key: cord-0865893-7tw516sc
authors: Huang, Hanxia; Dabrazhynetskaya, Alena; Pluznik, Jacob; Zheng, Jiwen; Wu, Yong; Chizhikov, Vladimir; Buehler, Paul W.; Yamada, Kenneth M.; Dhawan, Subhash
title: Hemin activation abrogates Mycoplasma hyorhinis replication in chronically infected prostate cancer cells via heme oxygenase‐1 induction
date: 2021-09-09
journal: FEBS Open Bio
DOI: 10.1002/2211-5463.13271
sha: 3942027cd8797d88b1d3ec70dd4a3207aa16f410
doc_id: 865893
cord_uid: 7tw516sc

Mycoplasma hyorhinis (M. hyorhinis) lacks a cell wall and resists multiple antibiotics. We describe here the striking > 90% inhibitory effect of hemin, a natural inducer of the cytoprotective enzyme heme oxygenase‐1 (HO‐1), on M. hyorhinis replication in chronically infected LNCaP prostate cancer cells. The role of HO‐1 in interrupting M. hyorhinis replication was confirmed by HO‐1‐specific siRNA suppression of hemin‐induced HO‐1 protein expression, which increased intracellular M. hyorhinis DNA levels in LNCaP cells. Proteomic analysis and transmission electron microscopy of hemin‐treated cells confirmed the complete absence of M. hyorhinis proteins and intact microorganisms, respectively, strongly supporting these findings. Our study is the first to our knowledge suggesting therapeutic potential for activated HO‐1 in cellular innate responses against mycoplasma infection.

treatment of infected individuals. Mycoplasmas are well known as laboratory contaminant of various cells and tissue cultures [3] that can alter experimental results.

Mycoplasma hyorhinis (M. hyorhinis), first identified in swine in 1962, can cause respiratory tract infections, arthritis, and inflammation of the abdominal cavity [4] . Recent studies indicate a potential link between mycoplasma infection and several human cancers, such as prostate, gastric, and ovarian cancer [5] [6] [7] [8] [9] [10] . In particular, M. hyorhinis infection with its increased antibody titer and elevated prostate-specific antigen (PSA) levels is reported to result in malignant changes in benign human prostate cells [11, 12] . An increased rate of seropositivity to mycoplasma, especially M. hyorhinis, in men with prostate cancer (52%) compared to those with benign prostate hyperplasia (36%) further suggests a link between M. hyorhinis infection of normal prostatic tissue and risk of a prostate cancer [13] .

Mycoplasmas are self-replicating organisms with the smallest genomes, containing a total of about 500-1000 genes [14] . Due to their extremely basic genome and metabolic dependence, mycoplasmas function as parasites for their survival [15] . Most mycoplasmas reside on the surface of cells; however, certain species of mycoplasma, including M. pneumonia and M. hyorhinis, invade cells and cause disease or promote disease progression [16] [17] [18] . Invading mycoplasmas subvert host protective responses for replication and cellular transformation, impacting cellular functions for rapid disease progression.

Association of M. hyorhinis with various cancers pose a significant challenge to drug therapy. Since antibiotics are largely ineffective for treating intracellular mycoplasma infections, augmentation of the cellular defense response presents an alternative approach for targeting mycoplasma replication. Recent studies from our and other laboratories have demonstrated the involvement of inducible HO-1 in the innate host defense mechanism against a wide variety of infections [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] . In the present study, we tested whether the induction of HO-1 would also limit the replication of the prokaryote, M. hyorhinis in mycoplasma-infected cells. We found that HO-1 induction by its natural substrate hemin dramatically reduced M. hyorhinis replication in chronically infected LNCaP prostate cancer cells, further demonstrating a pivotal role for this endogenous cytoprotective enzyme in the host defense mechanism against invading pathogens.

