterious or led to gross unfolding of the RBD. 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy identified as antibody-escape variants. We deep sequenced the pre-and post-enrichment populations to quantify each mutation's "escape fraction". These escape fractions range from 0 (no cells with the mutation in the escape bin) to 1 (all cells with the mutation in the plasma-escape bin) (S3 Data). The escape fractions measured for independent biological replicate libraries were well-correlated (S3D Fig), and in the sections below we report the average across the two replicate libraries. We represent the escape maps as logo plots, where the height of each letter is proportional to its escape fraction (Figs 3 and S3A) .

We examined the sites and epitopes to which mutations had the greatest effect on antibody binding. We use the Barnes, et al. [23] antibody epitope classification scheme, in which there are antibody classes 1 through 4 (Fig 3A) . The class 1, 2, and 3 antibodies are often potently neutralizing, while the class 4 antibodies are usually less potently neutralizing in vitro [31] [32] [33] 39, 40] . Relative to Wuhan-Hu-1, B.1.351 contains mutations in or proximal to the class 1, 2, and 3 epitopes (K417N, E484K, and N501Y, respectively) (Fig 3A) , although the N501Y mutation has little effect on polyclonal convalescent antibody binding or neutralization for Wuhan-Hu-1-like viruses [7, 8, 41] . For the B.1.351 plasmas, in 4 of 9 cases, mutations to site 484 within the class 2 epitope had the largest effects on antibody binding and the K484E reversion mutation had little effect ( Fig  3B and S3 Data) . In 3 of 9 cases, mutations to the class 3 epitope (sites 443-450, 498-501, shown in cyan) and the class 2 site 484 had comparably large effects on antibody binding. In two cases, no mutation had a particularly large effect on binding. Mutations to the class 1 and 4 antibody epitopes did not have large effects on plasma binding.

There are clear differences in the RBD epitope targeting of the B.1.351 plasmas versus previously characterized plasmas from a cohort of individuals (n = 11) infected with early 2020 viruses in Washington State, USA [28] . These 11 samples are a subset of the 17 whose RBDtargeting neutralizing activity is described above, chosen to cover a range of serum binding and neutralizing potencies and degrees of RBD-directed neutralization potencies (Fig 2B and  2C ) [28] . Specifically, binding of the early 2020 plasmas were most affected by mutations to the class 1 and 2 epitopes, with mutations to sites 456, 486, and 484 having some of the largest effects on binding to the RBD (Figs 4 and S4 and S4 Data), although mutation to site 456 have little effect on neutralization in vitro reflecting the common hyperfocusing of neutralizing antibody responses [28, 38] . While the B.1.351 plasmas were also strongly affected by mutations to the class 2 epitope and site 484, mutations to the class 1 epitope had little effect. Moreover, while both groups of plasmas are affected by class 3 epitope mutations, the relative importance of class 3 mutations is greater for the B.1.351 plasmas (Fig 4A and 4B ).

There is also heterogeneity among the antibody-escape maps within each of the two cohorts as well as similarities between cohorts. For instance, the antibody-escape map for participant C of the early 2020 cohort qualitatively resembles that of the "484-focused" B.1.351 cohort samples, and the maps for participants G and H qualitatively resemble the "484 and class 3-focused" group. Thus, the trends observed here must be interpreted with the caveat that the two cohort sizes are relatively small. To test if the differences in plasma antibody binding specificity described above lead to different effects of mutations on neutralization, we performed neutralization assays on key mutants

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy using spike-pseudotyped lentiviral particles. For these experiments, we chose the eight B.1.351 samples with the highest neutralizing potency (there was not enough residual sample volume to perform neutralization assays with the lowest-potency sample). We also chose four early 2020 samples with substantial RBD-focused neutralizing activity and with antibody-binding escape maps representative of the early 2020 cohort as a whole (S4 Fig). In all assays, we tested neutralization by B.1.351 and early 2020 plasmas against point mutants in the homologous B.1.351 or D614G spikes. Mutations to site 484 had strikingly different effects on neutralization by B.1.351 versus early 2020 plasmas. For the early 2020 plasmas, both E484K/Q mutations, as well as the K417N-E484K-N501Y triple mutation, reduced neutralization by >10-fold, which is comparable to the reduction caused by removing all RBD-binding antibodies from the plasmas (Fig 5) . Therefore, the neutralizing activity of early 2020 plasmas is often highly focused on site 484, as has been described previously [2, 7, 8, 28, 38, [41] [42] [43] [44] . In contrast, mutations to site 484 had much smaller effects on neutralization by B.1.351 plasmas. The K484E reversion had little effect on neutralization by B.1.351 plasmas, which was striking given the large effect of E484K on early 2020 plasma neutralization. While the K484Q mutation had the largest effect on B.1.351 plasmas of any of the single mutations we tested (geometric mean of 3.0-fold change), the effect was smaller than that for the early 2020 plasmas (geometric mean of 18.3-fold change). is shown as a gray ribbon diagram. (B) Escape maps for B.1.351 convalescent plasmas. The line plots at left indicate the sum of effects of all mutations at each RBD site on plasma antibody binding, with larger values indicating more escape. The logo plots at right show key sites (highlighted in purple on the line plot x-axes). The height of each letter is that mutation's escape fraction; larger letters indicate a greater reduction in binding. For each sample, the y-axis is scaled independently. RBD sites are colored by epitope as in (A). Sites 417, 484, and 501 are labeled with red text on the x-axis. All escape scores are in S3 Data and at https://github.com/jbloomlab/SARS-CoV-2-RBD_B. 1 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy The class 3 epitope was a slightly more important target of neutralization for the B.1.351 plasmas than for early 2020 plasmas, consistent with the deep mutational scanning escape maps. The G446V mutation to the class 3 epitope had a slightly larger, but still modest, effect on neutralization for the B.1.351 plasmas than for most of the early 2020 plasmas (Figs 5 and S5). No tested mutation, nor the 417-484-501 triple mutant, reduced neutralization by the B.1.351 plasmas as much as removing all RBD-binding antibodies (Fig 5) , a result in stark contrast to that observed for the early 2020 plasmas.

We found that a SARS-CoV-2 variant induces antibody responses with different immunodominance hierarchies than early SARS-CoV-2 viral isolates. Changes in immunodominance hierarchies over time and asymmetric antigenic drift have also been observed for influenza virus [14] [15] [16] 45] . Such changes can have important consequences, as they can contribute to individuals with different exposure histories having different susceptibilities to viral mutants [46, 47] . Although the changes in immunodominance we have observed here are relatively modest, they could become larger as the virus continues to evolve and different individuals accumulate increasingly disparate exposure histories through infection and vaccination [48, 49] .

