key: cord-0837352-8xmgbz4f
authors: Ao, Zhujun; Jing Ouyang, Maggie; Olukitibi, Titus Abiola; Warner, Bryce; Vendramelli, Robert; Truong, Thang; Zhang, Manli; Kung, Sam; Fowke, Keith R; Kobasa, Darwyn; Yao, Xiaojian
title: Development and Characterization of Recombinant Vesicular Stomatitis Virus (rVSV)-based Bivalent Vaccine Against COVID-19 Delta Variant and Influenza Virus
date: 2021-12-15
journal: bioRxiv
DOI: 10.1101/2021.12.14.472657
sha: 196c55bb594a5d32d0c44c05a77f9e4ce9db8ccc
doc_id: 837352
cord_uid: 8xmgbz4f

COVID-19 and influenza are both highly contagious respiratory diseases with a wide range of severe symptoms and cause great disease burdens globally. It has become very urgent and important to develop a bivalent vaccine that is able to target these two infectious diseases simultaneously. In this study, we generated three attenuated replicating recombinant VSV (rVSV) vaccine candidates. These rVSV-based vaccines co-express SARS-CoV-2 Delta variant spike protein (SP) or the receptor binding domain (RBD) and four copies of the highly conserved M2 ectodomain (M2e) of influenza A fused with the Ebola glycoprotein DC-targeting/activation domain. Animal studies have shown that immunization with these bivalent rVSV vaccines induced efficient but variable levels of humoral and cell-mediated immune responses against both SARS-CoV-2 and influenza M2e protein. Significantly, our vaccine candidates induced production of high levels of neutralizing antibodies that protected cells against SARS-CoV-2 Delta and other SP-pseudovirus infections in culture. Furthermore, vaccination with the bivalent VSV vaccine via either intramuscular or intranasal route efficiently protected mice from the lethal challenge of H1N1 and H3N2 influenza viruses and significantly reduced viral load in the lungs. These studies provide convincing evidence for the high efficacy of this bivalent vaccine to prevent influenza replication and initiate robust immune responses against SARS-CoV-2 Delta variants. Further investigation of its efficacy to protect against SARS-CoV-2 Delta variants will provide substantial evidence for new avenues to control two contagious respiratory infections, COVID-19 and influenza.

The ongoing pandemic of coronavirus disease 2019 (COVID -19) has been the most serious threat to global public health, with a total number of cases surpassing 256 million and over 5 million deaths 1, 2 . The case fatality ratio (CFR) of COVID-19 is 2.0% as of 18 November 2021, which is close to the CFR of 1918 flu (>2.5%) and shockingly higher than other influenza pandemics (<0.1%) [3] [4] [5] .

Since the identification of SARS-CoV-2 sequences 6 , extensive worldwide efforts have focused on developing effective vaccines and antiviral drugs against SARS-CoV-2. Several vaccines have been successfully developed and approved for the prevention of COVID-19 7 . However, the spread of some highly transmissible variants of concern (VOCs) and their ability to infect immunized people (breakthrough infections) have challenged the effectiveness of current vaccines. This raised a debate about the need for reformulated vaccines targeting these VOCs.

SARS-CoV-2 is a member of the betacoronavirus subfamily that causes severe symptoms in respiratory, gastrointestinal and neurological systems [8] [9] [10] [11] . Since late 2019, when the COVID-19 outbreak emerged in Wuhan, China, the COVID-19 pandemic continually threatened public health with the continuing emergence of different VOCs. The mutation D614G (amino acid (aa) 614 from aspartic acid to glycine) in the SP receptor-binding domain (RBD) was the first mutation found to endow the virus with a higher transmissibility, indicating that more virulent strains may emerge due to the fast evolution of the virus 12, 13 . One of the most virulent and highly transmissible VOC strains is the Delta variant (B.1.617.2). The Delta variant of SARS-CoV-2 was first found in India in Dec. 2020, and only in several months did this particular variant spread worldwide, becoming the dominant variant in many countries, including India, the U.K., Israel and the United States 14 . To date, the Delta variant has been the most contagious of all the known SARS-CoV-2 variants. A recent study found that people infected by the Delta variant had viral loads that increased to more than 1000 times higher than those of individuals infected with the original strain in 2020 15 . Therefore, it is imperative to develop a vaccine that can specifically target the Delta variant to more efficiently block the transmission and infection of SARS-CoV-2 worldwide.

