key: cord-0758743-ipncwcjp
authors: Baba, Kenji; Mizukoshi, Fuminori; Goto-Koshino, Yuko; Setoguchi-Mukai, Asuka; Fujino, Yasuhito; Ohno, Koichi; Tsujimoto, Hajime
title: Application of RNA interference for inhibiting the replication of feline immunodeficiency virus in chronically infected cell lines
date: 2007-03-10
journal: Vet Microbiol
DOI: 10.1016/j.vetmic.2006.10.033
sha: 8d0569b9fe93d0997ca38060117ffc6381122957
doc_id: 758743
cord_uid: ipncwcjp

RNA interference (RNAi) is a process in which double-stranded RNA induces the post-transcriptional sequence-specific degradation of homologous messenger RNA. The present study was carried out to apply the RNAi technology to inhibit the replication of feline immunodeficiency virus (FIV). Four small interfering RNAs (siRNAs) homologous to the FIV gag gene were synthesized and transfected into a feline fibroblastic cell line chronically infected with FIV (CRFK/FIV). These synthetic siRNAs efficiently inhibited the replication of FIV. Next, we examined the effect of retroviral vector-mediated transfer of FIV-specific short hairpin RNA (shRNA) on the replication of FIV in a feline T-cell line chronically infected with FIV (FL4). The retroviral vector-mediated transfer of FIV-specific shRNA was shown to markedly inhibit the replication of FIV in the FL4 cells. These results provide useful information for the development of RNAi-based gene therapy strategy to control FIV infection.

Feline immunodeficiency virus (FIV) belongs to the genus lentivirus of the family retroviridae. FIV was first isolated in 1987 in the United States and has been reported to induce crucial immunodeficiency in infected cats, which is similar to that in human immunodeficiency virus (HIV)-infected people (Pedersen et al., 1987) . FIV is now widely spread among domestic cats throughout the world including Europe, the United States, Australia, Vietnam, Taiwan and Japan (Ishida et al., 1989; Lin et al., 1995; Malik et al., 1997; Nakamura et al., 2000; Steinrigl and Klein, 2003; Yamamoto et al., 1989) . FIV-infected cats show various degree of immunological impairment resulting in the clinical symptoms including gingivitis, www.elsevier.com/locate/vetmic Veterinary Microbiology 120 (2007) 207-216 stomatitis, upper respiratory tract infections, myelosuppression and opportunistic infections (Bendinelli et al., 1995; Pedersen and Barlough, 1991; Shelton et al., 1990) . Because of the prevalence and various clinical outcomes, FIV infection has been considered as one of the most problematic diseases in small animal practice. A number of antiviral drugs such as reverse transcriptase inhibitors and protease inhibitors, have been shown to inhibit FIV replication in experimentally and naturally FIV-infected cats (Arai et al., 2002; Egberink et al., 1990; Hartmann et al., 1992) . However, severe hematological side effects of their antiviral drugs and insufficient clinical improvements in FIV-infected cats were also reported (Arai et al., 2002; Hartmann et al., 1992) . Therefore, no effective antiviral therapy for FIV-infected cats has been established.

RNA interference (RNAi) is a process of sequencespecific, post-transcriptional gene silencing (PTGS) triggered by double-stranded RNA (dsRNA) homologous to the target transcripts (Fire et al., 1998) . The dsRNAs are processed by RNase III-like enzyme Dicer into small interfering RNAs (siRNAs) of 21-23 nucleotides (Bernstein et al., 2001) . These siRNAs form an RNA-induced silencing complex (RISC), which leads to the degradation of homologous target RNA (Zamore et al., 2000) . Introduction of siRNAs can induce the sequence-specific gene silencing in mammalian cells (Elbashir et al., 2001) . Recent studies have demonstrated that RNAi can be exploited to target a variety of human viruses including HIV-1, poliovirus, human papillomavirus, hepatitis C virus (HCV), hepatitis B virus (HBV), influenza virus and severe acute respiratory syndrome (SARS)-coronavirus (Ge et al., 2003; Gitlin et al., 2002; Jacque et al., 2002; Jiang and Milner, 2002; Randall et al., 2003; Shlomai and Shaul, 2003; Wang et al., 2004) . These findings indicate that RNAi represents a promising gene therapeutic approach to control viral infection.

