key: cord-0818884-9h7kulwn
authors: Crone, M. A.; Priestman, M.; Ciechonska, M.; Jensen, K.; Sharp, D.; Randell, P.; Storch, M.; Freemont, P.
title: A new role for Biofoundries in rapid prototyping, development, and validation of automated clinical diagnostic tests for SARS-CoV-2
date: 2020-05-06
journal: nan
DOI: 10.1101/2020.05.02.20088344
sha: fd26dd522ad908ce224793f65f1001cdf63a40c0
doc_id: 818884
cord_uid: 9h7kulwn

The SARS-CoV-2 pandemic has shown how the rapid rise in demand for patient and community sample testing, required for tracing and containing a highly infectious disease, has quickly overwhelmed testing capability globally. With most diagnostic infrastructure dependent on specialised instruments, their exclusive reagent supplies quickly become bottlenecks in times of peak demand, creating an urgent need for novel approaches to boost testing capacity. We address this challenge by refocusing the full synthetic biology stack available at the London Biofoundry onto the development of alternative patient sample testing pipelines. We present a reagent-agnostic automated SARS-CoV-2 testing platform that can be quickly deployed and scaled, and that accepts a diverse range of reagents. Using an in-house-generated, open-source, MS2-virus-like-particle-SARS-CoV-2 standard, we validate RNA extraction and RT-qPCR workflows as well as two novel detection assays based on CRISPR-Cas and Loop-mediated isothermal Amplification (LAMP) approaches. In collaboration with an NHS diagnostic testing lab, we report the performance of the overall workflow and benchmark SARS-CoV-2 detection in patient samples via RT-qPCR, CRISPR-Cas, and LAMP against clinical test sets. The validated RNA extraction and RT-qPCR platform has been installed in NHS diagnostic labs and now contributes to increased patient sample processing in the UK while we continue to refine and develop novel high-throughput diagnostic methods. Finally, our workflows and protocols can be quickly implemented and adapted by members of the Global Biofoundry Alliance and the wider scientific and medical diagnostics community.

Following the report of a case in Wuhan on 31 st December 2019, the rapid spread and highly infectious nature of the newly emerged coronavirus has resulted in a worldwide pandemic, as declared by the World Health Organisation (WHO) on 11 th March 2020 [1] . The causative agent of COVID-19 has been classified as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and is closely related to the severe acute respiratory syndrome (SARS) and

Middle East Respiratory Syndrome (MERS) coronaviruses which were responsible for outbreaks in 2003 and 2012, respectively [2] . As of April 29, there have been 3 100 000 SARS-CoV-2-confirmed cases worldwide, with 215 000 deaths in 185 countries [3] . The fast rate of SARS-CoV-2 human-to-human transmission has resulted in an unprecedented need for diagnostic testing, placing a great strain on public health departments in every country.

Diagnostic testing is essential not only for the identification of infection in patients but also for tracking and containment of viral spread within communities and worldwide, testing of unresolved cases, and daily screening of medical frontline workers. It has become apparent that existing diagnostic infrastructure and associated reagent supply lines cannot be scaled to support sufficient testing in the early weeks and months of this pandemic in any country.

Automated workflows are highly preferable over manual protocols to achieve meaningful throughput, diagnostic precision, and to exclude human error from the sample processing pipeline. Typical automated systems such as the Roche cobas® unit can process hundreds of samples per day with minimal staff support, while ensuring uniform processing and sample tracking. As with other similar automated diagnostic testing platforms, they are costly and not available in the numbers needed to process hundreds of thousands of daily samples in the UK. Furthermore, they currently suffer from severe reagent supply shortages reducing their theoretical platform capacity to an insufficient practical testing capacity in the UK as in most countries. Thus, an urgent need has arisen for the adaptation of alternative automated liquid handling platforms and diagnostic test approaches and workflows, ideally designed in an open and modular way to allow for diversifying reagent supply away from mainstream and overstretched reagent sources.