Influenza is another contagious respiratory illness caused by the influenza virus. Surprisingly, 100 years after the pandemic of influenza A virus (IAV) that killed approximately 50 million people globally in 1918 16, 17 , seasonal influenza still poses a large threat to public health, with a global annual mortality of over 300,000 18 . Vaccination remains the most effective method to prevent influenzaassociated illness; however, the effectiveness of the seasonal influenza vaccine is only approximately 10% to 60% since the vaccine strains may not be well matched to circulating strains 19, 20 . Therefore, it is necessary to develop a universal influenza vaccine that can elicit immune responses against all influenza strains regardless of the virus subtype, antigenic drift or antigen shift. Recently, we demonstrated that recombinant rVSV-EΔM-tM2e which contains four copies of the highly conserved extracellular domain of the influenza matrix protein (M2e) could efficiently protect mice from influenza H1N1 and H3N2 challenges 21 . Given that both COVID-19 and influenza are contagious respiratory diseases mainly transmitted during the same seasons with an increasing threat to the globe, it is necessary to develop a multivalent vaccine that could simultaneously protect against both COVID-19 and influenza. Vesicular stomatitis virus (VSV) is a single-stranded negative-sense RNA virus belonging to the family Rhabdoviridae. Although VSV can cause illness in livestock and some other animals, it is highly restricted in humans by the IFN response and generally causes no or little symptoms in humans 22 . The VSV-based vaccine platform has been used as an attenuated replication-competent vaccine that induces a rapid and robust immune response to viral antigens after a single immunization and has been shown to protect against several pathogens, including Ebola virus, Zika virus, HIV, and Nipah virus [23] [24] [25] [26] [27] . Specifically, the VSV-based Zaire Ebola glycoprotein (GP) vaccine (rVSV-ZEBOV) that expresses EBOV GP induced robust and persistent specific antibodies against EBOV 27, 28 and was considered safe and effective against EBOV in a phase III clinical trial. Intriguingly, a recent report indicated that intranasal vaccination with VSV-SARS-CoV-2 resulted in protection in hamsters if administered within 10 days prior to SARS-CoV-2 challenge, and that animals did not show signs of pneumonia, demonstrating that VSV-based vaccines are fast-acting vaccine candidates that are protective against In this study, we generated several rVSV bivalent vaccine candidates that co-expressed SARS-CoV2 Delta variant spike protein (SP) or RBD and four copies of highly conserved influenza M2 ectodomain (M2e) fused with a DC-targeting/activation domain derived from EBOV GP (EboGPΔM) based on our previously reported vaccine platform 21, 29 . Here, we characterized the expression of SARS-CoV-2 Delta variant spike protein (SP) or RBD and influenza M2 ectodomains of these bivalent vaccine candidates and their abilities to induce immune responses against SARS-CoV-2 SP, especially Delta SP, and influenza M2e. The study demonstrated that vaccination with the bivalent VSV vaccine efficiently protected mice from lethal challenges of influenza H1N1 viruses.

