key: cord-0840578-vt81mfdh
authors: Iqbal, Bushran N; Arunasalam, Shiyamalee; Divarathna, Maduja V M; Jabeer, AAOM; Sirisena, PDNN; Senaratne, Thamarasi; Muthugala, Rohitha; Noordeen, Faseeha
title: Diagnostic utility and validation of a newly developed real time loop mediated isothermal amplification method for the detection of SARS CoV-2 infection
date: 2022-05-05
journal: J Clin Virol Plus
DOI: 10.1016/j.jcvp.2022.100081
sha: ad06c11c57345c825ada74dfd68ca7a118c1c5ac
doc_id: 840578
cord_uid: vt81mfdh

Background Detecting SARS-CoV-2 using a simple real time molecular assay will be helpful for the mitigation efforts in low / middle income countries during the pandemic. We have developed and validated a rapid and simple real time loop mediated isothermal amplification assay (LAMP) for screening of SARS-CoV-2 infection in known infected and non-infected individuals. Methods Six sets of primers were designed targeting the N-gene of the SARS-CoV-2 (Accession ID MN994468). LAMP reactions were performed using Warm Start 2X Master Mix and real-time PCR machine at 65°C for 60 cycles with 15 seconds for each cycle. Results were read by visualizing turbidity under ultraviolet light and real time fluorescence detection through FAM channel of the real time PCR machine. We tested a total of 320 including 240 SARS CoV-2 positive (Ct values <40) and 80 SARS CoV-2 negative samples as tested by a real time RT-PCR using the newly developed LAMP assay. Results A total of 206 out of 240 SARS CoV-2 positive samples were tested positive by the newly developed LAMP assay with a sensitivity of 86%. All 80 SARS CoV-2 negative samples were tested negative by the newly developed LAMP assay with a specificity of 100%. Conclusion The newly developed real time LAMP assay has a sensitivity of 86% and specificity of 100% compared to the real time RT-PCR for the detection of SARS CoV-2. The new assay will be useful to screen large number of samples if adopted to minimize the time and cost.

Covid-19 has posed unprecedented challenges to societies all over the world. It is a serious public health issue that requires simple diagnostic methods in detecting and preventing infections in different stages of the pandemic. The Covid-19 caused by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has been identified as the '20th century Spanish flu' affecting the whole world. In mitigating the efforts to combat, developing a rapid and costeffective diagnostic approach enabling the detection of the infection in the affected as well as asymptomatic individuals will be useful to assist preventive measures in resource limited settings. For the detection of SARS-CoV-2, the WHO and CDC recommend the use of nucleic acid based diagnostic methods, which are rapid and confirmatory (Gandhi et al., 2020) .

Detecting the SARS-CoV-2 infection is important to assist preventive measures in affected areas.

Numerous methods have been developed to detect SARS-CoV-2 infection and the commonly used method of laboratory diagnosis of Covid-19 is real time reverse transcription polymerase chain reaction (real time RT-PCR). Currently used real time RT-PCR assays have the advantage of accurate detection of the virus, however, the supply chain related issues and reporting time of more than 4 hours might have a negative impact on the mitigating efforts. Real time RT-PCR assays are not cost effective for resource limited countries to continue to use these assays for screening large community samples (Greene, 2020) . Reverse transcription-loop mediated isothermal amplification (RT-LAMP) has been widely studied as an alternative. RT-LAMP of genomic sequence of interest, is a rapid and cost-effective method for the detection of pathogens and it has been used for the detection of dengue virus and pathogenic leptospirae in resource limited settings (Chen et al., 2015; Lau et al., 2015; Suwancharoen et al., 2016) . This method can amplify DNA or RNA in a single isothermal reaction from a few copies of DNA to 10 9 in less than an hour under isothermal conditions and is highly specific and sensitive with a constant temperature between 60-65°C (Notomi et al., 2000; Teoh et al., 2013) . RT-LAMP assays use a "rolling hairpin" mechanism to allow amplification at a constant temperature using polymerase enzymes different from those used in PCR. This targeted isothermal nucleic acid amplification utilizes a combination of 4-6 primer sets and a DNA polymerase with high strand displacement activity to specifically replicate a region of DNA (Thompson and Lei, 2020; Jang et al., 2021) .

Since the emergence of Covid-19, multiple primer sets for the detection of SARS-CoV-2 for the RT-LAMP have been published and some have received emergency use authorization by the particularly at longer reaction times, limiting the sensitivity. This off-target amplification is problematic because LAMP reactions are commonly quantified using colorimetric dyes for a longer duration (Meagher et al., 2018; Coelho et al., 2021) . According to a recent study, frequency of testing and speed of reporting are more important than the assay sensitivity for reducing the transmission of the virus (Larremore et al., 2021) .