Many research institutions around the world have established non-commercial Biofoundries, that offer an integrated infrastructure including state-of-the-art automated high-throughput (HT) equipment to enable the design-build-test cycle for large scale experimental designs in synthetic biology [4] . The unique combination of HT infrastructure with technical expertise in molecular biology, analytics, automation, engineering, and software development provides an excellent, self-sufficient, and agile capability to quickly establish platforms for prototyping biological testing standards and developing liquid-handling workflows, such as those needed for automated diagnostic testing of SARS-CoV-2. Once new workflows are validated, the Global Biofoundry Alliance provides an established network and collaborative culture which allows their quick implementation across the world. In the London Biofoundry, we have rapidly re-configured our existing liquid handling infrastructure to establish a HT SARS-CoV-2 testing workflow that can be implemented immediately into existing frontline diagnostic labs.

We have also established two novel workflows using CRISPR-Cas and LAMP which would allow increased future testing capacity.

To generate a standard for our workflow development, benchmarking, and validation, we also engineered non-infectious synthetic virus-like particles (VLP). 'Armoured RNA' is a noninfectious RNA virus surrogate consisting of an MS2 bacteriophage capsid containing an RNA template of choice [5] . It has been employed as a diagnostic reference tool for the detection of respiratory viruses such as Influenza A and B as well as SARS-CoV [6] , [7] . The particles are non-infectious and do not require specialist laboratories or equipment as is the case for live patient samples. Furthermore, they are nuclease resistant, have been shown to be highly stable in plasma, nasopharyngeal secretions, faeces, and water, and simulate the presence of a real viral target [7] . This makes them an excellent choice for the development and validation of diagnostic workflows, including RNA extraction and detection of transcripts by RT-qPCR, CRISPR-Cas systems, or colorimetric LAMP [8] .

Here, we produced and characterised a VLP standard simulating SARS-CoV-2 by containing the genomic RNA segments complementary to the N protein N1, N2, and N3 primer-probe sets specified by the CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel [9] [10] . We show that these provide good sensitivity and thus a low limit of detection in RT-qPCR assays. We used the SARS-CoV-2-VLPs as a semi-quantitative copy number standard and as a processing control in the absence of patient samples to design and optimise an automated nucleic acid test (NAT) diagnostic workflow encompassing viral RNA extraction and one-step RT-qPCR. The optimised workflow has been validated using patient samples and results shows high correlation with accredited diagnostic laboratory test results. Finally, . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint we have modularised the workflow to anticipate deficits in the reagent supply chain or qPCR equipment. We have implemented multiple off-the-shelf RNA extraction kits, assessed the quality of several RT-qPCR reagent suppliers, and employed CRISPR-Cas diagnostic and colorimetric isothermal amplification systems, as alternative SARS-CoV-2 detection methods.

As of the date of publication, the UK is processing approximately 52 000 samples per day [11] .

The diagnostic pipeline outlined here provides a modular approach to maximising testing capability using an alternative automation platform with several options for RNA extraction, RT-qPCR master mixes, and qPCR-free workflows. Furthermore, by automating the workflow, we report an average sample processing rate of approximately 1 000 samples per platform per day which can be modified and scaled to 4 000 samples per day. With our new workflow validated and implemented at two NHS diagnostic laboratories, our work has helped increase the current testing capacity in London and will provide support and validation for Biofoundries and interested laboratories globally.

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. 

Recombinant MS2 bacteriophage VLPs carrying the SARS-CoV-2 N gene were produced in E.