Generation of rVSV-based vaccines expressing both the conserved M2 ectodomain (M2e) of influenza and SARS-CoV-2 Delta spike protein. Given that a new SARS-CoV-2 Delta variant (B1.617.2) has become a dominant variant spreading rapidly around the world 14 , it is necessary to develop a vaccine that specifically targets the Delta strain and related variants. To this end, we generated several bivalent rVSV-based vaccines against both SARS-CoV-2 Delta variants and influenza virus. First, we performed cDNA synthesis and two step PCR to generate the cDNAs encoding SARS-CoV-2 Delta variant spike protein (SP Delta ) containing a C-terminal 17 amino acid (aa) deletion (SPΔC) (Fig. 1A , a, Suppl. Fig. 1 ). The deletion of 17 aa at the C-terminus of SP will facilitate the transportation of SP to the plasma membrane and its assembly into virus because the assembly of SARS-CoV-2 occurs in the ER-Golgi intermediate compartment 30, 31 . To reduce the cytotoxic effect of SPΔC Delta 32 in the vaccine platform, we also introduced an isoleucine (I) to alanine (A) substitution at position 742 aa and named it SPΔC1 (Fig. 1A, a) . The analyses revealed that the I742A point mutation in SPΔC1 significantly reduced pseudovirus infectivity (Fig. 1B) and syncytia formation compared to SPΔC Delta in A549-ACE2 cells ( Fig. 1C and D) . In SP Delta ΔS2ΔC (named SPΔC2), a 381 aa fragment in the S2 domain (744-1124 aa) was further deleted (Fig. 1A, b) . Meanwhile, we inserted a receptorbinding domain (RBD) from SARS-CoV-2 (wild type) SP into the Ebola glycoprotein (EboGPΔM) to replace the mucin-like domain (MLD) and named it EboGPΔM-RBD (ERBD) (Fig. 1A, c) . Finally, we inserted cDNA encoding SPΔC1, SPΔC2 and ERBD into a recently reported rVSV-EM2e vaccine vector, which contains an EboGPΔM fused with four copies of influenza M2 ectodomain (24 aa) polypeptide (EboGPΔM-tM2e, or EM2) 21 (Fig. 1A , d) and named them V-EM2e/SPΔC1, V-EM2e/SPΔC2, and V-EM2e/ERBD (Fig. 1D ).

The established reverse genetics technology 33 was used to rescue three rVSV vaccine candidates.

Primary recovery was performed in 293T and VeroE6 co-culture cells by co-transfecting the rVSV-EM2e/SPΔC1, rVSV-EMe2/SPΔC2 or rVSV-EM2e/ERBD vector with the VSV accessory plasmids encoding VSV-N, P, L, and T7 34 (Fig. 1C ). After 48 hrs and 72 hrs, the supernatants containing the recovered rVSVs were collected and used to infect Vero E6 cells, which consequently showed a cytopathic effect (CPE) at 72 or 96 hrs post-infection ( Fig. 2A) . To verify the expression of SPΔC1, SPΔC2, ERBD, and EM2e in each corresponding rVSV-infected Vero E6 cell line, we performed an immunofluorescence assay with a rabbit anti-SARS-CoV-2 RBD antibody or anti-influenza M2

antibody. The results confirmed the expression of SPΔC1, SPΔC2, ERBD and EM2 in the corresponding rVSV-infected cells but not in mock-infected cells (Fig. 2B) . Meanwhile, we 

to wild-type VSV. In our rVSV vaccine strategy, VSV-G was replaced by EM2e and SPΔC or ERBD, which attenuated the pathogenicity of rVSV. Considering that rVSV is a replication-competent vector, it is necessary to investigate the replication ability and cell tropism of the above rVSV vaccine candidates. We therefore used a dose of 100 TCID50 to infect following cell lines: A549, a type II dendritic cells (DCs) (Fig. 3) . We assessed the cytopathic effect (CPE) of rVSV vaccine candidates and assessed their growth kinetics. A comparison study revealed that 1) rVSV vaccine candidates were unable to infect CD4+ Jurkat T cells and MRC-5 cells, while wild-type VSV replicated efficiently in all tested cells and induced typical CPEs, such as cell rounding and detachment (Fig. 3A, B) . 2) In A549 cells, U251 cells, MDMs and MDDCs, three rVSV vaccine candidates displayed positive infection but exhibited much slower replication kinetics and no significant CPE was observed compared to wild-type VSV during the testing period. This implies that these rVSV vaccine candidates have less replication ability and cytopathic effects. All of these data provided evidence supporting that the replication ability of these replicating rVSV vaccine candidates is highly attenuated compared to wild-type VSV. 

To date, the Delta variant is the most transmissible SARS-CoV-2 virus, and the current vaccines only provide partial protection against Delta variant infection. To rapidly respond to this critical situation,

we have developed vaccine candidates that specifically target the SARS-CoV-2 Delta variant and influenza viruses (Fig. 1) . These bivalent rVSV vaccines simultaneously express an EboGPΔM-M2e fusion protein (EM2e) and an EboGPΔM-SARS-CoV2 RBD fusion protein (ERBD), a full-length SPΔC Delta (SPΔC1), or an S2-deleted SPΔC Delta (SPΔC2). Replication kinetics studies revealed that the replication of these rVSV viruses was significantly attenuated compared to wild-type VSV and unable to infect CD4+ T lymphocytes, suggesting highly attenuated characteristics of these rVSV-based vaccines. Interestingly, our immunization study and neutralizing analysis revealed that the sera from V-EM2e/SPΔC1-and V-EM2e/SPΔC2-immunized mice exhibited significantly higher neutralizing activity against SARS-CoV-2 SP Delta -PV infection than against SP WT -PV infection (Fig. 5) .

