key: cord-0805169-pj91ziaf
authors: Pandey, Anand Kumar; Verma, Shalja
title: An in silico analysis of effective siRNAs against COVID‐19 by targeting the leader sequence of SARS‐CoV‐2
date: 2021-02-28
journal: Adv Cell Gene Ther
DOI: 10.1002/acg2.107
sha: f3b56d69bc484a6d275d008ce3e04aa11ab711c8
doc_id: 805169
cord_uid: pj91ziaf

Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5′ end, which is added to all subgenomic mRNAs at their 5′ terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in‐silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed‐duplex stability, exact complementarity with target, at least three mismatches with any off‐target and least number of off‐targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5′GUUUAGAGAACAGAUCUACAA3′ met almost all specificity criteria with no off‐targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of −327.45 for above‐mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off‐target sequences gave significantly low binding scores. Hence, 5′GUUUAGAGAACAGAUCUACAA3′ siRNA possess great potential to silence the leader sequence of SARS‐CoV‐2 with least off‐target effect. Present study provides great scope for development of gene therapy against the prevailing COVID‐19 disease, thus further research in this concern is urgently demanded.

respectively. It has a positive sense 30 kb RNA genome which is singlestranded. 1 The characteristic transcript of coronavirus contains a 3′ polyA tail and 5′ cap. After entering the host cell, the virus translates non-structural proteins (nsps) from the 2 ORFs (Open reading frames) 1a and 1b. Polypeptide 1a of 440-500 kDa produced from ORF1a cleaves to form 11 nsps. Furthermore, single frameshift of ribosome occurs at the upstream of the stop codon of ORF1a immediately and allows for the continuation of translation of ORF1b thereby yielding a long polypeptide of 740-810 kDa which cleaves to form 15 nsps. 2 The cleavage of polypeptides is performed by proteases nsp5 and nsp3 that contain a 3C like protease and papain enzyme-like protease domain, respectively. 3 For the replication of viral genome and its transcription, nsp12 encodes a protein having an activity of RNAdependent RNA polymerase. 4 that the fusion of body sequence to the leader sequence happen while the negative strand is being synthesized at the small transcription regulatory sequence motifs located in the immediate vicinity of the ORFs. This regulatory sequence has conserved core sequence of 6-7 nucleotides bordered by some variable sequences. 6 During the synthesis of the negative strand, RNA-dependent RNA polymerase, when encounters the transcriptional regulatory sequence, pauses and switch template to leader transcriptional regulatory sequence which leads to discontinuous transcription resulting in fusion of the leader to body sequence. Now these negative sense strand intermediates which have fused leader sequence transcribes into positive-sense strand mRNAs. 7 This leader sequence fused to subgenomic RNAs (5′ACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUU GUAGAUCUGUUCUCUAAACGAAC 3′) is nearly identical to the leader sequence or the 5′ untranslated region of the viral genome. 8 RNA interference or RNAi is a highly specific post-transcriptional mechanism of gene silencing. Utilization of double-stranded DNA for silencing the expression of a gene has proved itself highly effective compared to single antisense or sense strand. 9 Double-stranded RNA mediates gene silencing in a homology-dependent manner and may modulate the expression of genes in viral systems. 10, 11 Small interfering RNA (siRNA) is a double stranded RNA of around 21 nucleotides, which has shown immense potentials in numerous therapeutic and gene function studies. The strand of siRNA which has complementarity with the target gene is the guide strand and the other strand is the passenger strand. 12 The perfect complementarity of the guide strand of siRNA with the target highly enhances the specificity of the silencing mechanism. A drawback associated is silencing of off-target genes or unintended gene down regulation, due to the complementarity of seven nucleotides of seed region of siRNA with the off-target gene. Studies have reported that melting temperature or thermodynamic stability of the duplex of seed siRNA sequence (2-8 nucleotide F I G U R E 1 Genomic structural organization of SARS-CoV-2 genome depicting leader sequence (red), viral ORF 1a and 1b (light brown), structural genes (blue) and non-structural genes (green), that translates into polypeptides 1a and 1ab (dark brown), structural proteins (blue) and non-structural proteins (green) respectively 6 of siRNA guide strand from 5′ end) and the target gene mediates the off-target binding effect. Thus, a siRNA which have perfect complementarity only with the target gene and have low thermostability of seed-target duplex (Tm less than 21.5°C) can effectively eliminate the off-target binding of the siRNA. Also, selection of an siRNA having a minimum of 2 mismatches with any other off-target sequence can further reduce the probability of siRNA to bind to the undesired off-target sequence. 13, 14 Along with seed region the effectiveness of non-seed region of guide strand has also been reported in mediating off target effect but a negative correlation of T m value and GC content with downregulation or off target effect was found. 15 Several studies have shown scope for RNAi (RNA interference) in the treatment of viral infections. Numerous researchers have reported an effective reduction of target viral gene expression by corresponding siRNAs. RNAi-based therapies have been conducted in various cell and animal disease models of polio, Rous sarcoma, HIV, HCV, and HBV viral diseases and have shown a significant reduction in expression of genes involved in viral replication. [16] [17] [18] [19] [20] Efforts have also been made to inhibit essential SARS-CoV genes, including those which mediate replication of the virus, by siRNAs. 21 The leading role of the leader sequence of SARS-CoV-2 makes it a highly operative target which can be focused to develop therapies against COVID-19. Hence, this study deals with the in silico investigation of a potential siRNA against the leader sequence of SAS-CoV-2 and its validation by molecular docking approach.