We suggest several speculative hypotheses about several reasons why B.1.351 might elicit different hierarchies of antibodies. Although the B.1.351 spike protein has multiple mutations in key antigenic sites in the RBD and NTD [1, 2] , the neutralizing antibody response elicited by B.1.351 infection is at least as RBD-focused as for early 2020 infections, suggesting that none of the RBD mutations have reduced the antigenicity of that spike subdomain. But within the RBD, site 484 may be less immunodominant for B.1.351-elicited plasmas. Specifically, the E484K and E484Q mutations, which have large effects on early 2020 plasmas, have more moderate effects on 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy neutralization by B.1.351-elicited plasmas. Infection with early 2020 viruses frequently leads to the development of neutralizing class 2 antibodies that target an epitope containing site 484 [24, 42, 50, 51] , and are derived from common antibody germline genes (e.g., IGHV3-53/66, IGHV3-30, IGHV1-2 [23, 52, 53] . We speculate that viruses containing K484 rather than E484 (such as B.1.351) might less readily elicit such neutralizing antibodies [54] , or might elicit antibodies that draw less of their binding energy from site 484. Furthermore, if the class 2 epitope (containing site 484) is less immunogenic in B.1.351, that could lead to relatively stronger targeting of the class 3 epitope for B.1.351-elicited sera. Note that such phenomena could be human-specific, since the class 2 epitope containing site 484 is not as immunodominant in other species with different germline antibody genes (i.e., rhesus macaques) [55] .

Changing immunodominance hierarchies could explain previous reports that polyclonal antibodies elicited by infection with different SARS-CoV-2 variants can have differing neutralizing breadths and specificities [4, [56] [57] [58] . For instance, prior studies of individuals infected with B.1.351 demonstrated that the convalescent plasmas from B.1.351-infected individuals neutralized early 2020 viruses better than early 2020 convalescent plasmas neutralized B.1.351 viruses [1, 22] . Our results help mechanistically explain this finding by showing that one of the key epitopes that differs between early 2020 viruses and B.1.351 (the class 2 epitope centered on site 484) is more immunodominant for early 2020 infections. Such changes in immunodominance hierarchies could also explain recent results suggesting that polyclonal antibodies elicited by B.1.351 infection are less effective at neutralizing the Delta (B.1.617.2) variant than antibodies elicited by early 2020 viruses [4, 59] .

Our study has several limitations. The cohorts of individuals infected with early 2020 and B.1.351 viruses are small, and are geographically and temporally distinct. Specifically, the early 2020 samples were collected in early 2020 in Washington State, USA, and the B.1.351 samples were collected in December 2020-January 2021 in South Africa. Nevertheless, the two cohorts are relatively well-matched with respect to age, sex, and days-post symptom onset of sample collection ( Table 1 ) and assays were performed under comparable conditions. But host factors, including antibody germline gene alleles, immune history, and prior exposures to endemic coronaviruses may contribute to the differences observed in the specificity of the SAR-CoV-2 antibody response. Our deep mutational scanning measured binding to yeast-displayed RBD, which may not capture all relevant features of full-length spike in the context of virus. Finally, our neutralization assays used pseudotyped lentiviral particles and ACE2-overexpressing cells, and some recent works suggest that the relative importance of different spike epitopes for neutralization can depend on the viral system and target cell line used [7, 35, 36, 60] .

Although the B.1.351 variant has now been displaced, our results illustrate the need to understand immunity elicited by different SARS-CoV-2 variants. As population immunity due to infection or vaccination increases, preexisting immunity is becoming an increasingly important driver of SARS-CoV-2 evolution [61] , as has shown to be the case for seasonal coronaviruses [62, 63] . Moreover, as individuals begin to accumulate more complex SARS-CoV-2 immune histories due to multiple infections and/or vaccinations, the effects of immune imprinting or original antigenic sin [64, 65] may start to interact with the variant-specific immunodominance hierarchies we have described to create increasingly diverse antibody specificities in the human population.

Samples were collected from participants enrolled in a prospective cohort study approved by the Biomedical Research Ethics Committee (BREC) at the University of KwaZulu-Natal

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy (reference BREC/00001275/2020) or a prospective longitudinal cohort study in Seattle, WA, approved by the University of Washington Institutional Review Board (protocol #STUDY00000959). Written informed consent was obtained from each participant.

The SARS-CoV-2 RBD mutant libraries and unmutated parental plasmid are available upon request with completion of an MTA. The plasmid encoding the SARS-CoV-2 spike gene used to generate pseudotyped lentiviral particles, HDM_Spikedelta21_D614G, is available from Addgene (#158762) and BEI Resources (NR-53765). The HDM_Spikedelta21_B.1.351 plasmid is available upon request. Further information and requests for reagents and resources should be directed to and will be fulfilled by Jesse Bloom (jbloom@fredhutch.org) upon completion of a materials transfer agreement.

Samples were collected from participants enrolled in a prospective cohort study approved by the Biomedical Research Ethics Committee (BREC) at the University of KwaZulu-Natal (reference BREC/00001275/2020). Written informed consent was obtained from each participant. The mean age was 54 years (median 53; range 26-78 years). Four were males and 5 were females. All participants had symptomatic SARS-CoV-2 infection and a positive SARS-CoV-2 qPCR from a swab of the upper respiratory tract, and all participants required hospitalization. Early-2020 convalescent plasma samples were previously described [27, 28] and collected as part of the prospective longitudinal Hospitalized or Ambulatory Adults with Respiratory Viral Infections (HAARVI) cohort study of individuals with SARS-CoV-2 infection in Seattle, WA, between February and July 2020. Written informed consent was obtained from each participant. The plasma samples from 17 individuals were examined here (8 of 17 females; age range 23 to 76 years, mean 51.6 years, median 56 years). These samples were collected approximately 30 days post-symptom onset (mean 31.6 days, median 29 days, min 15 days, max 61 days). Five cases were hospitalized, 2 were asymptomatic, and the remainder were symptomatic nonhospitalized. The neutralization activity of plasma samples before and after depletion of RBDbinding antibodies in Fig 2 and RBD binding-escape maps in S4 Fig were previously reported [28] , but neutralization assays for all 30-days post-symptom onset plasmas in Figs 5 and S5 were newly performed in this study. The neutralization assays on the 100-day early 2020 samples in S5 Fig were previously reported [38] . This work was approved by the University of Washington Institutional Review Board (protocol #STUDY00000959).