Unfortunately, rVSV-EM2e/ERBD immunization did not elicit either high levels of antibody responses or neutralizing activity. To date, the reasons for the low antigenicity of RBD fused with EboGPΔM in our system remain unknown, since EboGPΔM-M2e still induced robust immune responses (Fig. 4) . Interestingly, several previous studies have demonstrated that RBD vaccine candidates were able to induce sufficient neutralizing antibody (nAb) responses and provided some protection against SARS-CoV-2 38 . The Inconsistencies in immunogenicity of RBD in different studies may be due to the difference in the delivery method of RBD, such as in nanoparticles or in rVSV, and deserves further study.

An important unique feature of the vaccine platform in this study is that it can simultaneously protect against SARS-CoV-2 and influenza viruses. In particular, this vaccine is designed to specifically target the SARS-CoV-2 Delta strain and the highly conserved ectodomain of M2 (M2e) of influenza virus that were derived from human, avian and swine virus strains 39 (Fig. 1A, d) . Our recent study demonstrated that rVSV expressing EboGPΔM-M2e alone induced robust anti-M2 humoral responses and effectively protected mice against either H1N1 or H3N2 virus challenge 21 The attenuated replication-competent VSV vaccine is an ideal platform for developing novel vaccine candidates against outbreak pathogens 40 . In addition to its safety and easy and scalable production, the VSV vaccine induces a rapid and robust immune response to viral antigens after a single immunization and has been shown to protect against several pathogens [23] [24] [25] [26] [27] The safety profile is also an important issue for vaccine development. Even though the pathogenicity of the rVSVΔG vector is significantly attenuated compared to the wild-type VSV, the replacement of EboGP-ΔM and SARS-CoV-2 SP affected the cell tropism of vaccine candidates. As expected, we observed much attenuated replication kinetics of rVSV-based vaccines in various cell lines compared to rVSV expressing VSV-G. Except for Vero-E6 cells, these vaccines showed no or much milder cytopathic effects in most tested cell lines compared with VSV wt , which induced significant cytopathic effects (Fig. 3) . Importantly, these rVSV-based vaccines do not target CD4 + T cells, which is also essential for protecting the immune system from attack. Given the fact that SARS-CoV-2 SP Delta was able to efficiently mediate cell fusion and subsequently caused the cell death 32 47 , we introduced a mutation (I742A) into the SPΔC Delta gene of V-EM2e/SPΔC1 to reduce SP Delta 's cytotoxicity. Indeed, the TI742A mutation significantly reduced SPΔCDelta-pseudovirus's infectivity and syncytia formation (Fig. 1B-D) . Also, in V-EM2e/SPΔC2, we deleted a 381 aa sequence encompassing the S2 domain of the SP Delta (Fig. 1A,b) . In comparison of immunogenicity of these two vaccine candidates, both V-EM2e/SPΔC1 and V-EM2e/SPΔC2 elicited similarly high levels of anti-SARA-CoV-2 IgG and IgA antibody responses (Fig. 4) and induced comparable levels of T cell cytokine production (Fig. 6) . However, the level of neutralization antibody induced by V-EM2e/SPΔC2 was not as high as that of V-EM2e/SPΔC1. (Fig. 5A and B 