coli from an expression plasmid using protocols described previously and modified to transcribe and package the primer-probe target sites for the CoV-2 N protein (Fig 1a) [12] . The assembled MS2-SARS-CoV-2 VLPs were purified and treated with DNase and RNase to ensure the preparation was free from template DNA and RNA contamination. The purity of the sample was analysed by SDS-PAGE (Fig 1b) . We determined the VLP size distribution using dynamic light scattering (DLS) to be approximately 27 nm (Fig 1c) , which matched well with a previously well characterized MS2 VLP construct [12] . Next, we employed digital droplet PCR (ddPCR) to obtain absolute quantities of three serial dilutions of VLPs. Heat lysis has been shown to be effective in releasing RNA from armoured RNA VLPs at levels comparable to commercially available extraction kits [7] . RNA encoding the CoV-2 N protein was extracted from the VLPs at 95°C for five minutes, followed by amplification using the N1 primer-probe set. The released RNA was serially diluted and absolute quantification was performed. The ddPCR quantification method involves partitioning of the sample into thousands of droplets which individually contain single amplification reactions using the N1 probe. VLP concentration can then be derived using Poisson distribution statistics to determine absolute particle concentration in each dilution. This method allows for highly accurate and precise sample quantification without the need for a standard curve. We analysed the purified MS2-SARS-CoV-2 VLP absolute concentration in serial ten-fold dilutions, which were found to contain 250, 25 and 2.5 copies per ml respectively (Fig 1d) .

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint represent the cut offs for the positive and negative clusters. Any data points between the two dotted lines are considered droplet "rain".

One-step Quantitative RT-PCR (RT-qPCR) is currently the 'gold standard' for detection of nucleic acids in molecular diagnostic tests due to its sensitivity, robustness, dynamic range, HT capability, and affordability. It is the current method of choice for the detection of SARS-CoV-2 in the UK and around the world. In order to demonstrate the utility of MS2-SARS-CoV-2 VLPs as a standard for optimising and validating automated NAT diagnostic workflows, we assessed whether they could be reliably detected via RT-qPCR using the CDC 2019-Novel Coronavirus (2019-nCoV) Diagnostic Panel primer-probe set. To this end, we extracted the SARS-Cov-2 N protein RNA encapsulated by the MS2 VLP using heat lysis from the serial dilutions quantified via ddPCR and performed One-Step RT-qPCR using the TaqPath master mix (Thermo Fisher Scientific). Three biological replicates were completed to assess the robustness of using the MS2-SARS-CoV-2 VLPs as control RNA (Fig 2a) . The quantified VLP dilutions were also used to generate a standard curve to aid in assessment of viral RNA purification efficiency and to estimate the limit of detection (LoD) of our automated workflow (Fig 2b) .

The current unprecedented demand for the one-step RT-qPCR master mix to detect SARS-CoV-2 may result in disruption to the laboratory reagent supply chain. Here we used our MS2-SARS-CoV-2 standards to demonstrate modularity of the one-step RT-qPCR detection method by comparing detection reproducibility between three commercially available master mixes using the CDC Diagnostic Panel N1, N2 and N3 primer-probe sets. We report that Ct values achieved using the Virus Fast One-Step (Thermo Fisher Scientific) master mix closely matched those generated with the gold standard TaqPath master mix from the same supplier (Fig 2 c) .

Ct values obtained using the Luna Universal RT-qPCR kit supplied by New England Biolabs differed slightly from the TaqPath master mix. While all three primer-probe sets achieved similar Ct results, N1 produced the lowest Ct values with least variability, as previously reported by Vogels et al. [13] . The N2 primer-probe set produced higher Ct values and exhibited more variability between replicates for all three RT-qPCR master mix options. Based . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint on its higher sensitivity, we chose the N1 primer-probe set for validation of our RNA extraction and virus detection workflows. 