Plasma was separated from EDTA-anticoagulated blood by centrifugation at 500 rcf for 10 min and stored at −80˚C. Aliquots of plasma samples were heat-inactivated at 56˚C for 30 min

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy and clarified by centrifugation at 10,000 rcf for 5 min, after which the clear middle layer was used for experiments. Inactivated plasma was stored in single-use aliquots to prevent freezethaw cycles. CTCCGCCTCCTTCTCCACATTCAAGTGTTACGGTGTATCTCCCACCAAGTTGAATG  ATCTATGCTTTACAAACGTTTACGCCGATAGTTTCGTAATTAGAGGCGATGAAG  TGCGTCAGATCGCACCAGGCCAGACGGGCAACATAGCAGACTATAATTATA  AGCTGCCTGATGACTTCACCGGCTGTGTGATAGCTTGGAACTCAAATAATCTAGA  TTCCAAGGTGGGAGGCAATTACAATTATTTGTACCGTCTGTTCCGTAAAAGCAA  TTTGAAACCATTTGAAAGAGACATTAGCACTGAAATTTATCAAGCAGGGTCCAC  CCCGTGCAACGGCGTAAAGGGCTTTAACTGTTATTTCCCATTACAGTCTTATG  GTTTCCAACCTACGTACGGAGTCGGGTATCAGCCGTACAGGGTTGTGGTTCTTTC  ATTTGAACTGCTGCACGCGCCCGCAACCGTATGCGGGCCGAAGAAATCAACGctcga  ggggggcggttccgaacaaaagcttatttctgaagaggacttgtaatagagatctgataacaacagtgtagatgtaacaaaatcgactt  tgttcccactgtacttttagctcgtacaaaatacaatatacttttcatttctccgtaaacaacatgttttcccatgtaatatccttttctatt  tttcgttccgttaccaactttacacatactttatatagctattcacttctatacactaaaaaactaagacaattttaattttgctgcctgccatat  ttcaatttgttataaattcctataatttatcctattagtagctaaaaaaagatgaatgtgaatcgaatcctaagagaatt This sequence has 5' and 3' flanking sequences that are unmutated in the variant libraries (lower case). The uppercase portion is the RBD coding sequence, amino acids N331-T531 (Wuhan-Hu-1 spike numbering). The libraries were designed to contain all 19 amino acids at each site in the RBD, without stop codons, with no more than one amino-acid mutation per variant. The variant gene fragments were PCR-amplified with these primers: 5'-tctgcaggctagtggtggag-3' and 5'-agatcggaagagcgtcgtgtagggaaagagtgtagatctcggtggtcgccgtatcattaattctcttaggattcgattcacattc-3'. (primer-binding regions underlined in the sequence above). A second round of PCR was performed using the same forward primer (5'-tctgcaggctagtggtggag-3') and the reverse primer 5'-ccagtgaattgtaatacgactcactatagggcgaattggagctcgcggccgcnnnnnnnnnnnnnnnnagatcggaagagcgtcgtgtag-3' to append the Nx16 barcodes and add the overlapping sequences to clone into the recipient vector backbone as described in [25, 66] .

Failed positions in the Twist-delivered library (sites 362, 501, and 524 in Wuhan-Hu-1 numbering) were mutagenized in-house using a PCR-based method with NNS degenerate primers and cloned into the unmutated wildtype backbone plasmid using NEB HiFi assembly, exactly as described in [66] . These were then PCR-amplified using the same 5'-tctgcaggctagt ggtggag-3' and 5'-ccagtgaattgtaatacgactcactatagggcgaattggagctcgcggccgcnnnnnnnnnnnnn nnnagatcggaagagcgtcgtgtag-3' primers to pool with the barcoded Twist library gene fragments.

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy

The barcoded variant gene fragments were cloned in bulk into the NotI/SacI-digested unmutated wildtype plasmid, as described in [25, 66] . The Genbank plasmid map for the fully assembled, barcoded B.1.351 RBD libraries (with the unmutated B.1.351 RBD sequence) is available at https://github.com/jbloomlab/SARS-CoV-2-RBD_B.1.351/blob/main/data/ plasmid_maps/pETcon-SARS-CoV-2-RBD-B1351_lib-assembled.gb. The pooled, barcoded mutant libraries were electroporated into E. coli (NEB 10-beta electrocompetent cells, New England BioLabs C3020K) and plated at a target bottleneck of 50,000 variants per duplicate library, corresponding to >10 barcodes per mutant within each library. Colonies from bottlenecked transformation plates were scraped and plasmid purified. Plasmid libraries (10 μg plasmid per replicate library) were transformed into the AWY101 yeast strain [67] according to the protocol of Gietz and Schiestl [68] .

As described by Starr et al. [25] , PacBio sequencing was used to generate long sequence reads spanning the Nx16 barcode and RBD coding sequence. PacBio sequencing amplicons were prepared from library plasmid pools via NotI digestion, gel purification, and Ampure XP bead clean-up. Sample-specific barcodes and SMRTbells were ligated using the HiFi Express v2 kit. The libraries were designed to contain only wildtype and 1-amino acid mutations, but some multiple mutations and stop codons were stochastically introduced during the library generation process. These mutations were excluded from downstream analysis of the effects of mutations on ACE2 binding, RBD expression, and plasma antibody binding, except when used in quality control checks (i.e., that most variants containing premature stop codons should not be expressed on the yeast cell surface and thus should have very low expression scores).

The effects of each mutation on RBD expression on the surface of yeast and on ACE2 binding were measured essentially as described previously for the Wuhan-Hu-1 RBD [25] . Specifically, each biological replicate library was grown overnight at 30˚C in 45mL SD-CAA media (6.7g/L Yeast Nitrogen Base, 5.0g/L Casamino acids, 1.065 g/L MES acid, and 2% w/v dextrose) at an initial OD600 of 0.4. To induce RBD surface expression, yeast were back-diluted in SG-CAA +0.1%D (2% w/v galactose supplemented with 0.1% dextrose) induction media at 0.67 OD600 and incubated at room temperature for 16-18 hours with mild agitation. For RBD expression experiments, 45 OD units of yeast were labeled in 1:100 diluted chicken-anti-Myc-FITC antibody (Immunology Consultants CMYC45F) to detect the RBD's C-terminal Myc tag. For ACE2-binding experiments, 12 OD units of yeast were incubated overnight at room

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy temperature with monomeric biotinylated ACE2 (ACROBiosystems AC2-H82E8) across a concentration range of 10 −13 M to 10 −6 M at 1-log intervals. Labeling volumes were increased at low ACE2 concentration to limit ligand depletion effects. Cells were then labeled with 1:100 diluted Myc-FITC to detect RBD expression and 1:200 Streptavidin-PE (Invitrogen S866) to detect binding of biotinylated ACE2.

