key: cord-0873528-r4yukmwe
authors: Yonker, Lael M.; Neilan, Anne M.; Bartsch, Yannic; Patel, Ankit B.; Regan, James; Arya, Puneeta; Gootkind, Elizabeth; Park, Grace; Hardcastle, Margot; St. John, Anita; Appleman, Lori; Chiu, Michelle L.; Fialkowski, Allison; De la Flor, Denis; Lima, Rosiane; Bordt, Evan A.; Yockey, Laura J.; D’Avino, Paolo; Fischinger, Stephanie; Shui, Jessica E.; Lerou, Paul H.; Bonventre, Joseph V.; Yu, Xu G.; Ryan, Edward T.; Bassett, Ingrid V.; Irimia, Daniel; Edlow, Andrea G.; Alter, Galit; Li, Jonathan Z.; Fasano, Alessio
title: Pediatric SARS-CoV-2: Clinical Presentation, Infectivity, and Immune Responses
date: 2020-08-20
journal: J Pediatr
DOI: 10.1016/j.jpeds.2020.08.037
sha: df44bd591c6975c433622e9bfcf4e951c9b0b785
doc_id: 873528
cord_uid: r4yukmwe

Data sharing: The data obtained as part of this study are available from the corresponding author upon reasonable request. OBJECTIVES: As schools plan for re-opening, understanding the potential role children play in the coronavirus infectious disease 2019 (COVID-19) pandemic and the factors that drive severe illness in children is critical. Study design: Children ages 0-22 years with suspected severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection presenting to urgent care clinics or being hospitalized for confirmed/suspected SARS-CoV-2 infection or multisystem inflammatory syndrome in children (MIS-C) at Massachusetts General Hospital (MGH) were offered enrollment in the MGH Pediatric COVID-19 Biorepository. Enrolled children provided nasopharyngeal, oropharyngeal, and/or blood specimens. SARS-CoV-2 viral load, ACE2 RNA levels, and serology for SARS-CoV-2 were quantified. RESULTS: A total of 192 children (mean age 10.2 +/- 7 years) were enrolled. Forty-nine children (26%) were diagnosed with acute SARS-CoV-2 infection; an additional 18 children (9%) met criteria for MIS-C. Only 25 (51%) of children with acute SARS-CoV-2 infection presented with fever; symptoms of SARS-CoV-2 infection, if present, were non-specific. Nasopharyngeal viral load was highest in children in the first 2 days of symptoms, significantly higher than hospitalized adults with severe disease (P = .002). Age did not impact viral load, but younger children had lower ACE2 expression (P=0.004). IgM and IgG to the receptor binding domain (RBD) of the SARS-CoV-2 spike protein were increased in severe MIS-C (P<0.001), with dysregulated humoral responses observed. CONCLUSION: This study reveals that children may be a potential source of contagion in the SARS-CoV-2 pandemic in spite of milder disease or lack of symptoms, and immune dysregulation is implicated in severe post-infectious MIS-C.

As schools plan for re-opening, debates around the role children play in the COVID-19 pandemic persist. Concerns have been raised as to whether allowing children to congregate in the classroom will fuel the spread of the pandemic. On an individual level, families are worried how SARS-CoV-2 infection could affect their children and family. Particular concern is elevated for families belonging to low socio-economic classes, where the prevalence of SARS-CoV-2 infection is higher, and where multi-generational co-habitation is the norm, increasing the risk of transmitting the infection to vulnerable grandparents and older adults (1) .

The manner in which children contribute to the spread of SARS-CoV-2 is unclear. Children are less likely to become seriously ill from SARS-CoV-2(2); however, asymptomatic carriers, including children, can spread infection and carry virus into their household. 3 Children infected with SARS-CoV-2 tend to have milder symptoms with significantly lower mortality than is seen in adult infection (4) . It has been hypothesized that children have reduced incidence of COVID-19 because ACE2 expression in the nasopharynx increases with age(5); however ACE2 expression has not been studied in the upper airways of children infected with SARS-CoV-2.

Understanding infectious burden and potential for transmissibility within the pediatric population is critical for developing both short-and long-term responses, including public health policies, to the current pandemic.

Although an acute SARS-CoV-2 infection tends to be mild or symptom-free in most pediatric cases, some children develop a multisystem inflammatory syndrome (MIS-C)(6, 7) several weeks after possible SARS-CoV-2 infection or exposure, with severe cardiac complications, including hypotension, shock, and acute heart failure (8) . Understanding post-infectious immune responses in pediatric SARS-CoV-2 infection(9), especially MIS-C, is critical for designing treatment and prevention strategies.