In this study, we report areal time RT-LAMP for detecting SARS-CoV-2. We developed, validated and made a simple cost analysis to promote the use of this real time RT-LAMP for the detection of SARS-CoV-2 in resource limited settings. This assay can be used to screen symptomatic Covid-19 suspected as well as asymptomatic exposed individuals.

Ethical approval for use of archived samples was requested from the Ethics Review Committee of the Faculty of Medicine, University of Peradeniya, Sri Lanka. The committee exempted the study as only the de-identified samples were used for the optimization and validation of the assay To estimate the sample size required for testing by the real time RT-LAMP assay, the following formula was used -S = Z 2 P(1-P)/d 2 . In here, 'P' is the percentage of the interested variable, and 'd' is the accepted level of error at 95% Confidence Interval (Lwanga et al., 1991) . The percentage of the interested variable for this study was considered as 24.5% based on the Covid-19 status in the country at the time of the study (Jeewandara et al., 2021) . Taken these conditions, the calculated sample size was 284. Ten percent of the required sample was added for non-responses and thus final sample size was 312, however, we have tested 320 samples. Table 1 . Table 1 . Primers used to target the N gene of the SARS-CoV-2 in the new real time RT-LAMP.

N-Gene F3 ACCGAAGAGCTACCAGACG B3 TGTAGCACGATTGCAGCATT FIP TCTGGCCCAGTTCCTAGGTAGTAATTCGTGGTGGTGACGGTA BIP AGACGGCATCATATGGGTTGCAGCGGGTGCCAATGTGATC LF CCATCTTGGACTGAGATCTTTCAT LB ACTGAGGGAGCCTTGAATACA

All samples used had been tested by a real time RT-PCR kit (Real Star, Altona Diagnostics, Germany 

The newly developed real time RT-LAMP assay was validated using the real time RT-PCR as a 

In this study, we detected the amplification of viral RNA through RFU per cycle at 65℃ for 60 cycles with 15 sec per cycle (~ 30 minutes). Whenever real time amplification was noted under these conditions, the results were taken as SARS CoV-2 RNA detected by the new real time RT-LAMP assay. Whenever real time amplification was not noted under these conditions, the results were taken as SARS CoV-2 RNA not detected by the new assay. Additionally, results were read by visualizing turbidity under UV light and naked eye.

Presence of viral RNA was detected within 30 minutes compared to the real time RT-PCR, which took a reaction time of 2 hours ( Figure 1A ). All negative samples detected by the real time RT-PCR were also negative by the newly developed real time RT-LAMP ( Figure 1B) .

Furthermore, visualization of these samples under UV light using a gel documentation system also gave similar results (Figure 2 ). These samples were also visualized through naked eye for turbidity as instructed by the manufacturers (Figure 3 ). All three read outs (real time RFU, UV light and naked eye turbidity) for the newly developed real time RT-LAMP agreed with each other. Table 2 . Results obtained from the binary logistic regression model, which compared the real time RT-PCR Ct values and the RT-LAMP results for the detection of SARS-CoV-2 are summarized in Table 3 . The binary logistic regression model was significant (model X 2 , p<0.05) and fitted well 

The workflow of the new real time RT-LAMP assay took 2 hours from sample collection to reporting of the results compared to the real time RT-PCR, which took 4 hours ( Figure 5 ). 

The newly developed real time RT-LAMP assay is a less expensive alternative molecular test to real time RT-PCR for detection of SARS-CoV-2 for large scale screening in resource limited settings (Table 4 ). Highly suspected real time RT-LAMP negative persons' extracts can be subjected to real time RT-PCR for confirmation. We then generated ROC curves for all samples tested (n=240; Ct < 40) . The area under the curve (AUC) for the binary model was noted as 0.9. In general, an AUC of 0.5 suggests no discrimination, 0.7 to 0.8 is considered acceptable, 0.8 to 0.9 is considered excellent, and more than 0.9 is considered outstanding. Analysis by ROC curve confirmed a value of 0.9 for AUC for both models tested for the current results indicating the model is excellent (Table 3 ; Figure 4 ).

The current real time RT-LAMP has a turnaround time of 2 hours from extraction to reporting and it is two times faster than the real time RT-PCR. The cost analysis provides evidence for the cost effectiveness of the real time RT-LAMP as a replacement for real time RT-PCR for SARS- Hsieh et al., 2014) and the recently reported SARS CoV-2 RT-LAMP assays also report such a problem. It is also difficult to avoid primer dimer formation and non-specific amplification when 4-6 primers are used. To overcome this, we have used 6% dimethyl sulfoxide (DMSO) in the final reaction mixture as recommended by previous LAMP based protocols (Alekseenko et al., 2021) . DMSO in LAMP reaction mixtures increases amplification at low template concentration and inhibit Bst 2.0 WarmStart DNA polymerase activity at the latter part of the reaction. The latter decreases non-specific amplification and the current LAMP assay also used DMSO in the reaction mixture to minimize the non-specific amplification.

