key: cord-0869076-jkhgd02w
authors: Sengupta, Sourodip; Addya, Sankar; Biswas, Diptomit; Banerjee, Paromita; Sarma, Jayasri Das
title: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in murine β-coronavirus-induced neuroinflammation
date: 2021-12-02
journal: Virology
DOI: 10.1016/j.virol.2021.11.012
sha: 4842893ba3bdaa22a2f114070a71df552d96b3eb
doc_id: 869076
cord_uid: jkhgd02w

Mouse hepatitis virus (MHV; m-β-CoV) serves as a useful model for studying the cellular factors involved in neuroinflammation. To understand the role of matrix metalloproteinases (MMPs) in neuroinflammation, brain tissues from m-β-CoV-infected mice were harvested at different days post-infection (d.p.i) and investigated for Mmp expression by RT-qPCR. Mmp-2, -3, -8, -12 showed significant mRNA upregulation peaking with viral replication between 5 and 6 d.p.i. Elevated levels of MMP regulator TIMP-1 are suggestive of a TIMP-1 mediated host antiviral response. Biological network assessment suggested a direct involvement of MMP-3, -8, -14 in facilitating peripheral leukocyte infiltrations. Flow cytometry confirmed the increased presence of NK cells, CD4(+) and CD8(+) T cells, neutrophils, and MHCII expressing cells in the m-β-CoV infected mice brain. Our study revealed that m-β-CoV upregulated Park7, RelA, Nrf2, and Hmox1 transcripts involved in ROS production and antioxidant pathways, describing the possible nexus between oxidative pathways, MMPs, and TIMP in m-β-CoV-induced neuroinflammation.

The newly emergent severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) 37

(1-3) and previous encounters with SARS-CoV (4-6) and middle east respiratory syndrome 38 coronavirus (MERS-CoV) (7-9) have led to a renewed interest in coronavirus (CoV) 39 research. CoVs are enveloped positive-sense single-stranded RNA virus (10, 11)[ICTV 9 th 40 report, 2011; https://talk.ictvonline.org/ictv-reports/]. Past studies have demonstrated the 41 requirement of several cellular proteases such as cell surface serine proteases (12-15), using a NanoDrop 2000/2000c Spectrophotometer (Thermo Fisher Scientific), and cDNA 153 was prepared with 1 µg of total RNA using a cDNA reverse transcription kit. Quantitative 154 real-time PCR (RT-qPCR) was performed using SYBR Green dye-based assay in a 155

QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) with the following reaction 156 conditions: initial denaturation at 95°C for 7 min, 40 cycles of 95°C for 10 s and 60°C for 30 157 s, and melting curve analysis at 60°C for 30 s. Reactions were performed in triplicates (n=3). 158

Primer sequences are provided in Table 1 . The comparative threshold (ΔΔCT) method was 159 used for relative quantification. The mRNA levels of target genes were normalized with the 160 housekeeping GAPDH gene and represented as the relative fold change values compared to 161 their respective mock-infected controls. 162 Table 1 . Primer sequence for detection of gene expression by RT-qPCR 163 164 Western blotting. Brain tissues (30 mg) were harvested from mice following 165 transcardial PBS perfusion and flash-frozen in liquid N2. Tissues were homogenized (thrice 166 for 30s at medium speed using Qiagen TissueRuptor II) and lysed in 500 uL of RIPA buffer 167 [50mM Tris Base (pH 7.6), 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.5% Sodium 168 deoxycholate] containing protease-cocktail inhibitor and phosphatase inhibitors (1 mM 169 NaVO4 and 10 mM NaF) for 1 hr 30 mins with intermittent vortex every 15 mins. The 170 samples were kept on ice during the entire process. Samples were then centrifuged for 15 171 supernatant was determined with a BCA protein assay kit. For immunoblotting, 20-60 µg of 173 total protein per sample was resolved by SDS-PAGE on a 12% polyacrylamide gel, then 174 transferred onto PVDF membranes using transfer buffer (25 mM Tris, 192 mM glycine, and 175 20% methanol). Membranes were blocked for 1 hr at room temperature either in 5% v/v goat 176 serum or skimmed milk prepared in TBST (Tris-buffered saline containing 0.1% v/v Tween 177 20) and subsequently incubated overnight at 4°C in polyclonal anti-mouse TIMP-1 or 178 polyclonal anti-mouse MMP-8 antibody at 1:1000 dilution in blocking solution respectively. 179

