key: cord-0764011-tuax8axn
authors: Kang, Tae-Jin; Loc, Nguyen-Hoang; Jang, Mi-Ok; Jang, Yong-Suk; Kim, Young-Sook; Seo, Jo-Eun; Yang, Moon-Sik
title: Expression of the B Subunit of E. coli Heat-labile Enterotoxin in the Chloroplasts of Plants and its Characterization
date: 2003
journal: Transgenic Res
DOI: 10.1023/b:trag.0000005114.23991.bc
sha: 50e66b341a99b63f136f8fa8503dcdbe99a78689
doc_id: 764011
cord_uid: tuax8axn

Transgenic chloroplasts have become attractive systems for heterologous gene expressions because of unique advantages. Here, we report a feasibility study for producing the nontoxic B subunit of Escherichia coli heat-labile enterotoxin (LTB) via chloroplast transformation of tobacco. Stable site-specific integration of the LTB gene into chloroplast genome was confirmed by PCR and genomic Southern blot analysis in transformed plants. Immunoblot analysis indicated that plant-derived LTB protein was oligomeric, and dissociated after boiling. Pentameric LTB molecules were the dominant molecular species in LTB isolated from transgenic tobacco leaf tissues. The amount of LTB protein detected in transplastomic tobacco leaf was approximately 2.5% of the total soluble plant protein, approximately 250-fold higher than in plants generated via nuclear transformation. The GM1–ELISA binding assay indicated that chloroplast-synthesized LTB protein bound to GM1-ganglioside receptors. LTB protein with biochemical properties identical to native LTB protein in the chloroplast of edible plants opens the way for inexpensive, safe, and effective plant-based edible vaccines for humans and animals.

The expression and delivery of recombinant protein antigens as edible vaccines is attractive because of the numerous advantages that it offers, such as low production cost, easy administration and storage (Giddings et al., 2000) . The chances of acquiring mucosal immunity against infectious agents that enter the body across a mucosal surface are also increased with edible vaccines (Tacket et al., 1998) . However, the use of subunit vaccines for oral delivery has been resisted * Author for correspondence E-mail: mskyang@moak.chonbuk.ac.kr because of the obvious likelihood of protein degradation in the gut. Recently, transgenic plants have been investigated as an alternative means of producing and delivering vaccines. Indeed, Norwalk virus capsid protein (Tacket et al., 2000) , transmissible gastroenteritis coronavirus glycoprotein (Tuboly et al., 2000) , hepatitis B surface protein (Kong et al., 2001) , and foot and mouth disease virus VP1 (Dus Santos et al., 2002) have been successfully expressed in plants. The quantity of plant tissue constituting a vaccine dose must be of a practical size for consumption. However, the level of protein expression achieved in plants is as low as 0.01% and rarely exceeds 0.40% of the total soluble proteins (TSP) (Haq et al., 1995; Gomez et al., 1998; Richter et al., 2001; Mason et al., 2002) . Thus, a high level of expression in plants is critical (Stoger et al., 2002) . A dramatic increase in the recombinant protein yield can be achieved using chloroplast transformation, especially in tobacco, since a leaf cell contains as many as 100 chloroplasts with up to 100 plastid DNA copies each, for a total of approximately 10,000 genome copies per cell. The Bt Cry2Aa2 operon contributed 45.3% of the TSP (De Cosa et al., 2001) and CTB at 4.1% of TSP (Daniell et al., 2001) when they were expressed in tobacco leaf chloroplasts. In other plant chloroplasts, the aadA gene was expressed at 1% of TSP in tomato (Ruf et al., 2001) and 5% of GFP expressed in potato chloroplasts (Sidorov et al., 1999) . Therefore, transgenic plastids are ideal expression factories for high-yield protein production (Bock, 2001) , and it will be possible to express chloroplast transgenes in edible crops, for use as edible vaccines.

Transformation of the plastid genome (plastome) has several more advantages over nuclear transformation. Since plastids in most agronomically important plant species are maternally inherited, field management of transplastomic plants may be simpler, because pollen-mediated outcrossing is not a problem (Daniell et al., 1998; Scott & Wilkinson, 1999; Lutz et al., 2001) . Additionally, multiple genes can be introduced and expressed by polycistronic operon expression in a single plastid transformation event (Staub & Maliga, 1995) . Since the foreign gene is integrated by homologous recombination, the location of transgene insertion is predictable, and there are no position effects, as normally experienced with random insertion of transgenes in nuclear transformation (Svab et al., 1990) . Lastly, gene silencing has not been reported in plastids; therefore, transgene expression is stable in the progeny of transplastomic plants.