Cells were processed on a BD FACSAria II and sorted into four bins from low to high RBD expression (measured by myc-FITC staining) or ACE2 binding (measured by streptavidin-PE fluorescence). The RBD expression sort bins were set such that bin 1 would capture 99% of unstained cells, and the remaining 3 bins divide the remainder of each mutant RBD library into equal tertiles. For ACE2 binding, bin 1 captured 95% of cells expressing unmutated RBD incubated with no ACE2 (0 M), and bin 4 captured 95% of cells expressing unmutated RBD incubated with a saturating amount of ACE2 (10 −6 M). Bins 2 and 3 equally divided the distance between the bin 1 upper and bin 4 lower fluorescence boundaries on a log scale. The frequency of each variant in each bin was determined by Illumina sequencing of RBD variant barcodes.

The effects of each mutation on RBD expression and ACE2 binding were determined as described in [25] . RBD mutant expression and ACE2 binding scores were calculated according to the equations in [25] . For ACE2 binding, a score of -1.0 corresponds to a 10-fold loss in affinity (K d ) compared to the wildtype RBD. For RBD expression, a score of -1.0 corresponds to a 10-fold reduction in mean RBD-myc-FITC fluorescence intensity. These measurements were used to computationally filter library variants that were highly deleterious for RBD expression or ACE2 binding and would likely represent spurious antibody-escape mutations (see below for details). The ACE2 binding and RBD expression scores for the single aminoacid mutations in the B.1.351 RBD are available at https://github.com/jbloomlab/SARS-CoV-2-RBD_B.1.351/blob/main/data/final_variant_scores.csv.

As previously described, prior to performing the antibody-escape experiments, the yeast libraries were pre-sorted for RBD expression and binding to dimeric ACE2 (ACROBiosystems AC2-H82E6) to eliminate RBD variants that are completely misfolded or non-functional, such as those lacking modest ACE2 binding affinity [37] . Specifically, unmutated B.1.351 RBD and each RBD mutant library were incubated with dimeric ACE2 at 10 −8 M (a saturating concentration of ACE2 for unmutated B.1.351 RBD). A FACS selection gate was set to capture 98% of cells expressing unmutated B.1.351 RBD that were incubated with 10 −10 M ACE2, to purge the mutant libraries of highly deleterious mutations (i.e., those that have <1% the affinity of unmutated B.1.351 RBD). These pre-sorted yeast libraries containing RBD variants with at least nominal expression and ACE2 binding were used in downstream antibody-escape experiments (see below).

Prior to the yeast-display deep mutational scanning, plasma samples were twice-depleted of nonspecific yeast-binding antibodies. AWY101 yeast containing a negative control (containing an empty vector pETcon plasmid) were grown overnight at 30˚C in galactose-containing media. Then, up to 50 microliters of plasma samples were incubated, rotating, with 40 OD units of the yeast for 2 hours at room temperature in a total volume of 1mL. The yeast cells were pelleted by centrifugation, and the supernatant was transferred to an additional 40 OD units of yeast cells, and the incubation was repeated overnight at 4˚C. Before beginning the plasma-escape mapping experiments, the negative control yeast were pelleted by centrifugation and the supernatant (containing serum antibodies but not negative control yeast or yeastbinding antibodies) was used in plasma-escape mapping.

Plasma mapping experiments were performed in biological duplicate using the independent mutant RBD libraries, similarly to as previously described for monoclonal antibodies [37] and polyclonal plasma samples [28] . Mutant yeast libraries induced to express RBD were washed and incubated with plasma at a range of dilutions for 1 hour at room temperature with gentle agitation. For each plasma, we chose a sub-saturating dilution such that the amount of fluorescent signal due to plasma antibody binding to RBD was approximately equal across samples. The exact dilution used for each plasma is given in S3 Fig. After the plasma incubations, the libraries were secondarily labeled for 1 hour with 1:100 fluorescein isothiocyanate-conjugated anti-MYC antibody (Immunology Consultants Lab, CYMC-45F) to label for RBD expression and 1:200 Alexa Fluor-647-conjugated goat anti-human-IgA+IgG+IgM (Jackson ImmunoResearch 109-605-064) to label for bound plasma antibodies. A flow cytometric selection gate was drawn to capture 3-6% of the RBD mutants with the lowest amount of plasma binding for their degree of RBD expression (S3 Fig). For each sample, approximately 10 million RBD + cells (range 10 7 to 1.5 x 10 7 cells) were processed on the BD FACSAria II cell sorter, with between 4 x 10 5 and 2 x 10 6 plasma-escaped cells collected per sample. Antibody-escaped cells were grown overnight in synthetic defined medium with casamino acids (6.7g/L Yeast Nitrogen Base, 5.0g/L Casamino acids, 1.065 g/L MES acid, and 2% w/v dextrose + 100 U/mL penicillin + 100 μg/mL streptomycin) to expand cells prior to plasmid extraction.

Plasmid samples were prepared from 30 optical density (OD) units (1.6e8 colony forming units (cfus)) of pre-selection yeast populations and approximately 5 OD units (~3.2e7 cfus) of overnight cultures of plasma-escaped cells (Zymoprep Yeast Plasmid Miniprep II) as previously described [37] . The 16-nucleotide barcode sequences identifying each RBD variant were amplified by polymerase chain reaction (PCR) and prepared for Illumina sequencing as described in [25] . Specifically, a primer with the sequence 5 0 -AATGATACGGCGACCACC-GAGA-3 0 was used to anneal to the Illumina P5 adaptor sequence, and the PerkinElmer Next-Flex DNA Barcode adaptor primers with the sequence 5 0 -CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCA-GACGTGTGCTCTTCCGATCT-3 0 (where xxxxxxxx indicates the sample index sequence) were used to anneal to the Illumina P7 adaptor sequence and append sample indexes for sample multiplexing. Barcodes were sequenced on an Illumina HiSeq 2500 with 50 bp single-end reads. To minimize noise from inadequate sequencing coverage, we ensured that each antibody-escape sample had at least 2.5x as many post-filtering sequencing counts as FACSselected cells, and reference populations had at least 2.5e7 post-filtering sequencing counts.