Most important problems of siRNA are the low efficiency of transfection in primary cells and its transient inhibitory effect (Elbashir et al., 2001) . In contrast, endogenous expression of short hairpin RNA (shRNA) mediated by viral vectors has been shown to induce persistently the sequence-specific gene silence in a variety of primary cells as well as in experimental animals (Rubinson et al., 2003; Xia et al., 2002) . To use the RNAi technology as a strategy of gene therapy for the control of FIV infection, both development of effective delivery method of siRNAs into feline lymphoid cells and achievement of sustained inhibitory effect are required. Lentivirus vector is now recognized to be the most efficient delivery method into non-dividing primary cells. However, it has not been used for clinical practices because the safety of lentivirus vector-mediated gene transfer has not been fully established. On the other hand, retrovirus vector has been applied for several human gene therapy clinical trials (Edelstein et al., 2004) . There have been a number of reports indicating the therapeutic effect of retrovirus vector-mediated transfer of antiviral genes in HIV-infected people (Deeks et al., 2002; Wong-Staal et al., 1998) .

In this study, to investigate the potential of RNAi as a therapeutic strategy for the control of FIV infection, we first examined the effect of chemically synthesized siRNAs homologous to FIV gag gene on the replication of FIV in chronically FIV-infected fibroblastic cells. Next, to deliver FIV-specific shRNA into feline lymphoid cells efficiently and to achieve persistent inhibitory effect on the replication of FIV in these cells, we generated a FIV-specific shRNA expression retrovirus vector and examined its effect on the replication of FIV in a chronically FIV-infected T-cell line.

A feline fibroblastic cell line (CRFK) chronically infected with FIV Petaluma strain (CRFK/FIV) was maintained in Dulbecco's modified Eagle medium (DMEM) (Sigma, St. Louis, MO) containing 10% heat-inactivated fetal calf serum (FCS) and penicillin/ streptomycin. A feline T-cell line, FL4, chronically infected with FIV Petaluma strain was maintained in RPMI 1640 medium (Sigma) supplemented with 10% heat-inactivated FCS and penicillin/streptomycin.

The design of siRNAs was based on general guidelines (Elbashir et al., 2001) . Four siRNAs (G1, G2, G3, and G4) corresponding to gag gene of Petaluma FIV14 (Olmsted et al., 1989 ) (GenBank accession number: M25381) were chosen from the highly conserved sequence of FIV gag gene (Kakinuma et al., 1995) and synthesized (Dharmacon Research, Lafayette, CO). An siRNA (Luc) corresponding to the coding sequence of firefly luciferase was purchased from Dharmacon Research and used as a control. Sequences of the sense and antisense strands of siRNAs targeted to FIV gag gene are shown in Table 1 . The siRNA strands were deprotected and annealed according to the manufacture's instructions.

CRFK/FIV cells were trypsinized and plated at 2 Â 10 5 cells per well (9.6 cm 2 ) in six-well plates 24 h prior to siRNA transfection in DMEM containing 10% FCS without antibiotics. Cationic lipid complexes, prepared by incubating the appropriate amount of indicated siRNA (0.04, 0.2 or 1.0 mM) with 3 ml of Oligofectamine (Invitrogen, Rockville, MD) in 100 ml of Opti-MEM-I medium (Invitrogen) for 20 min, were added to the wells in a final volume of 1 ml. After incubation for 4 h, the cells were washed, and then cultured in DMEM containing 10% FCS for further experiments.