Enterotoxigenic E. coli (ETEC) causes severe watery diarrhea due to the production of one or more enterotoxins. One of these is a high-molecular weight heat-labile toxin (LT), which is immunologically and physicochemically related to cholera toxin (CT) (Clements & Finkelstein, 1979; Clements et al., 1980) . Each molecule has one 27 kDa A subunit, which has toxic ADP ribosyl transferase activity, and a pentamer of 11.6 kDa B (binding) subunits, which are noncovalently linked into a very stable doughnutlike structure. LT and CT bind via specific interactions of the B subunit pentamer with the GM1-ganglioside present on the intestinal epithelial cell surface. Both heat-labile enterotoxin (LTB) and CTB function as adjuvants for co-administered antigens (Dickinson, 1996; Elson, 1996) as well as immunogens (Clements & Finkelstein, 1978; Gilligan et al., 1983) . When recombinant LTB (rLTB) was expressed in Bacillus brevis and administered intranasally to mice with diphtheria toxoid (D T ), it substantially stimulated production of D T -specific serum IgG antibody and induced moderate D T -specific mucosal IgA antibody responses in the nasal cavity and lung, suggesting that purified rLTB is a promising immuno-adjuvant for mucosal immunizations (Kozuka et al., 2000) . It has been shown that recombinant multimers of the B subunits of LT and CT can be produced successfully in potato and that they are immunogenic when taken orally by animals Lauterslager et al., 2001) and humans (Tacket et al., 1998) . However, LTB formed less than 0.01 and 0.19% of TSP when expressed in the nucleus of tobacco (Haq et al., 1995) and potato (Mason et al., 2001) , respectively. High expression of LTB in plants is necessary for its use as an edible vaccine. This paper reports the efficient high expression of LTB in tobacco chloroplasts and its binding to GM1-ganglioside in order to investigate the functional pentameric structure.

Seeds of Nicotiana tabacum cv TI560 were surfacesterilized with 70% ethanol for 3 min followed by 15 min in 10% sodium hypochlorite. Seeds were then washed five times in sterile water before being placed in Petri dishes containing MS salts (4.6 g l −1 ) supplemented with sucrose (30 g l −1 ) and bactoagar (7.5 g l −1 ) at pH 5.7, and grown in an environmentally controlled culture room at 25 • C on a photoperiod of 16 h light/8 h dark photoperiod.

The plasmid, pLD-CtV2, was originally constructed for stable plastid transformation in tobacco (De Cosa et al., 2001) . LTB was prepared from genomic DNA of E. coli strain 1032, which was amplified by PCR using primers designed to introduce a ribosome binding site (GGAGG) eight bases upstream from the start codon in the native LTB from which the signal peptide coding sequence was removed. The forward (5 -GGGGAATTCAGGAGGTTCAGTCATGGCTCCCC AGTCTATTACAGAAC-3 ) and reverse (5 -GGGGG TACCCTAGTTTTCCATACTGATTGC-3 ) primers contained EcoRI and XbaI sites, respectively. The denaturation, annealing and extension reactions were performed at 94 • C for 1 min, 55 • C for 1 min, and at 72 • C for 1 min, respectively. The reaction was repeated for a total of 30 cycles in a volume of 50 µl. The PCR product was cloned into TA cloning vector pGemTeasy (Promega) and the EcoRI and XbaI fragment was ligated into the same sites of pLD-CtV2. The resulting plasmid was named pMY-CH-LTB. The LTB gene was also expressed in E. coli M15, and the rLTB protein was purified using QIAexpress System (Qiagen) according to the manufacturer's instructions.

The leaves of tobacco grown aseptically on hormone free MS agar medium described in the section 'Plant Material' were cut and placed on filter paper on top of the MS agar medium before bombardment. The tobacco leaves were then bombarded with gold (1 µm) or tungsten (0.7 µm) particles using a Biolistic PDS-1000/He Particle Delivery System (BioRad) following the manufacturer's instructions and placed in a culture room at 25 • C. Two to 3 days after bombardment, the leaves were cut into about 0.5 cm 2 pieces and placed on RMOP selection medium (Daniell, 1997) containing 500 mg l −1 spectinomycin. The shoots generated from the selection medium after 5-6 weeks were cut into smaller pieces (∼0.2 cm 2 ) and placed on selection medium.