Escape fractions were computed as described in [37] , with minor modifications as noted below. We used the dms_variants package (https://jbloomlab.github.io/dms_variants/, version 0.8.10) to process Illumina sequences into counts of each barcoded RBD variant in each preselection and antibody-escape population. For each plasma selection, we computed the escape fraction for each barcoded variant using the deep sequencing counts for each variant in the original and plasma-escape populations and the total fraction of the library that escaped antibody binding via the formula provided in [37] . Specifically:

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy These escape fractions represent the estimated fraction of cells expressing that specific variant that falls in the escape bin, such that a value of 0 means the variant is always bound by plasma and a value of 1 means that it always escapes plasma binding.

We then applied a computational filter to remove variants with >1 amino-acid mutation, low sequencing counts, or highly deleterious mutations that might cause antibody escape simply by leading to poor expression of properly folded RBD on the yeast cell surface [25, 37] . Specifically, we removed variants that had ACE2 binding scores < −3.0 or expression scores < −1.0, after calculating mutation-level deep mutational scanning scores for this library as in [25] . An ACE2 binding score threshold of -3.0 retained 99.4% and an RBD expression score threshold of -1.0 retained 93.8% of all RBD mutations observed > = 50x in GISAID as of Aug.

We also removed all mutations where the wildtype residue was a cysteine. There were 2,014 out of the possible 3,653 mutations to non-disulfide bond residues in the RBD that passed these computational filters.

The reported antibody-escape scores throughout the paper are the average across the libraries; these scores are also in S3 Data. Correlations in final single-mutant escape scores are shown in S3D Fig.

For plotting and analyses that required identifying RBD sites of strong escape, we considered a site to mediate strong escape if the total escape (sum of mutation-level escape fractions) for that site exceeded the median across sites by >5-fold, and was at least 5% of the maximum for any site. Full documentation of the computational analysis is at https://github.com/ jbloomlab/SARS-CoV-2-RBD_B.1.351.

Importantly, because the B.1.351 libraries were generated using a different method than the Wuhan-Hu-1 RBD libraries, which is fully described in [25] , the analysis of deep sequencing data to compute each mutation's escape fraction is also different. The newly generated B.1.351 libraries were ordered from Twist Bioscience to have one amino-acid mutation per variant, whereas the Wuhan-Hu-1 libraries were generated in-house with a PCR-based approach, with an average of 2.7 mutations per variant [25] . Because there were often multiple mutations per variant for the Wuhan-Hu-1 libraries, global epistasis modeling was used to deconvolve the effects of single amino-acid mutations on antibody binding [28, 37] , whereas for the B.1.351 libraries, the measurements for single-mutant variants were used directly (occasional variants with multiple mutations were discarded) to calculate antibody escape.

HEK-293T (American Type Culture Collection, CRL-3216) cells were used to generate SARS-CoV-2 spike-pseudotyped lentiviral particles and 293T-ACE2 cells (Biodefense and Emerging Infectious Research Resources Repository (BEI Resources), NR-52511) were used to titer the SARS-CoV-2 spike-pseudotyped lentiviral particles and to perform neutralization assays (see below).

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy For experiments involving D614G spike, we used spike-pseudotyped lentiviral particles that were generated essentially as described in [70] , using a codon-optimized SARS-CoV-2 spike from Wuhan-Hu-1 strain that contains a 21-amino-acid deletion at the end of the cytoplasmic tail [27] and the D614G mutation that is now predominant in human SARS-CoV-2 [30] . The plasmid encoding this spike, HDM_Spikedelta21_D614G, is available from Addgene (#158762) and BEI Resources (NR-53765), and the full sequence is at (https://www.addgene. org/158762). Point mutations were introduced into the RBD of this plasmid via site-directed mutagenesis.

For experiments involving B.1.351 spike, we introduced the following mutations into the HDM_Spikedelta21_D614G plasmid to match the amino acid sequence of EPI_ISL_700420: 80A, D215G, L242-244del, K417N, E484K, N501Y, and A701V. This plasmid map is available online at https://github.com/jbloomlab/SARS-CoV-2-RBD_B.1.351/blob/main/data/plasmid_ maps/2957_HDM_Spikedelta21_B.1.351.gb.

To generate spike-pseudotyped lentiviral particles [70] , 6×10 5 HEK-293T (ATCC CRL-3216) cells per well were seeded in 6-well plates in 2 mL D10 growth media (Dulbecco's Modified Eagle Medium with 10% heat-inactivated fetal bovine serum, 2 mM l-glutamine, 100 U/ mL penicillin, and 100 μg/mL streptomycin). 24 hours later, cells were transfected using BioT transfection reagent (Bioland Scientific) with a Luciferase_IRES_ZsGreen backbone, Gag/Pol lentiviral helper plasmid (BEI Resources NR-52517), and wild-type or mutant SARS-CoV-2 spike plasmids. Media was changed to fresh D10 at 24 hours post-transfection. At~60 hours post-transfection, viral supernatants were collected, filtered through a 0.45 μm surfactant-free cellulose acetate low protein-binding filter, and stored at −80˚C.

Titers of spike-pseudotyped lentiviral particles were determined as described in [70] with the following modifications. 100 μL of diluted spike-pseudotyped lentiviral particles was added to 1.25e4 293T-ACE2 cells (BEI Resources NR-52511), grown overnight in 50 μL of D10 growth media in a 96-well black-walled poly-L-lysine coated plate (Greiner Bio-One, 655936). Relative luciferase units (RLU) were measured 65 hours post-infection (Promega Bright-Glo, E2620) in the infection plates with a black back-sticker (Thermo Fisher Scientific, NC9425162) added to minimize background. Titers were first estimated from the average of 8 two-fold serial dilutions of virus starting at 10 μL virus in a total volume of 150 μL, performed in duplicate.