A murine leukemia virus (MLV)-based vector (pSIREN-retroQ: BD Clontech, Palo Alto, CA) containing a human U6 RNA polymerase III promoter driving the expression of shRNA and a puromycin resistance gene expression cassette was used in this study. shRNA oligonucleotides were designed to contain a sense strand of 19-nucleotide sequences followed by a short spacer (TTCAAGAGA), a reverse complement of the sense strand and six thymidines as an RNA polymerase III transcriptional stop signal. To generate FIV gag gene-specific shRNA, two complementary DNA oligonucleotides were annealed and inserted between BamHI and EcoRI sites immediately downstream of U6 promoter (pU6shG4). The pU6shG4 contained siRNA sequence corresponding to gag gene of FIV Petaluma strain (nt 1626-1644 in FIV14 genome). Sequences of the sense and antisense strands are 5 0 -GATCCGCCAGAAAGTACCCTA-GAATTCAAGAGATTCTAGGGTACTTTCTGGCT TTTTTG-3 0 and 5 0 -AATTCAAAAAAGCCAGAAA GTACCCTAGAATCTCTTGAATTCTAGGGTACTT TCTGGCG-3 0 , respectively. A negative control vector, pU6shNC, containing siRNA sequence nonhomologous to mammalian genes was also generated by using a sense oligonucleotide, 5 0 -GATCCGT GCGTTGCTAGTACCAACTTCAAGAGAGTTGG-TACTAGCAACGCACTTTTTTG-3 0 and its antisense oligonucleotide, 5 0 -AATTCAAAAAAGTGCGTTGC TAGTACCAACTCTCTTGAAGTTGGTACTAGCA ACGCACG-3 0 (RNAi-Ready pSIREN-RetroQ Vector Kit: BD Clontech). All of the constructs were verified by nucleotide sequencing. Vesicular stomatitis virus envelope expression plasmid, pVSV-G (BD Clontech), was used to generate the vector virus that could infect feline cells. Table 1 Sequences of siRNAs and corresponding regions in genome of FIV14 clone

GP2-293 cell line (BD Clontech) is a human embryonic kidney (HEK293)-derived packaging cell line that stably expresses gag and pol gene of MLV. The cell line was cultured in DMEM supplemented with 10% heat-inactivated FCS, penicillin/streptomycin, 2 mM L-glutamine and 1 mM sodium pyruvate. To generate VSV-G pseudotyped MLV-based shRNA expression retrovirus vectors, GP2-293 cells in 75 cm 2 flask were cotransfected with a mixture of 15 mg of pVSV-G and 15 mg of pU6shG4 or pu6shNC by using cationic lipid complex method (Lipofectamine 2000: Invitrogen) . After incubation at 37 8C for 4 h, the medium was removed, and the cells were washed with phosphate buffered saline (PBS), and then cultured in fresh medium. The culture supernatants containing the produced viruses were harvested 24, 48 and 72 h after transfection, filtrated through a 0.45 mm-pore size filter, and then centrifuged at 50,000 Â g at 4 8C for 90 min. The viral pellets were resuspended in serumfree DMEM in 1/100 of the initial volume at 4 8C overnight. Aliquots of the concentrated viruses were stored at À80 8C for subsequent use. The concentrated virus stocks were titrated in NIH3T3 cells by colony forming assay. NIH3T3 cells (1 Â 10 5 cells) in DMEM containing 10% heat-inactivated FCS were seeded into wells (9.6 cm 2 ) of six-well culture plates. After incubation at 37 8C for 12 h, the cells were infected with 1 ml of the serial dilutions of each virus stock in the presence of 8 mg of polybrene (Sigma) per ml. After incubation at 37 8C for 48 h, the medium containing viruses were removed, and the cells were washed twice with PBS, and then cultured for 10 days in the presence of 1 mg of puromycin (BD Clontech) per ml. The titers of the virus stocks were prepared to be (2-4) Â 10 7 cfu/ml.