Total genomic DNA was extracted by the method of Kang and Fawley (1997) . The primer pairs used to amplify the LTB fragment from genomic DNA were 1F (5 -AAAACCCGTCCTCAGTTCGGATTGC-3 ) and 1R (5 -CCGCGTTGTTTCATCAAGCCTTA CG-3 ), 2F (5 -CTGTAGAAGTCACCATTGTTG TGC-3 ) and 2R (5 -TGACTGCCCACCTGAGAGC GGACA-3 ), 3F (5 -TCCTCAGTTCGGATTGCAG GC-3 ) and 3R (5 -GGGGGTACCCTAGTTTTCCA TACTGATTGC-3 ), and 4F (5 -GGGGAATTCAGG AGGTTCAGTCATGGCTCCCCAGTCTATTACAGA AC-3 ) and 4R (5 -TATGCCATCCTAAGGTGCTG C-3 ). PCR was performed with DNA isolated from transformed and wild-type plant leaves using con-ditions as described in the section 'Construction of chloroplast expression vector'.

Southern blot analysis was performed as described in Sambrook and Russell (2001) . Aliquots (10 µg) of total genomic DNA from the leaves of transformed and wild-type plants were digested with BglII and electrophoresed on a 0.8% agarose gel, which was then transferred to Hybond-N+ membrane (Amersham). The blot was hybridized with a 32 Plabeled random-primed (Promega) probe at 65 • C in a Hybridization Incubator (Finemould Precision Ind. Co., Korea). After hybridization overnight, blots were washed and exposed to X-ray film.

Leaf samples (∼0.5 g) from transplastomic and wildtype tobacco plants grown in a greenhouse were ground in liquid nitrogen and resuspended in 1 ml of extraction buffer (50 mM HEPES, pH 7.5, 10 mM potassium acetate, 5 mM magnesium acetate, 1 mM EDTA, 1 mM dithiothreitol, and 2 mM phenylmethanesulfonyl fluoride). An aliquot (100 µg) of TSP, as determined by Bradford protein assay (Sigma), from transformed and wild-type plants were loaded on 15% SDS-PAGE gels before electrophoresis. Purified LTB expressed in E. coli M15 cells was also loaded in the range of 0.5-4 µg. The separated protein bands were transferred from the gel to Hybond C membranes (Promega) using a Mini Trans Blot TM electrophoretic transfer cell (BioRad). Nonspecific antibody reactions were blocked by incubating the membranes in 25 ml of 5% nonfat dry milk in TBST buffer (TBS with 0.05% Tween-20) with gentle agitation overnight. The membrane was incubated for 2 h at room temperature with gentle agitation in 10 ml of 1:2000 dilution of rabbit anti-LTB antiserum (Immunology Consultants Lab., Inc., OR) in TBST antibody dilution buffer containing 2.5% nonfat dry milk and then washed three times with TBST buffer. The membrane was incubated for 2 h in 1:7000 dilution of anti-rabbit IgG conjugated with alkaline phosphatase (Promega S3731) in TBST buffer and washed three times with TBST buffer, and once with TMN buffer. After washing, the color was developed with BCIP/NBT (USB) in TMN buffer.

LTB protein levels expressed in transgenic tobacco plants were determined using a quantitative ELISA assay. The leaves of transplastomic and wild-type plants were ground in liquid nitrogen and homogenized in bicarbonate buffer, pH 9.6 (15 mM Na 2 CO 3 , 35 mM NaHCO 3 ), and the concentration was determined using Bradford Reagent (Sigma). TSPs from transplastomic and wild-type plants were loaded into a 96-well microtiter plate (Becton) with 100 µl per well of selected concentrations and incubated overnight at 4 • C. The plate was washed three times with washing buffer PBST. The background was blocked by incubation in 1% bovine serum albumin (BSA) in PBS (300 µl per well) at 37 • C for 2 h, and then the wells were washed three times with PBST. The plate was incubated with a 1:5000 dilution of rabbit anti-LTB antibody (Immunology Consultants Lab., Inc., OR) (100 µl per well) in 0.01 M PBS containing 0.5% BSA for 2 h at 37 • C, and washed four times with PBST. The wells were incubated with 1:10000 dilution of goat anti-rabbit IgG conjugated with horseradish peroxidase (Sigma G-7641) (100 µl per well) in 0.01 M PBS containing 0.5% BSA for 2 h at 37 • C, and washed four times with PBST. The plate was finally incubated with 100 µl per well TMB substrates (Pharmingen 2606KC and 2607KC) for 30 min at room temperature in the dark to maximize the reaction rate. After incubation, the reaction was measured at 405 nm in an ELISA reader (Packard, CT).