LNCaP cells were obtained from the American Type Culture Collection (Manassas, VA) and were maintained at 37°C in a humidified incubator with a 5% CO 2 /95% air atmosphere in RPMI 1640 supplemented with 10% FCS. These cells were subsequently found positive for M. hyorhinis. SYBR Green RT-PCR MasterMix was obtained from Qiagen (Valencia, CA, USA). The FDA-approved drug Panhematin Ò , containing hemin as the active component, was purchased from Lundbeck, Deerfield, IL (manufactured by APP Pharmaceuticals, Raleigh, NC, USA). Small interfering RNA (siRNA) targeting human HO-1coding sequences (Hs_HMOX1_1 and Hs_HMOX_10) and AllStars Negative Control siRNA were from Qiagen. All other experimental components were of reagent grade.

Total genomic DNA was extracted from LNCaP cells using the Qiagen DNA isolation kit (Qiagen, Valencia, CA, USA) according to the manufacturer's protocol. The DNA pellet was resuspended in 30 lL of DNAse-free distilled water and stored at À20°C. The quality of DNA was assessed by Agilent Bioanalyzer (Santa Clara, CA, USA).

Real-time PCR amplification of M. hyorhinis in the total genomic DNA was performed using QuantiTect SYBR Green PCR kit (Qiagen) with HotStar Taq Ò DNA polymerase and SYBR Green I fluorescent dye according to the manufacturer's protocol, and universal mycoplasma primers 5 0 -GGCGAATGGGTGAGTAACACG-3 0 (forward) and 5 0 -GGATAACGCTTGCGACCTATG-3 0 (reverse) as described previously [30] . Briefly, each 50 lL reaction contained of 25 lL of 2X SYBR Green PCR Master Mix, ≤ 0.5 µg DNA template, 0.5 lM of forward primer, 0.5 lM of reverse primer. Amplification was performed in an Applied Biosystems 7500 real-time PCR or Applied Biosystems QuantStudio 6 Flex system at the following conditions: 1st step-DNA denaturation and Taq polymerase activation at 95°C for 15 min.; 2nd step-40 cycles of denaturation at 95°C for 15 s., annealing at 60°C for 30 s and elongation at 72°C for 1 min; 3rd step-final elongation at 72°C for 5 min; and 4th step-dissociation curve analyses for obtained PCR products. The number of M. hyorhinis genomic copies was calculated based on comparison of the Ct values with standard curves generated from the purified known copy numbers of M. hyorhinis DNA.

LNCaP cells chronically infected with M. hyorhinis were first cultured for 24 h in the absence or presence of 100 lM hemin followed by replacing the media with serum-free media lacking hemin and then culturing cells for an additional 24 h. M. hyorhinis DNA was amplified directly from 5 lL of the culture supernatants without DNA extraction. The number of M. hyorhinis copies was calculated based on comparison of the Ct values with standard curves generated from M. hyorhinis DNA template (BTS-7 strain) as described above. All qPCRs, including standards, were performed in duplicate.

LNCaP cells cultured for 48 h in the absence or presence of antibiotics and hemin at the desired concentrations. Total number of cells were quantified microscopically, and the cell viability was determined by trypan blue exclusion test.

Small interfering RNAs (siRNAs) targeting human HO-1coding sequences (Hs_HMOX1_1 and Hs_HMOX_10) were purchased from Qiagen. Although the sequences of these siRNAs are proprietary for Qiagen, the corresponding target nucleotide sequence for siRNA Hs_HMOX1_1 (catalog number: SI00033089) is CACCAAGTTCAAGCAGCTCTA and that for siRNA Hs_HMOX1_10 (catalog number: SI04435354) is CAAGACTGCGTTCCTGCTCAA, respectively. AllStars Negative Control siRNA (Qiagen) was used as the nontargeted siRNA control. LNCaP cells were seeded in 6-well culture plates for transfection and incubated with 50 nM control or HO-1 siRNA for 6 h in serum-free OPTI-MEM media following the manufacturer's transfection instructions using LipofectamineÒ RNAiMAX (Invitrogen, Carlsbad, CA, USA). The cells were then treated with 100 lM hemin. The efficiency of HO-1 knockdown was assessed by western blot analysis. The level of M. hyorhinis DNA was quantified by real-time PCR using universal mycoplasma primers as described above.

