key: cord-0790596-7e008rcl
authors: Cubides-Diaz, Diego Alejandro; Muñoz Angulo, Natalia; Martin Arsanios, Daniel Augusto; Ovalle Monroy, Ana Lucia; Perdomo-Rodriguez, Daniel Ricardo; Del-Portillo, Maria Paula
title: Pandoraea pnomenusa Superinfection in a Patient with SARS-CoV-2 Pneumonia: First Case in the Literature
date: 2022-03-18
journal: Infect Dis Rep
DOI: 10.3390/idr14020025
sha: 142a4c9634e7424589a896d886ca0b52e0826353
doc_id: 790596
cord_uid: 7e008rcl

Pandoraea pnomenusa is a Gram-negative bacterium of the Pandoraea genus and is mainly associated with the colonization of structurally abnormal airways. During the COVID-19 pandemic, many microorganisms have been associated with coinfection and superinfection in SARS-CoV-2 pneumonia, but so far, no coinfection or superinfection by P. pnomenusa has been reported. We present the first case describing this association in a previously healthy patient. Clinical manifestations, treatment, and outcomes are shown.

The genus Pandoraea was first described in the year 2000, initially erroneously classified in the genera of Burkholderia cepacia and Ralstonia paucula or picketti [1] . This genus includes Gram-negative, aerobic, non-fermenting, non-spore-forming, and non-polar flagellated bacilli and is isolated from soil, water, and cystic fibrosis patients [2] . Pandoraea pnomenusa usually presents with resistance to multiple antimicrobials, including most beta-lactams. Among the resistance mechanisms, it presents an intrinsic OXA-type ß-lactamase and a gyrB gene [3] . Colonization of structurally abnormal airways is the usual presentation in humans. Though infection is rare, when it occurs, mortality rates are high, reaching up to 60% [2, [4] [5] [6] [7] . To our knowledge, this is among the first 10 cases of documented infection by this microorganism and the first one in a patient with SARS-CoV-2 pneumonia.

A 55-year-old male without medical records presented to the emergency department following a 10-day history of cough, shortness of breath, asthenia, and adynamia. Upon physical examination, lung auscultation revealed diminished respiratory sounds and crackles in both lungs, without other relevant findings. Initial laboratory findings are shown in Table 1 , and admission chest angiotomography is shown in Figure 1 . A SARS-CoV-2 antigen test was positive and bacterial coinfection was suspected, so corticosteroids with dexamethasone 6 mg daily and antibiotic therapy with ampicillin/sulbactam 3 g every 6 h were initiated. On day 3 of admission, the inflammatory response persisted, so he was admitted to the intensive care unit for clinical surveillance. On day 5 of admission, he persisted tachypneic with labored breathing. Arterial blood pressure, temperature, and heart rate were normal, but high flow oxygen support was required to maintain an oxygen saturation of ≥90%. Later on, he worsened, requiring mechanical ventilation and vasopressor support. Cultures and respiratory molecular panels were collected. Respiratory nested multiplex polymerase chain reaction (PCR) was positive for Klebsiella pneumonie (BIN 10 5 ) and Serratia marcescens (BIN 10 5 ) without the detection of resistance genes. Antibiotic therapy was changed to cefepime at a dose of 6 g in a continuous infusion, with partial clinical response. Eight days after admission, the patient presented again with fever and a non-modulated inflammatory response; thus, antibiotic therapy was escalated to meropenem 6 g in continuous infusion plus linezolid 600 mg twice daily, under the suspicion of multidrug-resistant microorganisms. New cultures were taken, and P. pnomenusa was isolated from the respiratory secretion culture (35 × 10 5 colony-forming units), identified by MALDI-TOF. Murray criteria were used, and contamination was ruled out since there was clinical deterioration and no other microorganisms were isolated. Since the mentioned microorganism does not have a breakpoint prespecified in CLSI (Clinical & Laboratory Standards Institute), disk diffusion susceptibility tests were run for ciprofloxacin and co-trimoxazole using a non-Enterobacterales breakpoint, and treatment was changed on day 10 to both agents at doses of 400 mg twice daily and 240/1200 mg thrice daily, respectively, with later adjustment of co-trimoxazole to renal function. The agar and resistance profiles are displayed in Figure 2 and Table 2 . Three days after the initiation of the new antibiotic scheme, the inflammatory response started to wane and fever abated. On day 18 of hospitalization, tracheostomy was performed without complications; renal support was required with continuous venovenous hemodiafiltration due to persistence of acute kidney injury, volume overload, and anuria. After the completion of 14 days of antibiotic therapy, the inflammatory response was completely eliminated. Eventually, respiratory weaning from mechanical ventilation was achieved, and renal replacement therapy was discontinued. He was discharged from the ICU on day 30 of hospitalization and continued respiratory and physical rehabilitation thereafter. Tracheostomy was decannulated on day 35, and the patient was discharged from the hospital on day 41 with supplementary oxygen and minimal sequelae, including physical and respiratory deconditioning and anxiety disorder related to the long hospital stay.