293T-ACE2 cells (BEI Resources NR-52511) were seeded at 1.25e4 cells per well in 50 μL D10 in poly-L-lysine coated, black-walled, 96-well plates (Greiner 655930). 24 hours later, pseudotyped lentivirus supernatants were diluted to~200,000 RLU per well (determined by titering as described above) and incubated with a range of dilutions of plasma for 1 hour at 37˚C. 100 μL of the virus-antibody mixture was then added to cells. At about 50 or *70 hours postinfection, luciferase activity was measured using the Bright-Glo Luciferase Assay System (Promega, E2610). Fraction infectivity of each plasma antibody-containing well was calculated relative to a no-plasma well inoculated with the same initial viral supernatant in the same row of the plate. We used the neutcurve package (https://jbloomlab.github.io/neutcurve version 0.5.7) to calculate the inhibitory concentration 50% (IC 50 ) and the neutralization titer 50% (NT 50 ), which is 1/IC 50 , of each plasma against each virus by fitting a Hill curve with the bottom fixed at 0 and the top fixed at 1.

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy

Two rounds of sequential depletion of RBD-binding antibodies were performed for vaccineelicited sera. Magnetic beads conjugated to the SARS-CoV-2 B.1.351 RBD (ACROBiosystems, MBS-K032) were prepared according to the manufacturer's protocol. Beads were resuspended in ultrapure water at 1 mg beads/mL and a magnet was used to wash the beads 3 times in phosphate-buffered saline (PBS) with 0.05% bovine serum albumin (BSA). Beads were then resuspended in PBS with 0.05% BSA at 1 mg beads per mL. Beads (manufacturer-reported binding capacity of 10-40 μg/mL anti-RBD antibodies) were incubated with human plasma at a 2:1 ratio beads:plasma, rotating overnight at 4˚C or for 2 hours at room temperature. A magnet (MagnaRack Magnetic Separation Rack, Thermo Fisher Scientific, CS15000) was used to separate antibodies that bind RBD from the supernatant, and the supernatant (the post-RBD antibody depletion sample) was removed. A mock depletion (pre-depletion sample) was performed by adding an equivalent volume of PBS + 0.05% BSA and rotating overnight at 4˚C or for 2 hours at room temperature. Up to three rounds of depletions were performed to ensure full depletion of RBD-binding antibodies. For the neutralization assays on these plasmas depleted of RBD-binding antibodies, the reported plasma dilution is corrected for the dilution incurred by the depletion process. Note that these assays were performed in 293T cells over-expressing human ACE2, which may underestimate contributions of non-RBD-binding antibodies to viral neutralization [7, 35, 60] .

The IgG ELISAs for spike protein and RBD were conducted as previously described [71] . Briefly, ELISA plates were coated with recombinant B.1.351 spike (purified and prepared as described in [71] ) and RBD (ACROBiosystems, SPD-C52Hp) antigens described in at 2 μg/ mL. Five 3-fold serial dilutions of sera beginning at 1:500 were performed in PBS with 0.1% Tween with 1% Carnation nonfat dry milk. Dilution series of the synthetic sera comprised of the anti-RBD antibody REGN10987 [72] , which binds to both Wuhan-1-like RBD and B.1.351 RBD, and pooled pre-pandemic human serum from 2017-2018 (Gemini Biosciences; nos. 100-110, lot H86W03J; pooled from 75 donors) were performed such that the anti-spike antibody was present at a highest concentration of 0.25 μg/mL. REGN10987 was recombinantly produced by Genscript. The REGN10987 is the same as that used in [73] . Pre-pandemic serum alone, without anti-RBD antibody depletion, was used as a negative control, averaged over 2 replicates. Secondary labeling was performed with goat anti-human IgG-Fc horseradish peroxidase (HRP) (1:3000, Bethyl Labs, A80-104P). Antibody binding was detected with TMB/E HRP substrate (Millipore Sigma, ES001) and 1 N HCl was used to stop the reaction. OD 450 was read on a Tecan infinite M1000Pro plate reader.

The static logo plot visualizations of the escape maps in the paper figures were created using the dmslogo package (https://jbloomlab.github.io/dmslogo, version 0.6.2) and in all cases the height of each letter indicates the escape fraction for that amino-acid mutation calculated as described above. For each sample, the y-axis is scaled to be the greatest of (a) the maximum site-wise escape metric observed for that sample, (b) 20x the median site-wise escape fraction observed across all sites for that plasma, or (c) an absolute value of 1.0 (to appropriately scale samples that are not noisy but for which no mutation has a strong effect on antibody binding). Sites K417, L452, S477, T478, E484, and N501 have been added to logo plots due to their

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy frequencies among circulating viruses. The code that generates these logo plot visualizations is available at https://github.com/jbloomlab/SARS-CoV-2-RBD_B.1.351/blob/main/results/ summary/escape_profiles.md. In many of the visualizations, the RBD sites are categorized by epitope region [23] and colored accordingly. We define the class 1 epitope as residues 403+405 +406+417+420+421+453+455-460+473-476+486+487+489+504, the class 2 epitope as residues 472+483-485+490-494, the class 3 epitope to be residues 345+346+437-452+496+498-501, and the class 4 epitope as residues 365-372+378+382-386.

For the static structural visualizations in the paper figures, the RBD surface (PDB 6M0J) was colored by the site-wise escape metric at each site, with white indicating no escape and red scaled to be the same maximum used to scale the y-axis in the logo plot escape maps, determined as described above. We created interactive structure-based visualizations of the escape maps using dms-view [74] that are available at https://jbloomlab.github.io/SARS-CoV-2-RBD_B.1.351/. The logo plots in these escape maps can be colored according to the deep mutational scanning measurements of how mutations affect ACE2 binding or RBD expression as described above.