FL4 cells (2 Â 10 5 cells/well) were seeded into wells (3.8 cm 2 ) of a 12-well plate coated with 10 mg of Retronectin (TaKaRa Shuzo, Kyoto, Japan) per cm 2 and inoculated with the retrovirus vectors at a multiplicity of infection (MOI) 10 in a final volume of 1 ml of RPMI 1640 medium containing 10% heatinactivated FCS. After incubation at 37 8C for 48 h, the cells were washed twice with PBS, and then cultured in the presence of 1 mg of puromycin per ml for 10 days to generate its stably transduced cells.

Total cellular RNAs were isolated from cells by using guanidine isothiocyanate method (RNeasy Mini Kit, QIAGEN, Valencia, CA) according to the manufacturer's protocol. The sequences of primers and probes used in this study are previously reported (Goto et al., 2002; Mizuno et al., 2003) and are as follows: a forward primer 413F (5 0 -AAACAG-TAAATGGAGCACCACAGTAT-3 0 , nucleotides (nt) 1040-1065 in pFIV14), a reverse primer 495R (5 0 -TAGCCCCTCTCTTGCCTTCTC-3 0 , nt 1122-1102), an internal probe 440T (5 0 -TAGCACTTGACC-CAAAAATGGTGTCCAATT-3 0 , nt 1067-1095), a forward primer FBA2S (5 0 -TGCTGTCTCTGTA CGCTTCTGG-3 0 , nt 228-249 in feline b-actin mRNA), a reverse primer FBA2R (5 0 -TGTG GGTGACCCCGTCC-3 0 , nt 287-270) and a internal probe FBATP (5 0 -CGCACCACTGGTATTGTCATG-GACTCTG-3 0 , nt 251-268). The probes were labeled with a reporter dye, 6-carboxyfluorescein (FAM) and a quencher dye, 6-carboxytetramethylrodamine (TAMRA) at their 5 0 and 3 0 ends, respectively. Total RNA from each sample was subjected to reverse transcription and polymerase chain reaction (PCR) amplification with a TaqMan Gold RT-PCR kit (Applied Biosystems, Foster City, CA) according to the manufacturer's protocol. In brief, a master mixture containing all reagents required for RT-PCR was prepared: 1Â TaqMan buffer A, 0.2 mM dNTPs, 5 mM magnesium chloride, 0.25 U of MultiScribe reverse transcriptase per ml, 0.4 U of RNase inhibitor per ml, and 0.05 U of AmpliTaq Gold DNA polymerase per ml. Total RNA extract (200 ng of total RNA per tube) was added to the master mixture. This mixture was used for assays of FIV RNA and b-actin mRNA used as an internal control to give a final probe concentration of 200 nM and a final concentration of each primer of 900 nM, and the total reaction volume was adjusted to 50 ml. The target and internal control were reverse transcribed at 48 8C for 30 min, held at 95 8C for 10 min to activate AmpliTaq Gold, and subjected to PCR consisting of 40 cycles of denaturation at 95 8C for 15 s and annealing/polymerization at 60 8C for 1 min, with a ABI PRISM7700 sequence detector (Applied Biosystems). The PCR cycle number at the threshold line was represented as C T . The difference between C T for the target and C T for the internal control, DC T , was calculated. The DC T values were used to estimate the amounts of FIV RNA. According to the manufacturer's instructions, 2 ÀDC T values were calculated, giving a predicted amount of FIV RNA in comparison to that of b-actin mRNA.

Ten microliters of the cell-free culture supernatant was added to 50 ml of RT buffer containing 5 mg of poly (A) (Sigma) per ml, 0.16 mg of oligo (dT) (Roche Diagnostics, Indianapolis, IN) per ml, 0.1% Nonidet NP-40, 60 mM Tris-HCl, 75 mM KCl, 5 mM MgCl 2 , 1 mM EDTA, 4 mM DTT and 10 mCi of [ 32 P] dTTP (Amersham Biosciences, Piscataway, NJ) per ml. After incubation at 37 8C for 3 h, 10 ml of the mixtures were spotted onto DEAE filter papers (Wallac Oy, Turku, Finland) and washed four times with 2Â SSC (1Â SSC is 0.15 M sodium chloride plus 15 mM sodium citrate) and once with 99% ethanol. The filter papers were then dried, and the incorporated radioactivity on the filter paper was measured with autoradiography. RT-activity per ml of culture supernatant was calculated from the value of incorporated radioactivity per 10 ml of each reaction mixture.