Plasmid constructions. In this study, the gene encoding SPΔC Delta was amplified from the previously described plasmid pCAGGS-SPΔC Delta 32, and the I742A mutation was introduced by sitedirected mutagenesis technique with, 5'-primers 5_TGTACAATGTATGCATGCGGAGACAGC, and 3'-primer, 5_GCTGTCTCCGCATGCATACATTGTACA. Then, the amplified SPΔC Delta -I742A gene was cloned at XhoI and NheI sites of an rVSV-based influenza vaccine vector, rVSV-EΔM-M2e 21 , and the constructed plasmid was named rVSV-EM2e/SPΔC1. To construct rVSV-EM2e/SPΔC2, we used a two-step PCR technique to generate cDNA that carried an additional 381 aa deletion in the S2 region of SPΔC Delta (Fig. 1A, b) , and the amplified SPΔC2-encoding cDNA was also cloned into the rVSV-EΔM-M2e vector using the same restriction enzymes, yielding rVSV-EM2e/SPΔC2. To Immunofluorescence assay and syncytia formation assay. As previously described 21 Additionally, 5 to 6 days post-challenge, the mice from the PBS group and two mice from the vaccination group were sacrificed, and the lungs were collected and immediately stored at -80 °C. The lung was homogenized using a tissue grinder and centrifuged at 5,000 rpm. The supernatant was used for titration in MDCK cells according to the method described previously 52, 53 .

or anti-influenza M2e antibody levels in immunized mouse sera. Anti-SARS-CoV-2-SP/RBD antibodies and anti-influenza M2 antibodies in mouse sera were determined by ELISA, as previously described with some modifications 21 54 . To determine the endpoint titers, 100 μl of 3× serially diluted sera was used to measure the OD450. The endpoint titer is designated as the reciprocal of the highest dilution of a serum that has an OD450 above the cutoff (10× negative control) and is calculated by using sigmoid 4PL interpolation with GraphPad Prism 9.0.

Vaccine candidates-induced T cell responses. The mice were vaccinated according to the schedule described in Fig. 4A and sacrificed on Day 28 (2 weeks after booster). To assess general T cell reactivity, mouse splenocytes were collected as described previously 29 

Early Transmission Dynamics in Wuhan, China, of Novel Coronavirus-Infected Pneumonia

Temporal estimates of case-fatality rate for COVID-19 outbreaks in Canada and the United States

Influenza: the mother of all pandemics

An interactive web-based dashboard to track COVID-19 in real time

Real estimates of mortality following COVID-19 infection. The Lancet. Infectious diseases

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

Looking beyond COVID-19 vaccine phase 3 trials

Understanding the neurotropic characteristics of SARS-CoV-2: from neurological manifestations of COVID-19 to potential neurotropic mechanisms

Neurological Manifestations of COVID-19 (SARS-CoV-2): A Review

Clinical characteristics of asymptomatic and symptomatic patients with mild COVID-19. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 26

Gastrointestinal symptoms of 95 cases with SARS-CoV-2 infection

Spike mutation pipeline reveals the emergence of a more transmissible form of SARS-CoV-2

Hyeryun Choe The D614G mutation in the SARS-CoV-2 spike protein reduces S1 shedding and increases infectivity bioRxiv 06

SARS-CoV-2 B.1.617.2 (Delta) Variant COVID-19 Outbreak Associated with a Gymnastics Facility -Oklahoma

Viral infection and transmission in a large, well-traced outbreak caused by the SARS-CoV-2 Delta variant

A year of terror and a century of reflection: perspectives on the great influenza pandemic of 1918â€

Back to the future: lessons learned from the 1918 influenza pandemic

Global mortality associated with seasonal influenza epidemics: New burden estimates and predictors from the GLaMOR Project

An overview of the regulation of influenza vaccines in the United States

Past Seasons Vaccine Effectiveness Estimates

Development and characterization of influenza M2 ectodomain and/or HA stalk-based DC-targeting vaccines for different influenza infections

Resistance to influenza virus andvesicular stomatitis virus conferred by expression of human MxA protein

A VSV-based Zika virus vaccine protects mice from lethal challenge

An effective AIDS vaccine based on live attenuated vesicularstomatitis virus recombinants

Single-dose liveattenuated Nipah virus vaccines confer complete protection by eliciting anti-bodies directed against surface glycoproteins

VSV-EBOV rapidly protects macaques against infection with the

Ebola virus outbreak strain

The vesicular sto-matitis virusbased Ebola virus vaccine: from concept to clinical trials

Ebola: lessons on vaccine development

Development and Evaluation of an Ebola Virus Glycoprotein Mucin-Like Domain Replacement System as a New Dendritic Cell-Targeting Vaccine Approach against HIV-1

Genetic analysis of the SARS-coronavirus spike glycoprotein functional domains involved in cell-surface expression and cell-to-cell fusion