To determine the ability of LTB to bind to gangliosides, a microtiter plate was coated with monosialoganglioside GM1 (Sigma) by incubating the plate with 100 µl per well GM1 (3.0 µg ml −1 ) in bicarbonate buffer, pH 9.6 at 4 • C overnight. As a control, plates were coated with 100 µl per well BSA (3.0 µg ml −1 ). After three washes with PBST, the plate was blocked with 1% BSA in 0.01 M PBS. The plate was washed three times with PBST, and then the GM1 coated plates were incubated with various concentrations of TSP from transplastomic and wildtype plants in PBS (100 µl per well) for 2 h at 37 • C. The primary and secondary antibody treatments were as described above.

The LTB gene was inserted into a plastid expression cassette. The plasmid pMY-CH-LTB consists of a plastid rRNA operon promoter (Prrn) with a ribosome binding site (GGAGG), the aminoglycoside adenylyltransferase (aadA) gene to provide spectinomycin and streptomycin resistance for selecting stable transformants, and the plastid psbA gene 3 -untranslated region for stabilizing the mRNA.

The plasmid pMY-CH-LTB was introduced into chloroplast genome using the biolistic process. Bombardment of tobacco leaves with DNA-coated tungsten particles was followed by selection on spectinomycincontaining medium (Svab & Maliga, 1993) . Multiple plastid transformation experiments were attempted and selection for spectinomycin resistance eventually yielded cells with uniformly transformed plastid genome populations, which were then regenerated into plants. A second round of selection on spectinomycincontaining medium was performed for transformed plants to produce homoplastomic plants.

Foreign gene integration into chloroplast genome was primarily determined by PCR screening of chloroplast transformants (Figure 1 ). Primer sets 1F-1R, 3F-3R, and 4F-4R were designed to confirm incorporation of the foreign gene into the chloroplast genome at the directed site by homologous recombination. The rationale for this strategy is that there can be no PCR product unless there is site-specific integration, because one primer binds to the native chloroplast genome adjacent to the point of integration and the second primer to the aadA or LTB gene. In addition, the primer set 2F-2R was used to confirm the integration of the LTB gene in tandem with the aadA gene. Therefore, the PCR products in the DNA of all five independent plants using different primer sets (1.65 kb (1F-1R), 2.8 kb (3F-3R), and 1.7 kb (4F-4R) fragments) confirmed site-specific integration in the chloroplast genome. As expected, there was no PCR product in the wild-type tobacco DNA. The transformed tobacco lines showing sitespecific integration according to the PCR product were further analyzed using Southern blot hybridization to verify site-specific integration and to establish copy number. In the chloroplast genome, there are BglII sites upstream from the 16S rRNA gene and downstream from the trnA region, which generate a 4.47 kb fragment when digested with BglII. A transformed chloroplast genome has a foreign gene cassette inserted between the trnI and trnA regions, which increases the size of the BglII fragment to 6.17 kb. Total DNA from each clone and wild-type tobacco were digested with BglII, and the blot was hybridized with a trnI-trnA probe (0.81 kb) labeled with 32 P-dCTP using a DNA labeling system (Prime-a-Gene Labeling System, Promega). The tissue transformed with pMY-CH-LTB showed the expected 6.17 kb fragments, reflecting the presence of the transgene (Figure 2) . The 4.47 kb fragment was found in the wild-type plant, which does not contain a transgene. In transgenic plants, the 4.47 kb fragment was not found, suggest-ing that homoplastomy has been achieved. From this result, it is assumed that genetic stability of transplastomic plants requires homoplastomy .