HO-1 induction in LNCaP cells was determined by western blot. Briefly, cells cultured in 6-well plates were pretreated for 24 h with various concentrations of hemin ranging from 0 to 100 lM, and HO-1 induction was determined by western blot. Briefly, total cell protein extracts were prepared in modified RIPA buffer (50 mM Tris/HCl, 1% NP-40, 0.25% deoxycholic acid, 150 mM NaCl, 1 mM EGTA, 1 mM sodium orthovanadate and 1 mM sodium fluoride with protease inhibitors (Roche Applied Science, Mannheim, Germany) and phosphatase inhibitors (Sigma-Aldrich, St. Louis, MO, USA) and quantified using the Pierce BCA protein assay. Total protein (2.5-5 lg) was resoled on a 12% Tris-glycine SDS/PAGE gel. After transfer to a PVDF membrane (Millipore, Burlington, MA, USA), immunoblots of whole cell lysates from untreated and hemintreated LNCaP cells were analyzed using a cocktail of mouse monoclonal anti-HO-1 IgG (Catalog # ADI-OSA-110; Enzo Life Sciences, Farmingdale, NY, USA) and polyclonal rabbit anti-actin (Catalog # ab8227; abcam, Cambridge, MA, USA) antibodies. The blots were washed and then placed in a cocktail of secondary HRP-conjugated anti-mouse (Catalog # NA 931V) and anti-rabbit IgG (Catalog #NA 934V; GE Healthcare, formerly Amersham) each diluted 1:2000 in 2% nonfat dry milk in Tris-Tween-buffered saline (TTBS) for two hours and rinsed 4 times for 10 min in TTBS. The HO-1 protein (32 kDa) and actin (42 kDa) bands were visualized using the ECLÒ (enhanced chemiluminescence) detection system (GE Healthcare, Chicago, IL, USA), and exposed to X-ray film.

Proteomic analysis (2-DIGE) and mass spectrometric identification of proteins from untreated and hemin-treated LNCaP cells were performed by Applied Biomics, Inc. (Hayward, CA, USA) as described below.

LNCaP cells that were untreated (control) or treated for 48 h at 37°C with 100 lM hemin were washed three times with cold PBS, gently scraped off the dish, centrifuged at 200 g, and resuspended in 100 lL of 2-D cell lysis buffer (Applied Biomics) and then stored at À80°C until sending to Applied Biomics on dry ice for proteomics analysis. Briefly, 2-D cell lysis buffer (30 mM Tris/HCl, pH 8.8, containing 7 M urea, 2 M thiourea and 4% CHAPS) was added to the collected cell pellets, sonicated on ice, followed by gentle shaking on a shaker for 30 min at room temperature. The total protein lysates were centrifuged at 25 000g for 30 min at 4°C, and supernatants were collected. Protein assays were performed using the Bio-Rad protein assay method. Lysate were diluted with the 2-D cell lysis buffer to adjust the final protein concentration to 6 mg/mL.

To 30 lg of protein lysate, 1.0 lL of diluted CyDye (1:5 diluted with DMF from 1 nmol/lL stock) was added and mixed thoroughly, and then, the tube was placed in the dark on ice for 30 min. 1.0 lL of 10 mM lysine was added to each of the samples and vortexed, and the reaction mixture was maintained in the dark on ice for an additional 15 min. Samples were labeled with Cy2, Cy3, and Cy5 dyes and diluted with equal volumes of 2-D sample buffer (8 M urea, 4% CHAPS, 20 mg/mL DTT, 2% Pharmalytes and trace amount of bromophenol blue). 100 lL destreak solution and rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 20 mg/mL DTT, 1% Pharmalytes and trace amount of bromophenol blue) were added to a final volume of 250 lL for the 13 cm IPG strip. The sample mixture was thoroughly mixed, centrifuged to clarify the solution, and equal amounts (30 lg) of protein were loaded onto the strip holder.