Pandoraea is a bacterial genus described in the year 2000 by Coenye et al., who performed a taxonomic study on a group of bacteria identified as Burkholderia cepacia, Ralstonia pickettii, and Ralstonia paucula; these organisms were isolated from soil, water, and cystic fibrosis patients [1] . According to genotypic and phenotypic characteristics, they were classified in the new genus Pandoraea in order to group this series of specific strains, which were previously considered to belong to another genus with similar characteristics and phylogenetics. This group includes aerobic, non-fermenting, non-spore-forming, non-polar, flagellate Gram-negative bacilli [2] . Up to 10 species of Pandoraea have been described, but P. apista, P. pnomenusa, P. pulmonicola, and P. sputorum have been isolated Table 2 . Antibiogram and resistance profile of P. pnomenusa isolated from respiratory secretion.

Pandoraea pnomenusa 35 × 10 5

Ciprofloxacin (5 µg After the completion of 14 days of antibiotic therapy, the inflammatory response was completely eliminated. Eventually, respiratory weaning from mechanical ventilation was achieved, and renal replacement therapy was discontinued. He was discharged from the ICU on day 30 of hospitalization and continued respiratory and physical rehabilitation thereafter. Tracheostomy was decannulated on day 35, and the patient was discharged from the hospital on day 41 with supplementary oxygen and minimal sequelae, including physical and respiratory deconditioning and anxiety disorder related to the long hospital stay.

Pandoraea is a bacterial genus described in the year 2000 by Coenye et al., who performed a taxonomic study on a group of bacteria identified as Burkholderia cepacia, Ralstonia pickettii, and Ralstonia paucula; these organisms were isolated from soil, water, and cystic fibrosis patients [1] . According to genotypic and phenotypic characteristics, they were classified in the new genus Pandoraea in order to group this series of specific strains, which were previously considered to belong to another genus with similar characteristics and phylogenetics. This group includes aerobic, non-fermenting, non-spore-forming, non-polar, flagellate Gram-negative bacilli [2] . Up to 10 species of Pandoraea have been described, but P. apista, P. pnomenusa, P. pulmonicola, and P. sputorum have been isolated most commonly from respiratory samples from cystic fibrosis patients and are related to death, poor clinical outcomes, and the potential to decrease lung function and increase pulmonary exacerbations [8, 9] . Pandoraea spp. is also frequently associated with co-colonization by other respiratory pathogens, most notably P. aeruginosa [10] .