This study will lead to development of a highly effective gene therapy based on RNAi approach against the ongoing pandemic of COVID-19 by contributing an efficient siRNA sequence-specific for leader sequence, efficient enough to down regulate the replication of SARS-CoV-2 virus effectively by targeting the majority of the genes of the virus.

The leader sequence (5′ACCUUCCCAGGUAACAAACCAACCAAC UUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC 3′) was obtained from SARS-CoV-2 genome (GenBank: MW040697.1) from NCBI database. To find probable siRNAs for the leader sequence, this sequence was subjected to online siRNA finding tool siDirect version 2.0 (http://siDir ect2.RNAi.jp/). The max T m value for seedtarget duplex stability was kept at 21.5°C to reduce off-target effect. Homo sapiens non-redundant database was selected for the analysis of off-target sequences to avoid siRNA prediction against human RNAs. The leading criteria considered for siRNA prediction consists of selection of such sequence, which do not have a seed sequence having exact complementarity with any of the off-target sequence. Moreover three conditions were considered which has to be fulfilled for effective siRNA prediction: presence of A/U in guide strand 5′ terminus, presence of G/C in passenger strand 5′ terminus, minimum of 4 A/U in the seven base pairs at 5′ end of guide strand.

The siRNA having minimum T m value of seed target duplex, no offtarget for the overall guide strand (including both seed as well as non-seed regions) and least number of off-targets for the passenger strand was considered best. 14 To confirm null guide strand offtarget effect, the region of leader sequence targeted by best siRNA was evaluated by Invitrogen BLOCK iT RNAi Designer tool (Thermo 

To evaluate the structural binding potential of siRNAs with the leader sequence, molecular docking was performed by using online server HNADOCK developed by School of Physics, Huang University of Science and Technology. 25 The leader sequence and the sequences of siRNAs guide strands were given as input for evaluating the affinity of siRNAs for the target leader sequence. The siRNA scoring the highest binding score for leader sequence, having the lowest T m value of seed duplex and having the least number of passenger strand off-targets was further considered for off-target effect analysis by molecular docking.

As all the predicted siRNAs were not having any off-target for their whole guide strand sequences, so, predicted passenger strand offtarget sequences and the corresponding sequence of passenger strand of the best-selected siRNA were considered for molecular docking by HNADOCK online server to analyze the potential of best siRNA for showing off-target effect. All the other parameters were kept at default values of the docking tool. The binding energy scores were compared to evaluate the most probable off-target for the best siRNA. 25 The high specificity of siRNA becomes a major concern especially when have to be utilized for the development of gene therapy (Tables 1 and 2 ).