Here, we describe the pediatric impact of COVID-19, specifically focusing on viral burden, susceptibility to disease, and immune responses. Table I; available at www.jpeds.com).

Once informed consent, and if appropriate, assent, were verbally obtained by the patients or parent/guardian in accordance with IRB guidelines, nasopharyngeal and oropharyngeal swabs were obtained and placed in phosphate buffered saline. The samples were immediately aliquoted and stored at -80 o C. Venipuncture was performed; plasma and serum were collected and immediately stored at -80 o C. CoV-2 test by RT-PCR, serology or antigen test, or exposure to an individual. with COVID-19 within 4 weeks prior to the onset of symptoms.

Data collection: Medical records were reviewed to assess demographic and clinical factors, including age, medical history, presenting features and clinical testing, household contacts, and other possible risk factors at presentation. Data were stored in a REDcap database.

SARS-CoV-2 viral load quantification: SARS-CoV-2 RNA levels were quantified with a quantitative viral load assay using the US CDC 2019-nCoV_N1 primers and probe set as previously described(10). Plasma and respiratory samples were centrifuged at approximately 21,000 x g for 2 hours at 4 o C. RNA was extracted from serum and respiratory specimens using the TRIzol-LS (Thermo Fisher Scientific Inc, Waltham, MA, USA)-based method, followed by RNA purification, and quantification with the 1X TaqPath 1-Step RT-qPCR Master Mix, CG (Thermo Fisher). Quantification of the Importin-8 (IPO8) housekeeping gene RNA level was performed to determine the quality of the respiratory sample collection(11-13). An internal virion control (RCAS) was spiked into each sample and quantified to determine the efficiency of RNA extraction and qPCR amplification.(14) SARS-CoV-2 pseudoviral reference standards (SeraCare, Milford, MA, USA) were used as positive controls for each run. SARS-CoV-2 viral loads below 40 RNA copies/mL were categorized as undetectable and set at 1.0 log 10 RNA copies/mL.

cDNA was transcribed from RNA extracted from nasopharyngeal and oropharyngeal swabs using TRIzol-LS reagent (Thermo Fisher) and then purified by isopropanol extraction. qPCR standards were created using a hACE2 plasmid and MEGAscript T7 transcription kit (Thermo Fisher), purified with the RNeasy MinElute spin column kit (Qiagen, the Netherlands), and J o u r n a l P r e -p r o o f quantified by nanodrop. ACE2 and IPO8 Gene expression was assessed by qPCR using iTaq Universal SYBR Green mix (Bio-Rad Laboratories, Hercules, CA, USA) with ACE2 primers (FWD AAACATACTGTGACCCCGCAT, REV CCAAGCCTCAGCATATTGAACA) as previously used(15) and IPO8 primers (Bio-Rad Laboratories, Hercules, CA, USA). ACE2 and IPO8 RNA were used to generate standard curve to quantitate copy numbers per sample and ACE2 expression relative to IPO8 was calculated as previous(16).

IgG and IgM titers measured by ELISA: SARS2-CoV2-RBD (in-house, HEK293 cells provided by Aaron Schmidt, Ragon Institute) and SARS2-CoV2-NC (Aalto Bio Reagents Ltd., Ireland) specific plasma antibodies were quantified by ELISA. The average plus 5x or 3x standard deviation of included negative adult plasma controls were defined as negative cutoff for IgG or IgM, respectively. SARS-CoV-2-RBD specific monoclonal human IgG1 or IgM antibody (clone: CR3022) was added in a two-fold dilution curve starting at 2.5ug/ml to each plate and specific IgG or IgM concentrations were calculated. comparisons, the Fisher exact test was used. The Spearman rank correlation tested relationships between two variables. Prism software was used to analyze and graph data.

The MGH Pediatric COVID-19 Biorepository enrolled 192 patients (mean age 10.2 +/-7 years), whose demographics are summarized in Table 2 (available at www.jpeds.com). Of all enrolled, 49 (26%) were SARS-CoV-2 (+), 18 (9%) had MIS-C, and 125 (65%) were SARS-CoV-2 (-).

Children ages 0-22 years participated in this study, with children ages 11-16 years most highly represented in the SARS-CoV-2 (+) cohort (16, 34%) and children ages 1-4 years most highly represented in the MIS-C cohort (7, 39%). Only 2 (4%) of the SARS-CoV-2 (+) cohort were <1

year of age, although this was previously reported as a higher risk age-group (18) . Sex was equally distributed between children with and without acute SARS-CoV-2 infection, although there was a male predominance in the MIS-C group (14, 78%). Latino/Hispanic children were most highly represented in both the SARS-CoV-2 (-) and SARS-CoV-2 (+) groups. Twenty-five (51%) of children infected acutely with SARS-CoV-2 came from low-income communities, as compared with 1 (2%) from high-income communities (Fisher exact test, P<0.001).