The membranes were washed in TBST and incubated for 1 hr at room temperature with HRP-180 conjugated donkey anti-goat or goat anti-rabbit secondary IgG antibody. As an internal 181 loading control, γ-actin or β-tubulin was used, and membranes were blocked separately in 182 5% w/v non-fat skimmed milk in TBST. Polyclonal anti-mouse γ-actin or β-tubulin antibody 183

(1:2000 dilution) and HRP-conjugated goat anti-rabbit secondary IgG antibody (1:10,000 184 dilution) were used. The blots were washed in TBST, and the immunoreactive bands were 185 visualized using the chemiluminescent HRP substrate. Non-saturated bands were visualized 186 with Syngene G: box Chemidoc system using GENSys Software. 187

Biological network analyses. The list of MMP (Mmp-2, -3, -8, -12, -14) and TIMP 188 Unpaired student t-test was performed to examine significant differences between the two 207 groups. Multiple comparisons were achieved using ordinary one-way ANOVA, followed by 208 Dunnett's multiple comparison test. A p-value < 0.05 was considered statistically significant. 209

Availability of data. All the data sets used and analyzed in the current study are 210 available from the corresponding author on request. 211

Four weeks old, male C57BL/6 mice inoculated with MHV-A59 (2000 PFU) or mock-214 infected were euthanized at 5-6 (acute), 10 (acute-chronic), and 15 (chronic) days post-215 infection (d.p.i), and brains were harvested. Routine plaque assay was performed with serially 216 diluted brain homogenates to determine viral replication. Viral titer was significantly 217 different in infected mice compared to mock between 5-6 d.p.i. (Fig. 1A; p<0 .001) and viral 218 plaques were below the detection limit at later time points (data not shown). Total RNA was 219 isolated from mock and virus-infected brain tissues to analyze viral nucleocapsid and Mmp 220 genes through RT-qPCR. Primer sequences are provided in Table 1 insignificant compared with mock brain lysates (Fig. 1, J) . 236 

Tissue inhibitors of metalloproteinases or TIMPs are endogenous protein regulators of 257 MMPs (38). To understand the regulation of MMPs upon MHV-A59 infection, we also 258 considered the mRNA expression of TIMPs. As described above, total RNA from brain 259 samples of mock and MHV-A59 infected mice were subjected to RT-qPCR using specific 260 primers (Table 1) 

To with an immune response, such as leukocyte extravasation signaling, granulocyte, and 361 agranulocyte adhesion and diapedesis. IPA revealed that MMPs could facilitate the 362 transmigration of firmly adhered granulocytes (Fig. 5, A) and agranulocytes (Fig. 5, B) across 363 the endothelial cells in the blood vessel. IPA results suggested a possible relationship between infected mice did not show significant differences in the number of CD45 hi and CD45 lo 397 populations (Fig. 6, A-D) . The m--CoV-RSA59 infected mice showed higher infiltrating 398 CD45 hi in the brain at 5 d.p.i than age-matched naïve and mock-infected mice (Fig. 6, E and  399 

infected with m--CoV-RSA59 exhibited a significant increase in all three lymphocyte 403 populations at 5 d.p.i compared with naïve/mock-infected samples (Fig. 7) . 404