To further expand the modular nature of the automated platform, we assayed an alternative to the standard RT-qPCR detection method by employing a novel CRISPR Cas13 NAT. This approach, based on the specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) method, was designed to identify and amplify target sequences of the CoV-2 N gene RNA packaged within the MS2-SARS-CoV-2 VLP [14] . Briefly, similar to RT-qPCR, the initial step of . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint this method relies on the reverse transcription and amplification of the target RNA. Here, we employed the above-mentioned CDC diagnostic primer sets N1, N2, and N3 (with forward primers 5' extended with a T7 promoter sequence) together with a one-step RT enzyme mix to generate cDNA from N gene RNA released from the VLPs. However, unlike qPCR, the subsequent step includes transcription of the amplified segment to RNA and incubation with a guide RNA (gRNA), in this case complementary to the N region of CoV-2, together with a purified recombinant Cas13a protein derived from Leptotrichia wadei (LwCas13a). Upon recognition and binding of the target sequence by gRNA, Cas13 exhibits RNase activity not only for this complex, but also collateral activity for any RNA in its vicinity. Taking advantage of this non-specificity, a quenched fluorescent probe can be added and subsequently cleaved by activated Cas13, thus generating a quantitative signal which can be detected using a standard fluorescence microplate reader. By applying this technology, we assayed MS2-SARS-CoV-2 RNA released through heat lysis and were able to detect the CoV-2 RNA sequence at 2500, 250 and 2.5 VLP copies per reaction (Fig 3) . This low limit of detection was comparable to all of the one-step RT-qPCR master mixes reported above. Thus, we propose this method may be used to substitute current RT-qPCR diagnostic workflows, as it does not require qPCR equipment and is highly amenable to HT automated workflows. Furthermore, it enables 10-to 100-fold increased throughput when assembled in high-density assay plates, with accurate diagnostic test readout available in just a few minutes using a standard fluorescence microplate reader. Another advantage of our CRISPR workflow is the possibility of identifying specific viral serotypes in a multiplexed strain-specific diagnostic which would provide additional information for clinical management.

As an additional alternative detection methodology, we adapted the previously described colorimetric LAMP assay [8] for use with high-throughput automation. In this approach, a pyrophosphate moiety and hydrogen ion are produced for every nucleotide that is incorporated into the PCR product during each amplification step. The release of hydrogen ions results in a pH change which can be visually determined using dyes such as phenol red [15] and by measuring absorbance (Fig 3c) . Here, we employed the Labcyte Echo platform to set up LAMP reactions using various concentrations of VLP N gene RNA template in 384-well microplates. These were incubated at 65 °C in a microplate reader and absorbance at 415 nm was measured over time. We demonstrated that the presence of the target sequence can be . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint -10 -detected reliably down to at least 42.5 copies per reaction. The use of automation coupled with the speed and affordability of the LAMP workflow provides an excellent alternative to qPCR diagnostic NATs in a format that is highly amenable to ultra-high-throughput workflows (Fig 3d) .

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. 

Automation of clinical laboratory diagnostics has been essential to increase sample processing throughput, minimise run times, standardise sample processing, maximise accuracy and reproducibility, and to reduce human error. The unprecedented need for diagnostic testing imposed by the SARS-CoV-2 pandemic has resulted in a bottleneck in sample processing throughput. To increase patient sample turnaround time, we have developed an automated diagnostic workflow including RNA extraction and RT-qPCR using elements of the full synthetic biology technology stack available at the London Biofoundry (Fig 4a) . We employed the MS2-SARS-CoV-2 VLPs as a process control to optimise and validate our automated clinical diagnostic workflow encompassing RNA extraction and the RT-qPCR and CRISPR Cas13 detection methods. In order to design full-factorial experiments, track randomised samples, and document optimisation and validation experiments, we used the Riffyn platform in combination with JMP software. VLP RNA extraction was optimized for the Analytik Jena CyBio FeliX liquid handling platform for the standard 96-well plate format using the innuPREP Virus DNA/RNA Kit -FX. We prepared two VLP dilutions of 1000 copies/ml and 10 000 copies/ml in order to simulate viral load amounts found in patient samples [16] .