Identification and evaluation of the inhibitory effect of Prunella vulgaris extract on SARS-coronavirus 2 virus entry

SARS-CoV-2 Delta Spike Protein Enhances the Viral Fusogenicity and Inflammatory Cytokine Production

An efficient helper-virus-free method for rescue of recombinant paramyxoviruses and rhadoviruses from a cell line suitable for vaccine development

Designing Efficacious Vesicular Stomatitis Virus-Vectored Vaccines Against Ebola Virus

Characterization of the A549 Cell Line as a Type II Pulmonary Epithelial Cell Model for Drug Metabolism

The human lung fibroblast cell line, MRC-5, produces multiple factors involved with megakaryocytopoiesis

Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

Scientific rationale for developing potent RBD-based vaccines targeting COVID-19. npj Vaccines

Sequence comparison between the extracellular domain of M2 protein human and avian influenza A virus provides new information for bivalent influenza vaccine design

Recombinant vesicular stomatitis virus vector vaccines for WHO blueprint priority pathogens

Replication-Competent Vesicular Stomatitis Virus Vaccine Vector Protects against SARS-CoV-2-Mediated Pathogenesis in Mice

A single dose of replication-competent VSV-vectored vaccine expressing SARS-CoV-2 S1 protects against virus replication in a hamster model of severe COVID-19

A single dose of recombinant VSV-∆G-spike vaccine provides protection against SARS-CoV-2 challenge

Optimization of single dose VSV-based COVID-19 vaccination in hamsters bioRxiv

Rapid protection from COVID-19 in nonhuman primates vaccinated intramuscularly but not intranasally with a single dose of a recombinant vaccine

Immunization with SARS coronavirus vaccines leads to pulmonary immunopathology on challenge with the SARS virus

Membrane fusion and immune evasion by the spike protein of SARS-CoV-2 Delta variant

Domains and Functions of Spike Protein in Sars-Cov-2 in the Context of Vaccine Design

Incorporation of Ebola glycoprotein into HIV particles facilitates dendritic cell and macrophage targeting and enhances HIV-specific immune responses

A Simplified SARS-CoV-2 Pseudovirus Neutralization Assay

Development of cell-based pseudovirus entry assay to identify potential viral entry inhibitors and neutralizing antibodies against SARS-CoV-2

Methods used to study respiratory virus infection

Serum virus neutralization assay for detection and quantitation of serum-neutralizing antibodies to influenza A virus in swine

A single dose of a vesicular stomatitis virus-based influenza vaccine confers rapid protection against H5 viruses from different clades

were infected with equal amounts of SPΔC Delta -PVs or SPΔC1-PVs (adjusted by P24) carrying

At 48hrs after infection, the Gluc activity in the supernatant of different infected cultures was measured. Data represents Mean ±SD of two replicates from a representative experiment out of three performed. C and D) The attenuated cell-to-cell fusion ability of SPΔC Delta -or SPΔC1-mediated syncytia formation was analyzed by co-culturing the SPΔC Delta -or SPΔC1-expressing 293T cells with A549 ACE2 cells. The amounts of syncytia were counted after 24 hrs in 5 different views of microscope (C), and was also imaged under bright-field microscopy (D). E)

The supernatants containing V-EM2e/SPΔC1, V-EM2e/SPΔC2 and V-EM2e/ERBD viruses were used to infect Vero E6 cells to generate the rVSV stocks. listed (F). Data represent Mean ±SD and were obtained from over three independent experiments. Statistical significance was determined using ordinary one-way ANOVA

At day 28, all the mice were challenged with 2100 PFU of H1N1 influenza virus. Weight loss (D) and survive rates (E) of the mice were monitored daily for 2 weeks. F) Viral loads in the lung tissue of immunized mice and PBS group at day 5 post H1N1 challenge were measured in MDCK cell line, as described in Materials and Methods. For H3N2 challenge experiment, the Balb/c mice were immunized with 1x10 5 TCID 50 (IN) of V-EM2e/SPΔC1 or PBS at day 0 (single-dose, SD)

I)Viral loads in the lung tissue of immunized mice and PBS group at day 6 after H3N2 challenge

The authors declare no competing interests.

The data that support the findings of this study are available from the corresponding authors upon reasonable request. Source Data are provided with this paper.