Staining with Ly6G to detect neutrophils revealed a significant increase in the cell number 405 in CD45 hi (Fig. 8 , A-C) and CD45 lo (Fig. 8, A, infection is known to increase ROS generation (52). We examined the effect of RSA59 459 infection on essential oxidative and antioxidative pathway genes. Brain samples from mice 460 infected with RSA59 and euthanized at 5-6 and 10 d.p.i were harvested for total RNA 461 isolation, followed by cDNA synthesis. Mock-infected samples were used as controls. RT-462 qPCR was performed using primers (Table 1) (Fig. 9 , A; p varies as <0.05 to <0.001). RelA, an NF-κB subunit, also showed 468 elevated mRNA levels during the acute infection, i.e., 5-6 d.p.i (Fig. 9, B; p<0.0001 ). On the 469 contrary, mRNA levels of Nfb2, a negative regulatory subunit of NF-B, remained 470 unchanged post-infection (Fig. 9, C) . Similar to a recently published paper(62), we also 471 detected significantly high mRNA levels of nuclear factor erythroid 2-related factor 2 (Nrf2) 472 and heme oxygenase-1 (Hmox1) genes during the acute disease phase in the context of MMP 473 expression (Fig. 9 The present work suggests that Timp1 upregulation could be part of a classical host defense 537 mechanism against virus-induced upregulation of different metalloproteases. Whether the 538 downregulation of Timp2, Timp3, and Timp4 is mediated by MHV or a feedback mechanism 539 exists to maintain a balance among different TIMPs is an exciting aspect to address. (72, 73) . Therefore, our result suggests that Park7 mediated ROS 562 generation could lead to the induction of MMP genes via NF-B signaling during MHV-563 induced acute disease (Fig. 10) . 564

We also found that m--CoV-RSA59 infection-induced upregulation of Nrf2 and 565 Hmox1 genes. The antioxidative pathway mediated by nuclear factor erythroid 2-related 566 factor 2 (Nrf2) and its dependant heme oxygenase-1 (Hmox1) (74) could therefore play an 567 important role in restoring homeostasis through inhibition of ROS overproduction. One 568 limitation of this study that will be addressed in our future experiments is that the connection 569 between ROS and MMPs has not been validated using inhibitors of ROS as positive controls. 

The transcription factor NF-kB can induce many inflammation-related genes, including MMPs. Additionally, 580 m--CoV-RSA59 infection increased mRNAs of nuclear factor erythroid 2-related factor 2 (Nrf2) and its 581 dependant heme oxygenase-1 (Hmox1) genes that are involved in the antioxidative pathway. The numbers 582 indicate mRNA fold-change and its regulation (up or down) as detected in RT-qPCR in Fig. 6 . Further, elevated 583 levels of Timp1 provide for a host homeostatic mechanism to regulate the activities of upregulated MMPs. 

CoV-2) Outbreak: Recent Advances, Prevention, and Treatment. International journal of environmental 620 research and public health

Genomic characterisation and epidemiology of 2019 622 novel coronavirus: implications for virus origins and receptor binding

Coronavirus as a possible cause of severe acute 625 respiratory syndrome

Characterization of a novel 628 coronavirus associated with severe acute respiratory syndrome

Identification of a novel 631 coronavirus in patients with severe acute respiratory syndrome. The New England journal of medicine

Isolation of a novel coronavirus 634 from a man with pneumonia in Saudi Arabia. The New England journal of medicine

Clinical features and 637 virological analysis of a case of Middle East respiratory syndrome coronavirus infection. The Lancet Infectious 638 diseases

From SARS to MERS: 10 years of research on highly pathogenic human 640 coronaviruses. Antiviral research

Nidovirales: evolving the largest RNA virus genome

Virus research

Coronaviruses post-SARS: update on replication and pathogenesis. Nature reviews and pathology of matrix metalloproteinases. Critical reviews in biochemistry and molecular biology