After loading the labeled samples onto the strip holder, the 13 cm strip was placed facing downward, and 1 mL mineral oil was added on the top of the strip. The IEF was run in dark at 20°C following the GE BioSciences protocol. At the end of the IEF run, the IPG strips were incubated in freshly prepared equilibration buffer #1 (50 mM Tris/HCl, pH 8.8, containing 6 M urea, 30% glycerol, 2% SDS, trace amount of bromophenol blue and 10 mg/mL DTT) for 15 min with gentle shaking. The strips were then rinsed in freshly prepared equilibration buffer #2 (50 mM Tris/HCl, pH 8.8, containing 6 M urea, 30% glycerol, 2% SDS, trace amount of bromophenol blue and 45 mg/mL iodoacetamide) for 10 min with gentle shaking. The IPG strips were then rinsed once in the SDS-gel running buffer before transferred onto the SDS/PAGE (12% SDS-gel prepared using low florescent glass plates) and sealed with 0.5% (w/v) agarose solution (in SDS-gel running buffer). The SDS/PAGE was run at 15°C until the dye front ran out of the gels.

Image scans were carried out immediately following the SDS/PAGE using Typhoon TRIO (GE Healthcare) following the manufacturer's protocols. The scanned images were analyzed by Image QuantTL software (GE Healthcare), and then, in-gel analysis and cross-gel analysis was performed using DeCyder software version 6.5 (GE Healthcare). The ratio change of the protein differential expression was obtained from in-gel DeCyder software analysis.

The spots of interest were picked up using the Ettan Spot Picker (GE Healthcare) based on the in-gel analysis and spot picking design by DeCyder software. The gel spots were washed several times and digested in-gel with modified porcine trypsin protease (Trypsin Gold, Promega). The digested tryptic peptides were desalted by Zip-tip C18 (Millipore). Peptides were eluted from the Zip-tip with 0.5 lL of matrix solution (a-cyano-4-hydroxycinnamic acid, 5 mg/ mL in 50% acetonitrile, 0.1% trifluoroacetic acid, 25 mM ammonium bicarbonate) and spotted on the MALDI plate.

MALDI-TOF (MS) and TOF/TOF (tandem MS/MS) were performed on a 5800 mass-spectrometer (AB Sciex). MALDI-TOF mass spectra were acquired in reflectron positive ion mode, averaging 2000 laser shots per spectrum. TOF/TOF tandem MS fragmentation spectra were acquired for each sample, averaging 2000 laser shots per fragmentation spectrum on each of the 5-10 most abundant ions present in each sample (excluding trypsin autolytic peptides and other known background ions).

Both the resulting peptide mass and the associated fragmentation spectra were submitted to GPS Explorer version 3.5 equipped with the MASCOT search engine (Matrix Science) to search the database of the National Center for Biotechnology Information nonredundant (NCBInr) or Swiss Protein database. Searches were performed without constraining protein molecular weight or isoelectric point, with variable carbamidomethylation of cysteine and oxidation of methionine residues, and with one missed cleavage allowed in the search parameters. Candidates with either protein score CI % or ion CI% > 95 were considered significant.

LNCaP cells cultured for 48 h in the absence or presence of 100 lM hemin were washed 3 times with PBS, fixed in freshly prepared 2.5% glutaraldehyde/formaldehyde in cacodylate buffer for 2 h, and rinsed with 0.2 M cacodylate buffer three times for 10 min each. The cells were then fixed and stained with 1.0% osmium tetroxide in 0.2 M cacodylate buffer for 1 h. After staining, the cells were rinsed with cacodylate buffer three times for 10 min each and then with deionized water twice for 10 min each. The cells were dehydrated through an increasing ethanol series (50% ethanol, 70% ethanol, 90% ethanol, and finally 100% ethanol) for 10 min each time. Embedding resin was prepared by mixing Epon 812, DDSA, NMA, and DMP30 (Electron Microscopy Sciences, Hatfield, PA, USA) as previously described [31] . The cells were transferred to resin:acetonitrile (50:50 mixture) for 1 h to allow resin to penetrate into cells. The resin/acetonitrile mixture was then replaced with 100% resin, which was allowed to infiltrate into cells overnight. The cells and resin were finally transferred to beam capsules and placed in a 55°C oven for 48 h until the resin hardened. The resin blocks were first trimmed, and then, thin sections (80 nm thickness) of cells were cut using an ultramicrotome (Leica Microanalysis, Buffalo Grove, IL, USA) and placed onto 200-mesh formvar/carbon-coated copper transmission electron microscopy (TEM) grids (Electron Microscopy Sciences, Hatfield, PA, USA). The TEM grids were stained with 0.5% uranyl acetate staining to enhance contrast prior to TEM imaging.