One-way analysis of variance (ANOVA) was used to test for a significant difference in each RT activity in the culture supernatants. If a significant difference was found by ANOVA, Tukey-Kramer's honestly significant difference test was performed to determine which pair showed the difference. Statistical significance was defined as P < 0.05.

We examined the effect of four siRNAs homologous to gag gene of FIV Petaluma FIV14 clone (G1, G2, G3, and G4) on the replication of FIV in CRFK/FIV cells.

An siRNA homologous to firefly luciferase (Luc) was used as a control. RT activity in the culture supernatant 48 h after transfection was significantly (P < 0.05) reduced in the cells transfected with G1, G3 or G4-siRNA compared to those in mock-transfected and anti-Luc siRNA-transfected cells (Fig. 1) . Among the four anti-FIV siRNAs, G4-siRNA showed the strongest inhibitory effect on the replication of FIV.

To evaluate the dose-dependency of the inhibitory effect of anti-FIV siRNA on the replication of FIV, we examined the effect of G4-siRNA on the replication of FIV in CRFK/FIV cells at various concentrations. Transfection with G4-siRNA resulted in significant (P < 0.05) reduction of the amount of FIV RNA in the cells in a dose-dependent manner whereas those in the cells transfected with Luc-siRNA at any concentrations were not different from that in mock-transfected cells (Fig. 2a) . Corresponding to the reduction of the amount of FIV RNA, RT activity in the culture supernatant 48 h after transfection with G4-siRNA was also reduced in a dose-dependent manner (Fig. 2b) . These results indicated that siRNA homologous to FIV gag gene could specifically G4-siRNA was examined at several time points. RT activity in the culture supernatant was lowest 48 h after transfection (78% and 96% reduction at 200 nM and 1 mM, respectively) and then gradually increased (Fig. 3) . These results indicated that the inhibitory effect of siRNA homologous to FIV gag gene was transient in chronically FIV-infected cells.

The effect of retrovirus vector-mediated transfer of FIV-specific shRNA on the replication of FIV was investigated in FIV-infected T cells. FL4 cells, feline T-cell line chronically infected with FIV Petaluma strain, were inoculated with VSV-G pseudotyped retrovirus vector with a construct to express FIVspecific shRNA, and stably shRNA-expressing cells were selected by cultivation in the presence of puromycin. Replication of FIV in these cells was examined 2 weeks after the inoculation with the retrovirus vectors.

The amount of FIV RNA was significantly (P < 0.05) smaller in the cells infected with the retrovirus vector with a construct to express shRNA specific to FIV (shG4) (2 ÀDC T value, 0.138 AE 0.024) than in untreated cells (0.709 AE 0.051) and the cells infected with the control retrovirus vector expressing shRNA non-homologous to mammalian genes (shNC) (0.559 AE 0.035) (Fig. 4a) .

Furthermore, RT activity in the culture supernatant was also significantly (P < 0.05) reduced in the cells infected with the retrovirus vector expressing shG4 (404 AE 45.9 cpm/ml) compared to that in untreated cells (1758 AE 251 cpm/ml) and the cells infected with the retrovirus vector expressing shNC (1592 AE 177 cpm/ml) (Fig. 4b) .

RNAi technology has been considered as a new therapeutic strategy for a variety of viral infections in humans. It has been demonstrated that inhibition of the replication of HIV-1 and other viruses can be achieved by introduction of siRNA or shRNA in both cultured cell lines and primary cells. The present study was carried out to demonstrate a potential of RNAi technology as a gene therapy strategy for the control of FIV infection.