Using the optimised FeliX extraction protocol, we were able to isolate RNA from the test VLP dilutions within 60 minutes. The automated workflow takes advantage of magnetic beadsbased nucleic acid extraction and eliminates laborious and time-consuming column-based binding and spinning steps. While we tested three biological replicates of the two dilutions, this workflow is designed for the concurrent processing of 96 samples. We project that . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint employing the FeliX RNA extraction protocol in a 96-well format and using one liquid handling device can result in the processing of 1000 samples in 12hrs, including extra time for reagent and extraction kit refilling and patient sample plate loading. This workflow requires minimal user intervention and is therefore highly scalable. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint Next, we employed RT-qPCR to determine RNA extraction efficiency. To this end, we used a combination of Riffyn and JMP software to generate and track randomised pick lists for the Labcyte Echo 525 acoustic liquid handling platform, which was used to automate the TaqPath master mix, primer-probe, and sample transfer into 96-well qPCR plates. Plate handling time from RNA extraction to qPCR launch was approximately 10 minutes when using the ECHO 525 followed by a qPCR running time of approximately 70 minutes. The extracted VLP RNA assayed by RT-qPCR resulted in Ct values that approximated those achieved with VLP heat lysis described above for the same concentrations, suggesting a high efficiency of extraction using the automated platform (Fig 4b) . Total running time from beginning of the RNA extraction to obtaining RT-qPCR results was approximately 2 hours and 45 minutes.

A key advantage of the Analytik Jena CyBio FeliX liquid handling platform over other commercial dedicated platforms is its programmability. This allows a reagent-agnostic approach to be developed, permitting resilient, robust, and redundant supply chains to be established. To this end, we also implemented and optimised RNA extraction using an alternative kit -Maxwell HT Viral TNA (Promega) -using the same platform. This required minor adjustments to match manufacturer recommendations for optimal volumes and empirically determined mixing steps. Crucially, the hardware is identical, the plasticware is identical, and the output is identical thus requiring no changes to working practice. The same VLP dilutions were used to allow comparison of RNA extraction efficiency between the innuPREP Virus DNA/RNA Kit and the Maxwell HT Viral TNA kit by RT-qPCR (Fig 4b) . The Ct values achieved from RNA extracted using the Promega kit are broadly 0.5 cycles higher than those for the Analytik Jena kit (27.52 ± 0.05 and 27.04 ± 0.04 respectively for the high VLP concentration, p=2.90 × 10 -7 ; and 30.76 ± 0.08 and 30.30 ± 0.05 for the lower concentration, p=2.02 × 10 -4 ; ± standard error of the mean, paired t-test).

In parallel, a CRISPR-Cas workflow was tested for situations where the number of qPCR machines, but not PCR machines, may be a limiting factor. Samples were pre-amplified with one-step RT-PCR master mix and 250 nL of each PCR product was added to 4750 nL of Cas13 gRNA master mix using the Labcyte Echo 550. Reactions reached saturation in positive samples within approximately 10 minutes (Fig 4c) . Although this approach slightly lengthens the approximate running time from RNA extraction to obtaining a diagnostic test result to . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint approximately 3 hours, it provides an alternative detection methodology that is more easily scaled than qPCR workflows.

After demonstrating that the workflow could detect VLPs loaded with SARS-CoV-2 RNA at clinically relevant concentrations, we validated the platform on 173 patient samples obtained from North West London Pathology (NWLP). We compared our extraction (Analytik Jena innuPREP Virus DNA/RNA Kit) and qPCR workflow to that of NWLP at the time (a multiplexedtandem PCR workflow). We assayed 5 µL of purified RNA from each patient sample (Fig 5a) and showed good correlation (R 2 = 0.8310) between our results and the test used by NWLP (Fig 5b) . Of 173 samples tested, we were able to match 49 positive and 120 negative samples, with three samples detected by NWLP only and one sample detected using our workflow only.

We then compared the Promega Maxwell HT Viral TNA extraction kit to the previously validated Analytik Jena innuPREP Virus DNA/RNA Kit workflow with a second set of patient samples. We observed high correlation (R 2 = 0.9357) between Ct values for the same samples when processed with either the Promega or Analytik Jena extraction kits (Fig 5c) . This highlights the strength of the platform providing consistent results for diverse reagent kits and supply chains. The more reagent kits are validated, the more resilience can be added through redundancy.

Finally, previously described detection assays [8] , [17] were demonstrated in a HT-compatible format. Samples were extracted using the FeliX liquid handling protocol and resulting elution samples were transferred to plates certified for acoustic liquid handling. Miniaturised reactions were then set up to enable alternative detection modalities that are HT-compatible.