The percent of neutralizing activity of early-2020 and B.1.351-convalescent plasmas due to RBD-binding antibodies is plotted with the plotnine python package, version 0.8.0 (https:// plotnine.readthedocs.io/en/stable/index.html), shown as a Tukey boxplot (middle line indicating median, box limits indicating interquartile range) with individual measurements overlaid as points. P-values are from a log-rank test accounting for censoring, calculated with the lifelines python package, version 0.25.10 (https://lifelines.readthedocs.io/en/latest/). Controls showing that the RBD antibody depletion completely removes a RBD-targeting neutralizing antibody. Effect of two rounds of RBD antibody depletion on binding to B.1.351 RBD and spike (left) and neutralization of B.1.351 spike-pseudotyped lentiviral particles (right) by synthetic serum. The synthetic serum was made by adding the RBD-targeting antibody REGN10987 that binds both Wuhan-Hu-1 and B.1.351 RBD [72] to pre-pandemic pooled serum at 50 μg/mL. The x-axis indicates the antibody concentration (μg/mL), and the y-axis is the optical density at wavelength 450 (OD450) reading at each dilution (left) or fraction infectivity (right). (B) Binding of B.1.351 convalescent plasmas to B.1.351 RBD and spike for mock depletion (gray lines) and depletion of RBD-binding antibodies (orange lines). Some samples were depleted three times (dashed lines and open circles) if two rounds of depletion did not abrogate binding to RBD. There were not substantial reductions in OD450 after the third round of depletions, so we reasoned that the samples were maximally depleted, and no further rounds of depletions were performed. Removal of RBD-binding antibodies only modestly reduces spike binding, consistent with prior findings that the majority of anti-spike antibodies do not bind the RBD [28, [77] [78] [79] [80] . (C) Neutralization curves for plasma mock depletion (gray circles) and depletion of RBD-binding antibodies (orange triangles). Each assay was performed in technical duplicate, and points show the mean and standard error of the replicates. Pre-pandemic pooled serum was included in (B) and (C) as a negative control for binding and neutralization. RBD-binding antibodies were removed from the plasma using streptavidin magnetic beads conjugated to biotinylated B.1.351 RBD. All binding assays were performed with B.1.351 RBD and spike, and all neutralization assays were performed with B.1.351 spike-pseudotyped Correlations between biological independent replicate library measurements of the effects of single mutations on ACE2 binding and RBD expression, measured as described in [25] . See Methods for experimental details. (C) Thresholds on the ACE2 binding and RBD expression scores (dashed orange lines) for the B.1.351 mutant library to computationally filter highly deleterious variants that may represent spurious antibody-escape mutations. Importantly, we aimed to retain most mutations that have been observed > = 50 times in sequenced SARS-CoV-2 isolates. The x-axis categorizes mutations by their number of observations in GISAID [81] as of Aug. 1, 2021. An ACE2 binding score threshold of > = -3.0 (1,000-fold loss in binding affinity) and an RBD expression score of > = -1.0 (10-fold loss in RBD expression) were chosen, which filter comparable numbers of mutations as in prior Wuhan-Hu-1 experiments [28, 73] . These filters retain 99.4 and 93.8% of mutations, respectively, that have been observed > = 50 times in sequenced SARS-CoV-2 isolates. (D) Relationship between the ACE2 binding and RBD expression scores for the B.1.351 RBD library compared to those previously published for the Wuhan-Hu-1 library [25] . The computational filters used for antibody-escape experiments for the Wuhan-Hu-1 [28] and B.1.351 libraries are dashed orange lines. Each dot is one mutation, and mutations to disulfide bonds are shown in red. A key difference is that for the previously published Wuhan-Hu-1 experiments, dimeric rather than monomeric ACE2 was used [25] . . Flow cytometry is used to quantify both RBD expression (via a C-terminal MYC tag, green star) and antibody binding to the RBD protein expressed on the surface of each yeast cell (bottom left). A library of yeast expressing B.1.351 RBD mutants was incubated with convalescent plasmas and fluorescence-activated cell sorting (FACS) was used to enrich for cells expressing RBD that bound reduced amounts of plasma antibodies, as detected using an IgA+IgG+IgM secondary antibody. Deep sequencing was used to quantify the frequency of each mutation in the initial and antibody-escape cell populations. We quantified the effect of each mutation as the escape fraction, which represents the fraction of cells expressing RBD with that mutation that fell in the antibody escape FACS bin. Escape fractions are represented in logo plots, with the height of each letter proportional to the effect of that amino-acid mutation on antibody binding. The site-level escape metric is the sum of the escape fractions of all mutations at a site. Experimental and computational filtering were used to remove RBD mutants that were misfolded or unable to bind the ACE2 receptor. (B) Left: Representative plots of nested FACS gating strategy used for all plasma selection experiments to select for single cells. Samples were gated by SSC-A versus FSC-A, SSC-W versus SSC-H, and FSC-W versus FSC-H) that also express RBD

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy (FITC-A vs. FSC-A). Right: The RBD mutant libraries were sorted to retain cells expressing variants that bound to ACE2 with at least nominal affinity. Unmutated B.1.351 RBD and each RBD mutant library was incubated with dimeric ACE2 at 10 −8 M. A FACS selection gate was set to capture 98% of cells expressing unmutated B.1.351 RBD that were incubated with 10 −10 M ACE2, to purge the mutant libraries of highly deleterious mutations (i.e., those that have <1% the affinity of unmutated B.1.351 RBD). (C) Left: FACS gating strategy for one of two independent libraries to select cells expressing RBD mutants with reduced binding by polyclonal sera (cells in blue). Gates were set manually during sorting. Selection gates were set to capture~5% of the RBD+ library. The same gate was set for both independent libraries stained with each plasma sample, and the FACS scatter plots looked qualitatively similar between the two libraries. Right: the fraction of library cells that fall into each selection gate. (A) Each plot shows the neutralization curves of one point mutant and the wildtype measured on the same assay date for each plasma (the same wildtype curve is repeated on multiple plots for comparison). Plots are grouped by assay date. Each point is the average of two technical replicates. (B) The fold-decrease in neutralization for samples shown in Fig 5, with the addition of previously measured neutralization by samples from 6 early 2020 convalescent individuals collected approximately 100 days post-symptom onset [38] . (C) The fold-change in IC50 (left) or the absolute IC50 (right) for the neutralization of each point mutant by each plasma. The fold-change IC50 is calculated relative to the geometric mean of two wildtype technical replicates performed on the same assay date. Each point is one technical replicate. The dashed gray line indicates the geometric mean of all wildtype measurements for that plasma, and the orange line indicates the geometric mean of the effect of removing all RBD-binding antibodies. B.1.351 plasma names are prefixed with K � , and early 2020 plasmas are prefixed with "participant". All assays were performed with the "homologous" virus: B. 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy 

Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma

SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma

Transmission, infectivity, and neutralization of a spike L452R SARS-CoV-2 variant

Reduced neutralization of SARS-CoV-2 B.1.617 by vaccine and convalescent serum

Emergence and expansion of SARS-CoV-2 B.1.526 after identification in New York

Recurrent deletions in the SARS-CoV-2 spike glycoprotein drive antibody escape

Resistance of SARS-CoV-2 variants to neutralization by monoclonal and serum-derived polyclonal antibodies

Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7. Nature

N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2. Cell

SARS-CoV-2 immune evasion by the B.1.427/B.1.429 variant of concern

Sensitivity of SARS-CoV-2 B.1.1.7 to mRNA vaccine-elicited antibodies

Molecular basis of immune evasion by the delta and kappa SARS-CoV-2 variants

SARS-CoV-2 B.1.617.2 Delta variant replication and immune evasion

Amino-acid change on the antigenic region B1 of H3 haemagglutinin may be a trigger for the emergence of drift strain of influenza A virus