To characterize this species, Robson et al. sequenced two Pandoraea strains isolated from patients with chronic respiratory diseases, both of which belonged to the P. pnomenusa species [10] . When compared to an environmental P. pnomenusa, these respiratory strains had 152 unique genes, most of which are associated with increased virulence and antimicrobial resistance [10] . Additionally, accurate genus and species identification by routine clinical microbiological methods is very difficult, and differentiation from Burkholderia cepacia complex organisms is problematic. Reliable identification requires 16S ribosomal DNA sequence analysis by PCR [1] , which allows a significant reduction in the misidentification of Pandoraea spp. as Burkholderia cepacia complex isolates. Bayjanov et al. performed a genetic characterization of Pandoraea strains recovered from cystic fibrosis patients, revealing that some strains identified as P. pnomenusa, P. sputorum, P. oxalativorans, and P. pulmonicola belonged to another species of Pandoraea. Therefore, classification based solely on taxonomic characteristics of the Pandoraea genus could lead to misclassification of these microorganisms [9] .

P. pnomenusa has been reported to be resistant to multiple antimicrobials, including most beta-lactams. Among the resistance mechanisms reported in some studies, an intrinsic OXA-type ß-lactamase, more precisely the P. pnomenusa-related OXA-62, and in a lower proportion, a gyrB gene, are the most important ones. OXA-62 is a class D carbapenemhydrolyzing β-lactamase that appears to be specific in P. pnomenusa, allowing its easier identification. The preferred substrates of this enzyme are benzylpenicillin, amoxicillin, oxacillin, and the slow hydrolysis of carbapenems. It has no activity against ceftazidime, cefotaxime, or aztreonam [3] .

Only five cases of infection by P. pnomenusa have been reported in the literature and are presented in Table 3 . There are, however, more cases of colonization, mainly in patients with chronic pulmonary conditions such as cystic fibrosis. To our knowledge, this is the first case report of a respiratory superinfection in a patient without chronic pulmonary disease. The only predisposing factor was an acute SARS-CoV-2 infection, which represents a state of immunosuppression and hyperinflammation of the respiratory system.

Regarding microbiological identification, initially, we used chocolate agar, which showed typical colonies (circular, grayish, and opaque), incubated aerobically at 37 • C for 48 h (two to three days are required for this microorganism to grow in a selective medium) [11] . Since phenotypic identification is not reliable, molecular techniques were applied using MALDI-TOF MS with the Microflex LT mass spectrometer with the Flex-Control 3.0 and MALDI BioTyper 2.0 and 3.0 software programs, identifying the isolate as P. pnomenusa with values indicating secure genus identification and probable species identification. Subsequently, identification was performed with PCR and sequencing of 16S rRNA [12, 13] using the primers: pnoF and pnoR with sequences (5 -3 ) "CAGTGGGGAATTTTGGACAATGGGCGA" and "CGAGCACTCCCACCTCTCAGCAGGA", respectively, specifically designed for the detection of P. pnomenusa with a product of 673 bp [1, 14] . Antibiotic susceptibility testing was performed using antimicrobials that are presumably effective against this microorganism, namely, ciprofloxacin and co-trimoxazole. Since CLSI and EUCAST lack breakpoints for disk diffusion for non-Enterobacterales and lack specific breakpoints for P. pnomenusa, the decision to use these antimicrobials was extrapolated from the breakpoints for disk diffusion for Burkholderia cepacia complex and Pseudomonas aeruginosa using CLSI standards of 2020 [15] . Cases of P. pnomenusa infection reported in high-impact journals also extrapolated breakpoints from other non-Enterobacterales such as P. aeruginosa for determining sensitivity and making therapeutic decisions [5, 7] .