The CRISPR-Cas workflow with RT-RPA amplification was shown to detect SARS-CoV-2 even at relatively low viral loads (Fig 5d) . Additionally, the performance of colorimetric LAMP was successfully demonstrated using low, medium, and high viral load patient samples (Fig 5e) .

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint

Integrated platforms that allow HT sample processing -including automated patient sample nucleic acid extraction -are available from several manufacturers, such as Roche, Abbott, Hamilton, Thermo Fisher, and Qiagen. However, at a time of unprecedented sample processing need, such as that imposed by the global COVID-19 pandemic, innovative approaches and non-traditional developers such as biofoundries, academic labs, start-ups, and SMEs can greatly expand testing options to add not only increased capacity, but also increased resiliency in mitigating supply chain bottlenecks [18] , [19] . Biofoundries are agile facilities with a highly skilled workforce and cutting-edge equipment that can rapidly respond to such new challenges. Typically, they are not-for-profit institutions and therefore can evaluate different strategies unconstrained by commercial considerations. Their aim is to develop and apply purpose-built laboratory automation platforms, with an emphasis on versatile equipment, that can be adapted to a variety of synthetic biology workflows and support the translation of the latest scientific developments at their hosting research institutes and beyond. As lessons from management of the outbreak in Wuhan are beginning to emerge, it is becoming clear that automated diagnostic workflows, such as those implemented at the Huo-Yan diagnostic laboratory for processing 10 000 tests per day, play a pivotal role in containment of the virus [20] .

When developing diagnostics for high-pressure pandemic scenarios, it is critical to create workflows that are modular and offer multiple contingency options, as reagent supply can quickly become a limiting factor to sample processing. Here we describe the rapid development of a HT diagnostic platform for the detection of SARS-CoV-2, using a synthetic VLP developed in-house under biosafety level 1 conditions. We use a versatile automated liquid handling device, the Analytik Jena CyBio FeliX, and validate 2 RNA extraction kits, multiple qPCR master mixes, as well as CRISPR-and colorimetric LAMP-based workflows, all in under four weeks. Importantly, we also validate the RNA extraction and RT-qPCR assay using patient samples, demonstrating a good correlation between a currently used clinical laboratory test for SARS-CoV-2 and our modular workflow. The framework provided for the validated platform may be further extended by alternative extraction and detection methodologies as well as in-house production and optimisation of kit components [21] , [22] .

This toolkit increases resilience of the SARS-CoV-2 NAT in case of shortages in extraction . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint materials, RT-qPCR master mix, and laboratory equipment availability. The diagnostic output interchangeability is created not only by generating custom protocols for several commercially available kits, but also by adapting the CRISPR Cas13 detection and colorimetric LAMP systems to HT SARS-CoV-2 diagnostic testing. CRISPR-based detection technologies are also currently being developed by Sherlock Biosciences and Mammoth Biosciences to generate at-home point-of-care testing kits [14] , [23] , [24] , as well as in CARMEN-Cas13, a microwell array which multiplexes virus detection [25] .

Our workflow is easy to scale up, cost-effective and can provide similar output capacity to that offered by the 'gold standard' of commercial automated systems. For example, a single FeliX liquid handler and qPCR thermocycler can match the largest state-of-the-art Roche cobas® 8800 platform, which can process 960 samples in eight hours. Additionally, excess viral RNA remaining from the Felix patient sample RNA extraction can be diverted to alternative analysis workflows such as next generation sequencing (NGS), which is not possible for some commercial platforms. Finally, our automated RNA extraction and qPCR workflow requires minimal specialist training and can be launched within one day. It is currently installed, and used in NHS diagnostic labs, where patient sample testing has been validated against large commercially available platforms, matching their precision and throughput.