Reactivity of human convalescent sera with influenza virus hemagglutinin protein mutants at antigenic site A. Microbiol Immunol

Immunodominance of antigenic site B over site A of hemagglutinin of recent H3N2 influenza viruses

Detection of a SARS-CoV-2 variant of concern in South Africa

CoVariants: SARS-CoV-2 Mutations and Variants of Interest

Impact of circulating SARS-CoV-2 variants on mRNA vaccine-induced immunity

mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants

Reduced sensitivity of SARS-CoV-2 variant Delta to antibody neutralization

Cross-Reactive Neutralizing Antibody Responses Elicited by SARS-CoV-2 501Y.V2 (B.1.351)

SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies

Mapping mutations to the SARS-CoV-2 RBD that escape binding by different classes of antibodies

Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding

N501Y mutation of spike protein in SARS-CoV-2 strengthens its binding to receptor ACE2

Dynamics of Neutralizing Antibody Titers in the Months After Severe Acute Respiratory Syndrome Coronavirus 2 Infection

Comprehensive mapping of mutations in the SARS-CoV-2 receptor-binding domain that affect recognition by polyclonal human plasma antibodies

Viral genomes reveal patterns of the SARS-CoV-2 outbreak in Washington State

Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus

Mapping Neutralizing and Immunodominant Sites on the SARS-CoV-2 Spike Receptor-Binding Domain by Structure-Guided High-Resolution Serology

The antigenic anatomy of SARS-CoV-2 receptor binding domain

Potent neutralizing antibodies against multiple epitopes on SARS-CoV-2 spike

Prevalent, protective, and convergent IgG recognition of SARS-CoV-2 non-RBD spike epitopes

Neutralizing and protective human monoclonal antibodies recognizing the N-terminal domain of the SARS-CoV-2 spike protein

Lectins enhance SARS-CoV-2 infection and influence neutralizing antibodies

Complete Mapping of Mutations to the SARS-CoV-2 Spike Receptor-Binding Domain that Escape Antibody Recognition. Cell Host Microbe

Antibodies elicited by mRNA-1273 vaccination bind more broadly to the receptor binding domain than do those from SARS-CoV-2 infection

Potently neutralizing and protective human antibodies against SARS-CoV-2

Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody

Neutralization of SARS-CoV-2 spike 69/70 deletion, E484K and N501Y variants by BNT162b2 vaccine-elicited sera

Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants

Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera

Identification of SARS-CoV-2 spike mutations that attenuate monoclonal and serum antibody neutralization

Discordant antigenic drift of neuraminidase and hemagglutinin in H1N1 and H3N2 influenza viruses

Cross-reactive antibody responses to the 2009 pandemic H1N1 influenza virus

Genesis and pathogenesis of the 1918 pandemic H1N1 influenza A virus

Pandemic Paradox: Early Life H2N2 Pandemic Influenza Infection Enhanced Susceptibility to Death during the 2009 H1N1 Pandemic

Immunodominance and Antigenic Variation of Influenza Virus Hemagglutinin: Implications for Design of Universal Vaccine Immunogens

Complete map of SARS-CoV-2 RBD mutations that escape the monoclonal antibody LY-CoV555 and its cocktail with LY-CoV016

Evolution of antibody immunity to SARS-CoV-2

Modular basis for potent SARS-CoV-2 neutralization by a prevalent VH1-2-derived antibody class

Convergent antibody responses to SARS-CoV-2 in convalescent individuals

SARS-CoV-2 Beta variant infection elicits potent lineage-specific and cross-reactive antibodies

Broadly neutralizing antibodies to SARS-related viruses can be readily induced in rhesus macaques

Reduced antibody cross-reactivity following infection with B.1.1.7 than with parental SARS-CoV-2 strains

Increased transmission of SARS-CoV-2 lineage B.1.1.7 (VOC 2020212/01) is not accounted for by a replicative advantage in primary airway cells or antibody escape

Exposures to different SARS-CoV-2 spike variants elicit neutralizing antibody responses with differential specificity towards established and emerging strains

Divergence of delta and beta variants and SARS-CoV-2 evolved in prolonged infection into distinct serological phenotypes

A neutralizing human antibody binds to the Nterminal domain of the Spike protein of SARS-CoV-2. Science

Rapid and parallel adaptive mutations in spike S1 drive clade success in SARS-CoV-2. bioRxiv

A human coronavirus evolves antigenically to escape antibody immunity

Evidence for adaptive evolution in the receptor-binding domain of seasonal coronaviruses OC43 and 229E

On the Doctrine of Original Antigenic Sin

Disquisitions of Original Antigenic Sin. I. Evidence in man

ACE2 binding is an ancestral and evolvable trait of sarbecoviruses

A novel high-throughput screen reveals yeast genes that increase secretion of heterologous proteins

Large-scale high-efficiency yeast transformation using the LiAc/SS carrier DNA/ PEG method

alignparse: A Python package for parsing complex features from highthroughput long-read sequencing

Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays

Serological identification of SARS-CoV-2 infections among children visiting a hospital during the initial Seattle outbreak. Nat Commun

Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail

Prospective mapping of viral mutations that escape antibodies used to treat COVID-19

dms-view: Interactive visualization tool for deep mutational scanning data

SARS-CoV-2 and bat RaTG13 spike glycoprotein structures inform on virus evolution and furin-cleavage effects

Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor

Potent neutralizing antibodies from COVID-19 patients define multiple targets of vulnerability

Analysis of a SARS-CoV-2-Infected Individual Reveals Development of Potent Neutralizing Antibodies with Limited Somatic Mutation. Immunity

Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model

Human neutralizing antibodies elicited by SARS-CoV-2 infection

disease and diplomacy: GISAID's innovative contribution to global health. Glob Chall

We thank Cathy Lin for administrative support; Dolores Covarrubias, Andy Marty, the Genomics and Flow Cytometry core facilities at the Fred Hutchinson Cancer Research Center, and Katy Munson at the University of Washington PacBio Sequencing Services for experimental support. We also thank all study participants for their generous participation and contribution to this work.The content is solely the responsibility of the authors and does not necessarily represent the official views of the US government or the other sponsors. 

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy

A SARS-CoV-2 variant elicits an antibody response with a shifted immunodominance hierarchy