The mechanisms by which SARS-CoV-2 infection leads to airway immunosuppression are currently under investigation. It has been recognized that infected ciliated cells shed their ciliary axonemes, which disables mucociliary clearance, increases secretion accu-mulation, and probably promotes disease progression [16] . Additionally, the epithelium infection dampens the interferon response, especially alpha, beta, and lambda interferon gene transcription [16] . These changes are similar to those observed in patients with cystic fibrosis, where there is ciliary movement impairment leading to secretion accumulation and high salt concentration in the airways. This high salt concentration leads to the inhibition of antimicrobial peptides, including human β-defensins, and a subsequent increased infection susceptibility [17] . Additionally, two other mechanisms predispose to acquiring superinfections: hypermethylation of the interferon 1 gene, which leads to a decrease in interferon 1 concentrations in the airways [18] , and the synthesis of pro-inflammatory cytokines, which are harmful to host cells [19] . This cytokine release syndrome, exhaustion of the immune system, and lung damage in patients with SARS-CoV-2 infection might lead to a state of immunosuppression, increasing susceptibility to superinfection by unusual microorganisms such as P. pnomenusa. These microorganisms, which are usually associated with colonization rather than infection in patients with structurally abnormal lungs, may gain clinical relevance in the course of coronavirus disease and could worsen the clinical course and outcomes in patients with acute respiratory infections. 

In the last 20 years, P. pnomenusa has been reported as the cause of microbial colonization of structurally abnormal airways. Infection is rare but has been associated with high mortality rates and usually requires antimicrobial therapy with non-beta-lactam broadspectrum antibiotics. The association of these kinds of unusual infections with SARS-CoV-2 pneumonia is increasing; however, prior to this study, no superinfection with P. pnomenusa had been reported. More research is needed to elucidate the pathogenicity of bacterial superinfection in patients with COVID-19. 

The patient consented to the publication of material concerning his health condition. Written informed consent was given to and retained by authors.

Data Availability Statement: All relevant information is presented in the case report. Any additional data may be made available on reasonable request from the corresponding author.

The authors declare no conflict of interest.

Clinical & Laboratory Standards Institute COVID- 19 Coronavirus disease 2019 EUCAST European Committee on Antimicrobial Susceptibility Testing MALDI-TOF Matrix-assisted laser desorption/ionization-time of flight PCR Polymerase chain reaction SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2

Identification of Pandoraea species by 16S ribosomal DNA-based PCR assays

Multiple Organ Failure, and Death Due to Pandoraea pnomenusa Infection after Lung Transplantation

Novel Carbapenem-Hydrolyzing Oxacillinase OXA-62 from Pandoraea pnomenusa

Bacteriemia asociada a catéter por Pandoraea pnomenusa en un paciente pediátrico con leucemia aguda linfoblástica

Pandoraea pnomenusa Isolated from an Australian Patient with Cystic Fibrosis

Prosthetic aortic valve dehiscence following infective endocarditis by a rare bacterium-Pandoraea pnomenusa

Possible Prosthetic Valve Endocarditis by Pandoraea pnomenusa and Specific Virulence Mechanisms

Epidemic spread of Pandoraea apista, a new pathogen causing severe lung disease in cystic fibrosis patients

Whole-genome analysis of Pandoraea species strains from cystic fibrosis patients

Genome Sequences of Two Pandoraea pnomenusa Isolates Recovered 11 Months Apart from a Cystic Fibrosis Patient

Diagnóstico microbiológico de la colonización-infección broncopulmonar en el paciente con fibrosis quística

Misidentification of Pandoraea sputorum Isolated from Sputum of a Patient with Cystic Fibrosis and Review of Pandoraea Species Infections in Transplant Patients

Clinical and Microbiological Features of a Cystic Fibrosis Patient Chronically Colonized with Pandoraea sputorum Identified by Combining 16S rRNA Sequencing and Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry

Isolation and identification of Pandoraea spp. From bronchoalveolar lavage of cystic fibrosis patients in Iran

EM100 Connect-CLSI M60 ED2:2020 n.d. Available online

Respiratory epithelial cell responses to SARS-CoV-2 in COVID-19

Association of β-defensin-1 gene polymorphisms with Pseudomonas aeruginosa airway colonization in cystic fibrosis

Cystic Fibrosis Lung Transplant Recipients Have Suppressed Airway Interferon Responses during Pseudomonas Infection

Superinfections in COVID-19 Patients: Role of Antimicrobials