The two randomly selected transformed plants (lines 2 and 5) were analyzed for the presence of LTB protein by immunoblot analysis with purified bacterial LTB (Figure 3 ). Immunoblot analysis of tobacco plants transformed with the LTB gene revealed an oligomeric LTB protein with molecular weight of 45 kDa (Figure 3(A) ). However, when B subunits were boiled for 10 min, they dissociated into tetramers, trimers, and monomers with molecular weight of 12 kDa similar to the bacteria-derived LTB (Figure 3(B) ). That is consistent with the previous report on the LTB expressed in the nuclear transformation of maize (Chikwamba et al., 2002) . As expected the level of LTB protein accumulation did not differ significantly in the two transplastomic plants because of site-specific integration into the chloroplast genome.

An ELISA assay was used to estimate the LTB protein level in the leaf tissues of transplastomic plant lines 2 and 5. The percentage of LTB protein in each plant was calculated from the total soluble leaf protein used in three replicates of the assay. According to this method, the concentrations of soluble protein loaded in the microtiter plate wells yielded LTB protein levels equal to 2.3 and 2.5% of TSPs in the respective transplastomic plant lines (Figure 4(A) ).

The ability of the B subunits to bind to gangliosides was examined using 96-well plates coated with GM1-gangliosides. In the GM1-ELISA binding assays, chloroplast-produced LTB protein demonstrated a strong affinity for GM1-ganglioside, but not for BSA (Figure 4(B) ). Based on the absorbance measurement used to determine GM1 binding, the LTB protein expression by the two transplastomic plant lines was also very similar. The strong binding efficiencies of plant LTB for GM1 indicate that plant-derived LTB subunit binding to GM1 is cooperative (Schon & Freire, 1989; Merritt et al., 1994 ).

Following the success of Haq et al. (1995) in expressing LTB protein in potato, Mason et al. (1998) fed the transformed potato plants to mice, and found that the LTB in potato tubers stimulated strong serum and mucosal antibody responses against LTB and provided partial protection against oral challenge with LT. Therefore, they demonstrated that the LTB expressed in plants has the potential to be used as an edible vaccine. The production of oligomeric LTB protein in edible plants may induce mucosal and systemic antibodies in mammals at levels sufficient to provide protective immunity against an ETEC challenge after feeding on transgenic plant tissues. It has been reported that the production of LTB in transgenic potato tubers at the level of 0.01% of TSP is sufficient to elicit both systemic and mucosal antibody production in mice, demonstrating the in vitro toxin-neutralization capability of oral immunization (Haq et al., 1995) . However, it may be desirable to increase antigen expression levels to create more effective plant-based oral vaccines for larger animals and humans.

Chloroplasts offer an ideal compartment for the overproduction of foreign proteins. An additional significant advantage of using chloroplasts is their potential to process eukaryotic proteins, including folding and the formation of disulfide bridges. The CT B subunit gene was expressed up to 4.1% tobacco TSP (Daniell et al., 2001) , which is 410-fold greater expression than that of the native LTB gene expressed in the nuclear genome. The chloroplast-synthesized CTB bound to the intestinal membrane GM1-ganglioside receptor, indicating correct folding and disulfide bond formation of CTB pentamers. Another protein that has been expressed in tobacco chloroplasts is human somatotropin (hST), which is used clinically; hST contributed more than 7% of TSP and was expressed in a biologically active, disulfide-bonded form in tobacco chloroplasts (Staub et al., 2000) .

The 2.5% LTB protein of TSP that was observed is approximately 250-fold greater expression than that of LTB via nuclear genome integration (Haq et al., 1995) . Moreover, the expression level may be underestimated, because the band larger than 45 kDa seen in the Western blot analysis (Figure 3(A) ) results from aggregates of oligomers in plant extracts (Daniell et al., 2001) . The chloroplast-synthesized LTB showed a strong affinity for GM1-ganglioside, suggesting that the LTB conserved the antigenic sites for binding and proper folding of pentameric LTB structure. This proves the feasibility of using plastids to express pharmaceutically useful proteins. The LTB expression in the tobacco chloroplasts did not affect growth rates, flowering or seed setting, and we could not morphologically distinguish between the transplastomic and wild-type plants in the greenhouse. This result agrees with the previous report (Daniell et al., 2001) in which transplastomic tobacco plants expressing CTB gene had no pleiotropic effects compared to wild-type plants.