Student t-test was used for statistical analysis presenting two-tail P values. 

Using universal mycoplasma primers, we performed real-time PCR amplification of total DNA isolated from LNCaP cells chronically infected with M. hyorhinis. To quantify M. hyorhinis by real-time PCR, we first generated a standard curve by amplifying DNA isolated from the BTS-7 strain of M. hyorhinis. We calculated the copy numbers from the respective DNA molar concentrations. Figure 1A shows a representative M. hyorhinis standard curve with linearity between the amplification threshold values (Ct) at varying Log 10 M. hyorhinis copy numbers over a broad linear dynamic range with an R 2 value of nearly 1.0. We used this standard curve to convert the Ct values into M. hyorhinis copy numbers in the infected cells by amplifying known amounts of isolated genomic DNA. (Fig. 1B) . Western blot analysis of total protein isolated from these cells established the induction of HO-1 in a concentration-dependent manner without altered expression of the housekeeping protein actin (Fig. 1C) . Since hemin-induced maximal HO-1 expression at 100 lM hemin without causing cytotoxicity, this concentration was used in subsequent experiments.

To determine the earliest time point for reduced M. hyorhinis replication, LNCaP cells were cultured in the presence of 100 lM hemin and M. hyorhinis was quantified by real-time PCR of total cellular DNA at the indicated times. As shown in Fig. 1D , hemin treatment profoundly inhibited intracellular M. hyorhinis DNA levels within 10 h to nearly undetectable levels after 48 h.

LNCaP cells were cultured at 37°C for 48 h in the absence or presence of penicillin/ streptomycin and gentamicin at the concentration of 10 lg/mL and 100 lM hemin. The cells were then examined for intracellular M. hyorhinis DNA level, cell growth, and cytotoxicity. As shown in Fig. 2A , intracellular M. hyorhinis DNA levels in LNCaP cells cultured in the presence of penicillin/streptomycin and gentamicin were similar to those cultured in the absence of these antibiotics with approximately 22% reduction in cells cultured in the presence of gentamicin. However, the level of M. hyorhinis DNA in LNCaP cells cultured in the presence of hemin was nearly undetectable. Although hemin treatment partially retarded the growth of LNCaP cells by~25% (Fig. 2B) and was not cytotoxic (Fig. 2C) , it inhibited intracellular M. hyorhinis DNA levels by greater than 90% (as shown in Fig. 2A ), indicative of a marked reduction of M. hyorhinis replication in hemin-treated LNCaP cells.

To confirm that the reduced M. hyorhinis replication is mediated by HO-1, LNCaP cells were transfected with siRNA specific to HO-1 prior to culturing in the presence of 100 lM hemin for 48 h. HO-1 protein expression was determined by western blot analysis, and the level of M. hyorhinis DNA was quantified by real-time PCR. Silencing of HO-1 substantially reduced its intracellular expression (Fig. 3A) , and transfection with HO-1-specific siRNA substantially diminished the protective effect of hemin against M. hyorhinis infection (Fig. 3B) . Transfection of cells with control siRNA did not significantly affect either HO-1 induction or M. hyorhinis replication. To determine the level of cellfree production of M. hyorhinis, cells were first cultured for 24 h in the absence or presence of 100 lM hemin followed by replacing the media with serum-free media lacking hemin and then culturing cells for an additional 24 h. M. hyorhinis DNA was amplified directly from 5 lL of the culture supernatants without DNA extraction. The data from this experiment showed the pattern of cell-free M. hyorhinis copy numbers to be identical to that observed for cell-associated M. hyorhinis, indicating the active production of extracellular mycoplasma by the infected cells (Fig. 3C ).