Synthetically engineered VLPs have been widely reported and commercially used as controls and standards in nucleic acid-based diagnostic tests (Asuragen), and have been developed as antigen epitopes in serological assays, where they are used to detect patient antibodies (Native Antigen) [26] , [27] . MS2 VLPs carrying RNA payload, such as those used in this study for the detection of SARS-CoV-2 N gene RNA, provide a quick and reproducible system for generating extremely stable NAT controls. As such, we have purified and quantified large batches that are ready to be shared with, and employed by, others for diagnostic test development that relies on viral RNA detection. Furthermore, our VLP production and characterisation workflow can be modified to rapidly generate new controls mimicking emerging viral threats, thus enhancing preparedness for the development of new diagnostics in future epidemic or pandemic scenarios. In addition, automation equipment available in biofoundries can be used for large scale testing of antigen-presenting VLPs in developing antibody-based ELISA diagnostics as well as for performing high-throughput antiviral drug . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint -18 -screens. The London Biofoundry is a founding member of the Global Biofoundry Alliance, which currently encompasses 26 such entities worldwide [28] . This network allows for easy sharing of reagents, protocols, and technical know-how, therefore automated diagnostic workflows developed by one partner can be quickly replicated around the world and increase capacity for testing and drug development to help counteract and prevent the global spread of emerging pathogens.

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint

The nucleic acid sequence of the N gene of SARS-CoV-2 (accession number: NC_045512) was ordered from GeneArt (ThermoFisher Scientific). The N gene was cloned into a previously described plasmid backbone (Addgene #128233) using Type IIs assembly. The sequence verified (Eurofins Genomics) The protein purification workflow is based on previously described work [12] , [29] . All protein purification steps were performed at 4 °C. The cell pellet was resuspended in 4 mL Sonication Buffer ddPCR Droplet digital PCR was performed using the Bio-Rad QX200 Droplet Digital PCR system. Reactions were setup using the One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad) with primer and probe . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint

LwCas13a was purified as described previously [14] , with a few modifications. A plasmid expressing 

Experiments were designed and randomised using JMP and Riffyn. Targets were pre-amplified using the Luna Universal One-Step RT-qPCR kit (NEB) with a primer concentration of 500 nM for 45 cycles.

. CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.

The copyright holder for this preprint this version posted May 6, 2020. (Labcyte) from a 6 well reservoir (Labcyte). Extracted RNA templates were transferred using a multichannel pipette. Plates were sealed with MicroAmp Optical Adhesive Films (ThermoFisher Scientific) and spun at 500 g in a centrifuge. An Analytik Jena qTower 3 auto was used for thermocyling and measurements were taken in the FAM channel.

Experiments were designed and randomised using JMP and Riffyn. Targets were pre-amplified using Echo 550 (Labcyte) was used to transfer pre-amplified products (250 nL) from the 384LDV plus echo plate to initiate the reaction, the plate was sealed, centrifuged at 500 g for 1 minute and read using a CLARIOstar Plus (BMG Labtech) with an excitation wavelength of 483-14 nm, emission of 530-30 nm, . CC-BY-NC-ND 4.0 International license It is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint dichroic filter of 502.5 nm and enhanced dynamic range (EDR) enabled. Double orbital shaking of 600 rpm for 30 seconds was performed before the 1 st cycle. The reactions were incubated at 37 °C with readings taken every 2 minutes. Each reaction was normalised between a water input as 0 and an RNase I (ThermoFisher Scientific) input (0.25 U) as 1. Error was calculated as the standard error of three amplification and four CRISPR replicates.

Forward Sequence Reverse Sequence

GAAATTAATACGACTCACTATAGGGACCCCAAAATCAGCGAAAT TCTGGTTACTGCCAGTTGAATCTG

GAAATTAATACGACTCACTATAGGGTTACAAACATTGGCCGCAAA GCGCGACATTCCGAAGAA

GAAATTAATACGACTCACTATAGGGAGCCTTGAATACACCAAAA TGTAGCACGATTGCAGCATTG

Orf1ab-RPA GAAATTAATACGACTCACTATAGGGCGAAGTTGTAGGAGACATTAT ACTTAAACC -3'