Structure and function of matrix metalloproteinases and TIMPs

Cardiovascular research

Matrix Metalloproteases as Influencers of the Cells' Social Media. 704 International journal of molecular sciences

Chemokine and cytokine processing by matrix metalloproteinases and its effect on 707 leukocyte migration and inflammation

Matrix metalloproteinases and their pathological 710 upregulation in multiple sclerosis: an overview

Elevation of matrix metalloproteinases 713 (MMPs) in multiple sclerosis and impact of immunomodulators

Levels and Systemic Lupus Erythematosus: A Meta-analysis. Disease markers

Elevated serum levels of MMP-2, MMP-3, and 719 MMP-13 in Chinese patients with systemic lupus erythematosus

Metalloproteinases in Alzheimer's Disease and Concurrent Cerebral Microbleeds

Matrix metalloproteinases and their multiple roles in Alzheimer's 725 disease

Tissue inhibitors of metalloproteinases

Pathogenesis of murine coronavirus in the central nervous system

Coronavirus infection of the central nervous system: host-virus 748 stand-off

Experimental demyelination produced by the 751 A59 strain of mouse hepatitis virus

A mechanism of virus-induced demyelination. Interdisciplinary perspectives on infectious 753 diseases

Experimental optic neuritis induced by a 755 demyelinating strain of mouse hepatitis virus

Demyelinating and 758 nondemyelinating strains of mouse hepatitis virus differ in their neural cell tropism

Mechanisms of primary axonal damage in a viral 761 model of multiple sclerosis. The Journal of neuroscience : the official journal of the Society for Neuroscience

Cleavage inhibition of the murine coronavirus 764 spike protein by a furin-like enzyme affects cell-cell but not virus-cell fusion

Innate-adaptive immunity interplay and redox 767 regulation in immune response

Demyelination determinants map to the spike glycoprotein 770 gene of coronavirus mouse hepatitis virus

Enhanced green fluorescent protein expression may 773 be used to monitor murine coronavirus spread in vitro and in the mouse central nervous system

Mouse hepatitis virus type-2 infection in mice: an experimental inflammation induced in virus and autoimmune-mediated models of multiple sclerosis in C57BL6 mice

A proline insertion-deletion 783 in the spike glycoprotein fusion peptide of mouse hepatitis virus strongly alters neuropathology

CD4 Deficiency Causes Poliomyelitis 787 and Axonal Blebbing in Murine Coronavirus-Induced Neuroinflammation

Ifit2 deficiency restricts 790 microglial activation and leukocyte migration following murine coronavirus (m-CoV) CNS infection. PLoS 791 pathogens

Fine Tuning the Cytokine Storm by IFN and IL-10 Following Neurotropic 793

Myd88 Initiates Early

Innate Immune Responses and Promotes CD4 T Cells during Coronavirus Encephalomyelitis

DJ-1-Nrf2 axis is activated 799 upon murine beta-coronavirus infection in the CNS. Brain disorders

West Nile virus entry into the brain

Dengue-virus-infected 805 dendritic cells trigger vascular leakage through metalloproteinase overproduction

Matrix metalloproteinase-9 in pneumococcal meningitis: activation via an 821 oxidative pathway

NF-kappaB in Oxidative Stress

Transcriptional regulation via the NF-kappaB signaling module

Hypoxia induces connexin 43 dysregulation by modulating matrix 827 metalloproteinases via MAPK signaling

Inhibition of transcription factor NF-kappaB reduces matrix 830 metalloproteinase-1, -3 and -9 production by vascular smooth muscle cells

Role of Nrf2/HO-1 system in development

a Primer sequences given in 5' to 3' direction. All primers purchased from IDT, USA. Mmp2, Mmp9 and Park7 primers were purchased from RealTimePrimers.com, USA. b GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Forward primer a Reverse primer aGCCCCACCAAGTTCAAACAGCTCTA CTCTGTCAGCATCACCTGCAGC J o u r n a l P r e -p r o o f