To determine the proteomic patterns associated with the protective role of hemin against M. hyorhinis infection, we performed 2-D electrophoresis on equal amounts of total protein isolated from untreated M. hyorhinisinfected and hemin-treated M. hyorhinis-infected LNCaP cells. We labeled the proteins from these cells with Cy3 and Cy5, respectively, and compared protein profiles of hemin-treated LNCaP cells with the untreated cells to examine for hemin-induced altered protein expression. We found a number of M. hyorhinis proteins present in whole cell lysates isolated from the infected cells cultured in the absence of hemin (shown in green, Fig. 4A ). Two proteins (spot numbers 36 and 42) induced by hemin and shown in red were observed at low levels. However, due to their low fluorescence intensities, these spots did not meet the cutoff for mass spectrometry protein identification selection. Figure 4B shows the pattern of differentially regulated cellular proteins in LNCaP cells cultured in the presence of hemin. As shown in this figure, the expression of all M. hyorhinis proteins present in the infected cells was dramatically reduced in hemin-treated cells (shown in red, Fig. 4B ). The profile of unchanged protein expression is shown in yellow. The mass spectrometric analysis performed on the differentially regulated proteins revealed that all identified spots represented various M. hyorhinis proteins (Table 1) .

Ultrastructural examination of M. hyorhinis -infected cells revealed a large number of mature microorganisms with ovoid to round electron-dense structures inside of endosomal vacuoles as shown in the region marked by a black circle and at higher magnification in the white inset of Figure 5A . The diameter of the microorganisms ranged from 0.25 lm to 0.8 lm with an average diameter of approximately 0.36 lm. The observed size of M. hyorhinis is consistent with the known size of mycoplasma-spheres of 0.35 lm to 0.50 lm in diameter and rod-or dumbbell-shaped forms up to 1.5 lm in length [32] . Also, the images of infected cells are in agreement with a previously published study by Kornspan et al. reporting electrondense structures in M. hyorhinis -infected melanoma cells [17] . Interestingly, such structures were absent from the LNCaP cells cultured for 48 h in the presence of 100 lM hemin (Fig. 5B) . The intracellular debris observed in hemin-treated cells were consistent with inactivated mycoplasma by hemin treatment. These observations are consistent with the hemin-induced dramatic reduction of M. hyorhinis replication as described above and further suggest HO-1 activated intracellular mediators that disrupt M. hyorhinis.

The lack of rigid wall around mycoplasmas, ability to hide inside of cells, and resistance to antibiotics, such as penicillin and streptomycin, often pose extremely difficult challenges to treat chronic mycoplasma infections and attenuate disease progression. In addition, dysregulation of numerous host genes for their survival could further complicate conventional clinical interventions for treating chronic infections [16, 33, 34] . Therefore, new host-targeted therapeutic approaches, essential for their eradication need to be developed and evaluated. The involvement of HO-1 by hemin and other inducers in mediating cellular resistance to a broad range of infections has now been established for more than a decade [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] , and more recently also in reducing SARS-CoV-2 protein expression in HO-1induced Vero cells [ Fig. 2H in Ref. 35 ]. Specifically, the data shown in Fig. 2H of Olagnier et al. [35] showed partial yet significant reversal of the suppressed HO-1 expression in SARS-CoV-2-infected cells by NRF2 agonists 4-octyl-itaconate (4-OI) and dimethyl fumarate (DMF) while simultaneously inhibiting SARS-CoV-2 replication in Vero cells, indicating restoration of the inducible HO-1-dependent host protection mechanism. The classical Nrf2dependent cellular HO-1 activation pathway has been known for nearly two decades [36] [37] [38] [39] ; therefore, partial restoration of HO-1 expression by NRF2 agonists 4-OI and DMF correlating with reduced SARS-CoV-2 protein expression, as shown in Fig. 2H of Olagnier et al. [35] , suggests involvement of HO-1, at least in part, in an Nrf2-HO-1 activation pathway.