Experiments were designed and randomised using JMP and Riffyn. Colorimetric LAMP reactions (NEB WarmStart® Colorimetric LAMP 2X Master Mix) were performed as previously described [8] but with a lower final reaction volume of 5 µL and template of 2 µL. Master Mix, primers and template were transferred to a 384-Well Small Volume LoBase plate (Greiner Bio-One) using an Echo 525 and Echo 550 (Labcyte). The plate was then sealed with a MicroAmp Optical Adhesive Film (ThermoFisher Scientific) and centrifuged for 1 minute at 500 g. The plate was incubated at 65 °C in a CLARIOstar Plus (BMG Labtech) and absorbance measurements were taken at 415 nm every minute for 60 minutes.

Double orbital shaking of 600 rpm for 30 seconds was performed before the 1 st , 6 th , and 11 th cycles. is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted May 6, 2020. . https://doi.org/10.1101/2020.05.02.20088344 doi: medRxiv preprint

Surplus clinical material was used to validate the assay as per normal practice and does not require ethical review.

Coronavirus disease 2019 (Covid-19) Situation Report 51

The species Severe acute respiratory syndrome-related coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2

An interactive web-based dashboard to track COVID-19 in real time

Synthetic biology industry: data-driven design is creating new opportunities in biotechnology

Armored RNA Technology for Production of Ribonuclease-Resistant Viral RNA Controls and Standards

Preparation of his-tagged armored RNA phage particles as a control for real-time reverse transcription-PCR detection of severe acute respiratory syndrome coronavirus

Preparation of armored RNA as a control for multiplex real-time reverse transcription-PCR detection of influenza virus and severe acute respiratory syndrome coronavirus

Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP

Comparative analysis of primer-probe sets for the laboratory confirmation of SARS-CoV-2," bioRxiv

2019-Novel Coronavirus (2019-nCoV) Real-time rRt-PCR Panel Primers and Probes

Data on COVID-19 testing

Bacteriophage MS2 displays unreported capsid variability assembling T = 4 and mixed capsids

Analytical sensitivity and efficiency comparisons of SARS-COV-2 qRT-PCR assays

Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6

Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes

Viral load of SARS-CoV-2 in clinical samples

A protocol for detection of COVID-19 using CRISPR diagnostics

Fast, portable tests come online to curb coronavirus pandemic

Foundation for Innovative New Diagnostics

Effect of large-scale testing platform in prevention and control of the COVID-19 pandemic: an empirical study with a novel numerical model

Scalable and Resilient SARS-CoV-2 testing in an Academic Centre

SPRI bead mix

CRISPR-based COVID-19 surveillance using a genomically-comprehensive machine learning approach

Rapid Detection of 2019 Novel Coronavirus SARS-CoV-2 Using a CRISPR-based DETECTR Lateral Flow Assay

Massively multiplexed nucleic acid detection using Cas13

The use of Armored RNA as a multi-purpose internal control for RT-PCR

Dengue virus-like particles mimic the antigenic properties of the infectious dengue virus envelope

Building a global alliance of biofoundries

One-plasmid double-expression His-tag system for rapid production and easy purification of MS2 phage-like particles

We would particularly like to thank the UK Dementia Research Institute for rapidly funding the initial workflow development and for continuing support via the DRI Care Research and Technology Centre at Imperial College. We also acknowledge funding from UKRI-EPSRC (EP/R014000/1, EP/S001859/1), UKRI-BBSRC (BB/M025632/1) and the National Physical Laboratory (NPL). We would like to thank Graham Taylor, Myra McClure, Arthi Anand, and Panagiotis Pantelidis for their excellent clinical diagnostic guidance during this project and support with the surplus clinical material. We also thank Andrew Griffiths at the DRI Care Research and Technology Centre for project management support.We would also like to thank Analytik Jena and in particular Debra Conway and BMG Labtech for providing equipment and support throughout the process. We also thank Professor Charles Bangham for the use of the QX200 ddPCR setup. MiC would like to thank the Science Team at Riffyn for training and continued support. We thank Matthew Haines in the Freemont lab for critical reading of the