Food plants would be more practical alternatives for the production of heat-labile recombinant protein antigens like LTB or CTB, and the ability of palatable food plant species that can be consumed without cooking, such as bananas, tomatoes, lettuce, carrots, and avocados, to produce vaccine antigens must be evaluated. In tomato, foreign protein accumulation was found not only in the chloroplasts of green leaves, but also in the chromoplasts of tomato fruits (Ruf et al., 2001) . This is the first example of protein expression in the plastids of an edible plant part, and provides the promise of high-level expression of edible vaccines. We are currently attempting to express LTB in the plastids of lettuce and carrot plants.

The development of edible transgenic plants with high expression levels of multimeric LTB and CTB, which can function both as an immunogen and a carrier peptide for other antigen epitopes, will move us closer to a low-cost, convenient, effective and safe strategy for preventing infectious and autoimmune diseases in humans, especially in regions of the developing world where the resources of modern medical technology are largely unavailable.

Transgenic plastids in basic research and plant biotechnology

A functional antigen in a practical crop: LT-B producing maize protects mice against Escherichia coli heat labile enterotoxin (LT) and cholera toxin (CT)

Immunological crossreactivity between a heat-labile enterotoxin(s) of Escherichia coli and subunits of Vibrio chorelae enterotoxin

Isolation and characterization of homogeneous heat-labile enterotoxins with high specific activity from Escherichia coli cultures

Properties of homogeneous heat-labile enterotoxin from Escherichia coli

Efficient elimination of selectable marker genes from the plastid genome by the CRE-lox site-specific recombination system

Recombinant gene expression protocols

Containment of herbicide resistance through genetic engineering of the chloroplast genome

Expression of the native cholera toxin B subunit gene and assembly as functional oligomers in transgenic tobacco chloroplasts

Overexpression of the Bt cry2Aa2 operon in chloroplasts leads to formation of insecticidal crystals

Use of Escherichia coli heat-labile enterotoxin as an oral adjuvant

A novel methodology to develop a foot and mouth disease virus (FMDV) peptide-based vaccine in transgenic plants

Cholera toxin as a mucosal adjuvant

Transgenic plants as factories for biopharmaceuticals

Immunological relationships between cholera toxin and Escherichia coli heatlabile enterotoxin

Expression of immunogenic glycoprotein S polypeptides from transmissible gastroenteritis coronavirus in transgenic plants

Oral immunization with a recombinant bacterial antigen produced in transgenic plants

Variable (CA/GT)n simple sequence repeat DNA in the alga Chlamydomonas

Oral immunization with hepatitis B surface antigen expressed in transgenic plants

Efficient extracellular production of recombinant Escherichia coli heat-labile enterotoxin B subunit by using the expression/secretion system of Bacillus brevis and its mucosal immunoadjuvanticity

Oral immunisation of naive and primed animals with transgenic potato tubers expressing LT-B

Expression of bar in the plastid genome confers herbicide resistance

Edible vaccine protects mice against Escherichia coli heat-labile enterotoxin (LT): potatoes expressing a synthetic LT-B gene

Edible plant vaccines: applications for prophylactic and therapeutic molecular medicine

Galactose-binding site in Escherichia coli heat-labile enterotoxin (LT) and cholera toxin (CT)

Stable genetic transformation of tomato plastids and expression of a foreign protein in fruit

Thermodynamics of intersubunit interactions in cholera toxin upon binding to the oligosaccharide portion of its cell surface receptor, ganglioside GM1

Molecular Cloning: A Laboratory Manual

Low probability of chloroplast movement from oilseed rape (Brassica napus) into wild Brassica rapa

Stable chloroplast transformation in potato: use of green fluorescent protein as a plastid marker

Expression of a chimeric uidA gene indicates that polycistronic mRNAs are efficiently translated in tobacco plastids

High-yield production of a human therapeutic protein in tobacco chloroplasts

Plantibodies: applications, advantages and bottlenecks

High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene

Stable transformation of plastids in higher plants

Immunogenicity in humans of a recombinant bacterial antigen delivered in a transgenic potato

Human immune responses to a novel Norwalk virus vaccine delivered in transgenic potatoes

Immunogenicity of porcine transmissible gastroenteritis virus spike protein expressed in plants

This work was supported by a grant (PF003104-01) from Plant Diversity Research Center of the 21st Century Frontier Research Program funded by Ministry of Science and Technology of Korean government.