The 4th siRNA having the guide strand sequence 5′

GUUUAGAGAACAGAUCUACAA 3′ with no guide strand offtargets in human, was predicted to have the lowest seed duplex stability with the T m value of 11.7°C and had the minimum number (7 only) of off-target sequences for the passenger stand (Table 2) .

BLAST analysis of whole leader sequence by BLOCK iT RNAi designer with human gene database showed no similar or identical sequence to the leader sequence region targeted by the best con- The most interesting fact revealed by the docking conformations of passenger strand with the off-target sequences was that in none of the docking conformations, the 5′ end of the passenger interacted with the off-target sequences, this might be due to low seed duplex stability or T m value (Table 1 ) and due to the presence of mismatches at the 5′ end (Table 2) . 13 

The increasing victimization rate of the current COVID-19 pan- The present analysis deals with the investigation of highly specific siRNA to target the leader sequence for the development of RNAi based therapy against the virus. Our analysis revealed 5′GUUUAGAGAACAGAUCUACAA3′ as the most potent siRNA with high binding affinity to the target leader sequence along with least seed duplex stability with T m value of 11.7°C and no offtarget sequences for the guide stand. The 7 predicted off-targets for the passenger strands had at least 3 mismatches majority of them lying at the 5′ end of the sequence. Also, the binding scores of the off-target-passenger complexes were significantly low thus depicting very low chances for off-target effect. Henceforth, the predicted potent siRNA shows great scope for the development of RNAi based therapy against the highly infectious SARS-CoV-2;

therefore, further research in this concern is urgently demanded.

As no effective drug or treatment has yet been reported against the deadly virus of SARS-CoV-2 for clinical applications. This study will provide significant contribution in the development of an effective siRNA-based gene therapy against the current pandemic of COVID-19.

There is no conflict of interest among authors.

The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to. No ethical approval was required as this is an in silico prediction study.

Data sharing not applicable to this article as no datasets were generated or analysed during the current study

Anand Kumar Pandey https://orcid.org/0000-0003-3256-4663

Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2): an update

Coronavirus diseases 2019: current biological situation and potential therapeutic perspective

The SARS-CoV-2 main protease as drug target

Structure of replicating SARS-CoV-2 polymerase

A structural view of SARS-CoV-2 RNA replication machinery: RNA synthesis, proofreading and final capping

The coding capacity of SARS-CoV-2

The architecture of SARS-CoV-2 transcriptome

Direct RNA sequencing and early evolution of SARS-CoV-2

Silencing disease genes in the laboratory and the clinic

Therapeutic siRNA: state of the art

Editorial focus: understanding offtarget effects as the key to successful RNAi therapy

Preclinical and clinical development of siRNA-based therapeutics

Optimal choice of functional and off-target effect-reduced siRNAs for RNAi therapeutics

Ui-Tei K. siDirect 2.0: updated software for designing functional siRNA with reduced seeddependent off-target effect

The siRNA non-seed region and its target sequences are auxiliary determinants of off-target effects

Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches

siRNA-based approaches in cancer therapy

RNA interference approaches for treatment of HIV-1 infection

Inhibition of hepatitis C virus replication by intracellular delivery of multiple siRNAs by nanosomes

RNAi for treating hepatitis B viral infection

Inhibition of genes expression of SARS coronavirus by synthetic small interfering RNAs

siRNA targeting the leader sequence of SARS-CoV inhibits virus replication

Computational identification of small interfering RNA targets in SARS-CoV-2

Research and development on therapeutic agents and vaccines for COVID-19 and related human coronavirus diseases

HNADOCK: a nucleic acid docking server for modeling RNA/DNA-RNA/DNA 3D complex structures

Structural foundations of RNA silencing by argonaute

Inhibition of SARS-CoV replication by siRNA

An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2