While the role of HO-1 in suppressing virus replication has been widely accepted, its involvement of HO-1 in regulation of mycoplasma infection of eukaryotic cells has thus far remained unexplored. In the present study, we aimed to determine the involvement of HO-1 in suppression of M. hyorhinis replication in chronically infected prostate cancer cells. We used the physiological HO-1 inducer hemin in our studies. We found a remarkable reduction of intracellular mycoplasma DNA levels, absence of M. hyorhinis-related proteins by proteomic analysis, and no evidence of intracellular mature microorganism, in hemin-treated LNCaP cells chronically infected with M. hyorhinis.

Our study is the first to our knowledge that demonstrates the HO-1-dependent inhibition of M. hyorhinis replication in prostate cancer cells, providing evidence for an HO-1-mediated cellular protective response as a pivotal host defense mechanism against this cell invading pathogen. Further evidence for the involvement of HO-1 was confirmed by silencing of HO-1 gene expression by siRNA transfection which partially yet significantly diminished the protective effect of hemin against M. hyorhinis replication. Since HO-1 protein expression in HO-1 siRNA-transfected LNCaP cells was reduced by > 90% compared to a somewhat lower effect on M. hyorhinis replication (~30%-50%), possible involvement of HO-1-independent or HO-1 upstream gene regulatory pathways cannot be ruled out, which could be the subject of future studies. Nonetheless, our observations suggest that (a) HO-1 induction is important for the inhibitory effects on M. hyorhinis replication and (b) reduction of HO-1 expression directly correlates with the increased intracellular mycoplasma level. Our study presents HO-1 as a key mediator of hemin-induced host protective effects in LNCaP cells in addition to exhibiting lower cell proliferation. Although the precise postentry events associated with mycoplasma replication or cellular factors contributing to it are not clearly understood, circumventing host defense has been implicated in promoting its pathogenesis [40] . Importantly, numerous studies have documented altered host gene transcription by infectious mycoplasma or by mycoplasma p37 protein for promoting cell invasiveness and metastasis [41] [42] [43] [44] [45] [46] [47] [48] [49] . Therefore, restoring the host defense response may be crucial not only for inactivating the invaded mycoplasmas, or even perhaps interrupting the mycoplasma replication cycle, but also for reducing the severity of the disease pathogenesis.

In summary, our study demonstrates that the induction of cellular HO-1 protein expression is pivotal for the inhibitory effect of hemin on M. hyorhinis replication in chronically infected prostate LNCaP cancer cells. The reduced HO-1 expression in cells transfected with HO-1-specific siRNA proportional to increased M. hyorhinis replication provides strong evidence for HO-1 as a key mediator of hemin-induced HO-1 host protective response. Our experimental approach pointing to a putative role for the activation of the innate cellular mechanism in inducing host defense may provide an alternative therapeutic modality to further establish the concept of stimulated innate cellular response against invading pathogens, especially because hemin treatment is FDA-approved for acute intermittent porphyria. Accordingly, an effective pharmacological stimulation of HO-1 induction, a protein that is widely distributed in all tissues, may present an attractive therapeutic strategy for overcoming hurdles associated with antibiotic resistance to invading mycoplasmas. of the proteomics data. We are grateful to Dr. Viswanath Ragupathy and Dr. Jiangqin Zhao for critical review of the manuscript. We would like to acknowledge the FDA Advanced Characterization Facility for instrument use. This work was supported by FDA and NIDCR Intramural Research Programs.

The findings and conclusions in this article are the views of the authors and should not be construed to represent FDA's view or policies. The authors declare no conflict of interest.

The data that support the findings of this study are available in the figures and tables of this article.

Laboratory diagnosis of Mycoplasma pneumoniae infection

Mycoplasmas and their antibiotic resistance: The problems and prospects in controlling infections

Uses and standardization of vertebrate cell cultures

Influence of pasteurella multocida and mycoplasma hyorhinis (PPLO) on the histopathology of field case of swine pneumonia

Mycoplasmas and oncogenesis: persistent infection and multistage malignant transformation

Mycoplasma infections and different human carcinomas

Mycoplasma and cancer: in search of the link

Mycoplasma hyorhinis infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells

Mycoplasma hyorhinis: a potential risk factor in gastric cancer progression

Detection of mycoplasma hyorhinis infection in ovarian cancer with in situ hybridization and immunohistochemistry