All children enrolled in the Pediatric COVID-19 biorepository had the option of providing nasopharyngeal, oropharyngeal, and blood specimens for research. Eighty-three children provided a nasopharyngeal specimen, 105 provided an oropharyngeal specimen, and 100 provided a blood sample.

J o u r n a l P r e -p r o o f

CoV-2 (-) and SARS-CoV-2 (+) children commonly reported fever, (62, 40% vs 25, 51%, respectively), cough (55, 36% vs 23, 47%), congestion (29, 19% vs 17, 35%), rhinorrhea (29, 19% vs 14, 29%), and headache (33, 21% vs 13, 27%), none of which were significantly different between the two groups. Anosmia was more common in the SARS-CoV-2 (+) group (3, 2% vs 10, 20% P=<0.001), as was sore throat (26, 28% vs 17, 35%, P=0.04). In addition to fever, MIS-C presented more often with nausea/vomiting (5, 29%, P<0.001) and rash (5, 28%, P<0.001) and less often with symptoms of an upper respiratory tract infection. Temperatures documented on examination did not differ among the three cohorts ( Figure 1 and Table 3 [available at www.jpeds.com]).

None of the SARS-CoV-2 (+) or MIS-C children had heart disease, hypertension, or diabetes, which are risk factors for infection in the adult population (19) ; however, 13 (27%) of SARS-CoV-2 (+) children were obese, as compared with 2 (11%) of the MIS-C cohort. Asthma was a common feature in SARS-CoV-2 (-) patients (29, 19%) whereas SARS-CoV-2 (+) and MIS-C patient groups displayed typical population rates of asthma(20) (6, 12% and 2,11%, respectively). Other pulmonary diseases, immune/autoimmune diseases, and neuro/neurodevelopmental diseases were assessed and were not seen in high levels in any cohort.

Nine (18%) SARS-CoV-2 infected children and 10 (56%) children with MIS-C did not have a known infected household contact. Of the children acutely infected with SARS-CoV-2, 26 (53%) attended grade school. None of the 7 preschool/kindergarteners tested positive for SARS-CoV-2 or developed MIS-C.

Nasopharyngeal and oropharyngeal swabs and serum were tested to quantify SARS-CoV-2 viral load. Higher levels of viral load were detected in nasopharyngeal swabs compared with oropharyngeal swabs (unpaired t-test, P=0.01, Figure 2 , A). Only 2 (11%) children with MIS-C had a detectable viral load from nasopharyngeal swabs (Figure 2 , A). Viral load in respiratory secretions of children was high, despite mild or absent symptoms, at 6.2 log 10 RNA copies/ml (range 1.0-8.9 log 10 RNA copies/ml) during days 0-2 of symptoms. Of the 11 asymptomatic children presenting for SARS-CoV-2 testing based on exposure to an infected individual rather Limiting the spread of SARS-CoV-2 infections in children is of particular concern as schools plan for re-opening. Our findings suggest that it would be ineffective to rely on symptoms or J o u r n a l P r e -p r o o f 

Disproportionate impact of the COVID-19 pandemic on immigrant communities in the United States

Coronavirus Disease 2019 in Children -United States

Evidence Supporting Transmission of Severe Acute Respiratory Syndrome Coronavirus 2 While Presymptomatic or Asymptomatic

Estimates of the severity of coronavirus disease 2019: a model-based analysis

Nasal Gene Expression of Angiotensin-Converting Enzyme 2 in Children and Adults

Multisystem Inflammatory Syndrome Related to COVID-19 in Previously Healthy Children and Adolescents

Multisystem Inflammatory Syndrome in U.S. Children and Adolescents

Acute heart failure in multisystem inflammatory syndrome in children (MIS-C) in the context of global SARS

Detection of Host Response to Viral Respiratory Infection by Measurement of Messenger RNA for MxA, TRIM21, and Viperin in Nasal Swabs

multiplexed IgG subclassing of antigen-specific antibodies from clinical samples

Epidemiology of COVID-19 Among Children in China

Coronavirus Disease 2019 in China

Tracking pediatric asthma: the Massachusetts experience using school health records

Antibody responses against SARS-CoV-2 in COVID-19 patients

An insertion unique to SARS-CoV-2 exhibits superantigenic character strengthened by recent mutations