Improvements to the new developed real time RT-LAMP assay will enable robust, cost-effective and sensitive detection of SARS-CoV-2. A rapid extraction free colorimetric RT-LAMP may be used with our primers (Table 1) In conclusion, the new real time RT-LAMP assay has a great potential to fill the technological gap, which hinders the large-scale testing as the assay enables nucleic acid detection with rapidity and cost-effectiveness. The new real time RT-LAMP would be an alternative test to screen large scale community samples in different parts of Sri Lanka and elsewhere.

Bushran 

Direct detection of SARS -CoV -2 using non -commercial RT -LAMP reagents on heat -inactivated samples

Direct RT-PCR from serum enables fast and cost-effective phylogenetic analysis of bovine viral diarrhoea virus

Highly Sensitive Loop-Mediated Isothermal Amplification for the Detection of Leptospira

Essential properties and pitfalls of colorimetric Reverse Transcription Loop -mediated Isothermal Amplification as a point -of -care test for SARS -CoV -2 diagnosis

A colorimetric RT-LAMP assay and LAMP-sequencing for detecting SARS-CoV-2 RNA in clinical samples

Elsevier has created a COVID-19 resource centre with free information in English and Mandarin on the novel coronavirus COVID-19 . The COVID-19 resource centre is hosted on Elsevier Connect , the company ' s public news and information

Mild or Moderate Covid-19

Rapid isothermal amplification and portable detection system for SARS-CoV-2

Surveillance of SARS-CoV-2 variants of concern by identification of single nucleotide polymorphisms in the spike protein by a multiplex real-time PCR

Selecting a SARS-CoV-2/COVID Molecular Testing Method for Your Laboratory

Simultaneous elimination of carryover contamination and detection of DNA with uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification (UDG-LAMP)

RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2

Development of a multiplex Loop-Mediated Isothermal Amplification ( LAMP ) assay for on-site diagnosis of SARS CoV-2 1-14

Seroprevalence of SARS-CoV-2 Infection in the Colombo Municipality Region

DMSO and Betaine Greatly Improve Amplification of GC-Rich Constructs in De Novo Synthesis

Development and Validation of a Rapid , Single-Step Reverse Transcriptase Loop-Mediated Isothermal Amplification ( RT-LAMP ) System Potentially to Be Used for Reliable and High-Throughput Screening of COVID-19

Scalable, rapid and highly sensitive isothermal detection of SARS-CoV-2 for laboratory and home testing

Test sensitivity is secondary to frequency and turnaround time for COVID-19 screening 1-11

Colorimetric detection of dengue by single tube reversetranscription-loop-mediated isothermal amplification

Sample size determination in health studies : a practical manual / S. K. Lwanga and S. Lemeshow. World Health Organization

Rapid point -of -care detection of SARS -CoV -2 using reverse transcription loop -mediated isothermal amplification ( RT -LAMP )

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

Expert Review of Molecular Diagnostics LAMP Diagnostics at the Point-of-Care : Emerging Trends and Perspectives for the Developer Community LAMP Diagnostics at the Point-of-Care : Emerging Trends and Perspectives for the Developer Community ABSTRACT

Development and validation of direct RT-LAMP for SARS-CoV-2 1 . Department of Microbiology , Immunology , and Infectious Diseases , University of 2 . Alberta Public Health Laboratory , Calgary , AB , Canada 3 . Clinical Section of Microbiology

Detection of noroviruses in fecal specimens by direct RT-PCR without RNA purification

Loop-mediated isothermal amplification of DNA

Development of a TaqMan® RT-PCR assay without RNA extraction step for the detection and quantification of African Chikungunya viruses

Evaluation of loop-mediated isothermal amplification method (LAMP) for pathogenic Leptospira spp. detection with leptospires isolation and real-time PCR

Detection of dengue viruses using reverse transcription-loopmediated isothermal amplification

Mini review: Recent progress in RT-LAMP enabled COVID-19 detection

Rapid Direct Nucleic Acid Amplification Test Without RNA Extraction for SARS-CoV-2 Using a portable PCR thermocycler 2-6

We greatly appreciate the support from Dr. Jatin Shrinet from Florida state university USA for the help in designing the primers for the study. Support provided by Ms