Persistent exposure to Mycoplasma induces malignant transformation of human prostate cells

Association of Mycoplasma hominis infection with prostate cancer

Detection of antibodies directed at M. hyorhinis p37 in the serum of men with newly diagnosed prostate cancer

Molecular biology and pathogenicity of mycoplasmas

Beware of mycoplasmas

Interaction of mycoplasmas with host cells

Invasion of melanoma cells by Mycoplasma hyorhinis: enhancement by protease treatment

Factors influencing the cell adhesion and invasion capacity of Mycoplasma gallisepticum

Hemin activation ameliorates HIV-1 infection via heme oxygenase-1 induction

Heme oxygenase-1 and carbon monoxide suppress the pathogenesis of experimental cerebral malaria

Lipopolysaccharide suppresses HIV-1 replication in human monocytes by protein kinase C-dependent heme oxygenase-1 induction

ª 2021 The Authors. FEBS Open Bio published by John Wiley & Sons Ltd on behalf of Federation of

Antiviral activity and hepatoprotection by heme oxygenase-1 in hepatitis B virus infection

Heme oxygenase-1 affords protection against noncerebral forms of severe malaria

Iron increases HMOX1 and decreases hepatitis C viral expression in HCVexpressing cells

Heme and HO-1 Inhibition of HCV, HBV, and HIV

Heme oxygenase-1-mediated host cell response inhibits the susceptibility of prostate cancer cells to retroviral infection and retards their proliferation

Heme oxygenase-1 induction alters chemokine regulation and ameliorates human immunodeficiency virus-type-1 infection in lipopolysaccharide-stimulated macrophages

The cytoprotective enzyme heme oxygenase-1 suppresses Ebola virus replication

Nrf2-dependent induction of innate host defense via heme oxygenase-1 inhibits Zika virus replication

Preparation of reference strains for validation and comparison of mycoplasma testing methods

Biological tissue and cell culture specimen preparation for TEM nanoparticle characterization

Effect of preparatory techniques on the gross morphology of Mycoplasma hominis

Subversion and exploitation of host cells by mycoplasmas

Host cell responses to persistent mycoplasmas-different stages in infection of HeLa cells with Mycoplasma hominis

SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate

Nrf2, a cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene

Nuclear heme oxygenase-1 (HO-1) modulates subcellular distribution and activation of Nrf2, impacting metabolic and anti-oxidant defenses

Role of Nfr2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism

Tolvaptan activates the Nrf2/HO-1 antioxidant pathway through PERK phosphorylation

Mycoplasmas-host interaction: mechanisms of inflammation and association with cellular transformation

from Mycoplasma hyorhinis promotes cancer cell invasiveness and metastasis through activation of MMP-2 and followed by phosphorylation of EGFR

Exogenous mycoplasmal p37 protein alters gene expression, growth and morphology of prostate cancer cells

The Mycoplasma hyorhinis p37 protein rapidly induces genes in fibroblasts associated with inflammation and cancer

Mycoplasma hyorhinis activates the NLRP3 inflammasome and promotes migration and invasion of gastric cancer cells

Induces tumor invasiveness

ª 2021 The Authors. FEBS Open Bio published by John Wiley & Sons Ltd on behalf of Federation of

Mycoplasma hyorhinis infection promotes NF-jB-dependent migration of gastric cancer cells

Mycoplasma infection transforms normal lung cells and induces bone morphogenetic protein 2 expression by post-transcriptional mechanisms

Mycoplasma infection alters cancer stem cell properties in Vitro

Mycoplasma hyorhinis induces epithelial-mesenchymal transition in gastric cancer cell MGC803 via TLR4-NF-jB signaling

ª 2021 The Authors. FEBS Open Bio published by John Wiley & Sons Ltd on behalf of Federation of

We thank Dr. John Liao for his assistance in performing proteomic experiments and for critical evaluation Author contribution SD, conceived, designed the study, acquired, analyzed, interpreted the data and wrote the paper; HH, AD, JP, JZ, and YW acquired, analyzed, interpreted the data and edited the paper; VC, PWB and KMY analyzed, interpreted the data, and edited the paper.