To identify the sequence of siRNA, which can efficiently inhibit the replication of FIV, we examined the effect of four siRNAs homologous to FIV gag gene on FIV replication in CRFK/FIV cells. We demonstrated that transfection with anti-FIV siRNAs (G1, G3 and G4) resulted in reduction of RT activity in the culture supernatant, indicating that a diverse region of FIV gag gene can be targeted by siRNA. For application of RNAi technology to therapeutic purposes of naturally FIV-infected cats, sequence diversity of FIV genome should be considered. The sequence used for preparation of G4-siRNA, which efficiently inhibited the replication of FIV in this study, is highly conserved among various strains of FIV (Kakinuma et al., 1995) . Therefore, it is highly plausible that the siRNA such as G4 inhibits the replication of various field strains of FIVas well as Petaluma strain. However, since gene silencing by RNAi requires almost perfect complementarity between the siRNA and its target sequence, further investigation is required to examine the inhibitory effect of the siRNAs on the replications of diverse FIV strains.

In this study, we showed that G4-siRNA inhibited the replication of FIV in a dose-dependent manner, whereas Luc-siRNA did not. These results indicated that siRNA homologous to FIV gag gene could specifically inhibit the replication of FIV in chronically FIV-infected cells. Transfection with G4-siRNA at a higher concentration (1 mM) resulted in inhibition of the replication of FIV by 96%, whereas its inhibition was by 48% at a lower concentration Fig. 4 . Effect of retrovirus vector-mediated transfer of FIV-specific shRNA on the replication of FIV in FL4 cells. FL4 cells were infected with the retrovirus vector, which express shG4 or shNC and then selected under puromycin. The amount of FIV RNA in the untreated, shG4-transduced, and shNC-transduced FL4 cells (a) and RT activities in the culture supernatants (b) were measured 2 weeks after retrovirus vector-mediated transduction. The amount of FIV RNA was measured by a real-time sequence detection system and the relative FIV RNA expression values (2 ÀDC T ) were calculated. The columns and bars show means and standard deviations, respectively, obtained from the data in triplicate samples. The asterisk indicates statistically significant difference between cells transduced with shG4 and shNC (P < 0.05).

(40 nM). As a large amount of viral transcripts would be generated de novo in CRFK/FIV cells, enough amount of siRNAs might be required to efficiently inhibit the replication of FIV in the cells.

When siRNAs were transiently transfected into CRFK/FIV cells, the strongest inhibitory effect on the viral replication was observed at 48 h after transfection, then its effect was gradually decreased. This result is consistent with previous reports describing that the silencing effect of siRNA rapidly faded away in continuously dividing mammalian cell lines (Elbashir et al., 2001) . On the other hand, Song et al. demonstrated that inhibition of the replication of HIV-1 in nondividing primary monocyte-derived macrophages by transfection with siRNA targeted HIV p24 sustained at least 15 days after transfection (Song et al., 2003) . As CRFK/FIV cells were rapidly proliferating, the shortterm effect of siRNAs shown in this study might be due to the dilution of siRNAs in the cells.

The low transduction efficiency of siRNAs into T cells and its transient effect are the most important problems to use the RNAi technology as a strategy of gene therapy for the control of FIV infection. Retrovirus vector can infect primary cells and induce the sustained expression of transferred gene. Therefore, we examined the effect of the retrovirus vectormediated transfer of the shRNA in feline T-cell line. The amount of FIV RNA and RT activity in the culture supernatant of the FL4 cells were markedly decreased even 2 weeks after transduction with a retrovirus vector which express shRNA specific to FIV. This result suggests the therapeutic effect of the retrovirus vector-mediated delivery of FIV-specific shRNA in cells infected with FIV. However, the retrovirus vector-mediated FIV-specific shRNA transfer could not achieve complete inhibition of FIV replication even after the selection by antibiotic. As for the reason, there might exist a small number of cells in which the amount of shRNA was not enough to inhibit FIV replication even in cells after antibiotic selection. As another possibility, FIV clones to escape from the shRNA might exist in FL4 cells because it is not a cloned cell line.

The goal of the gene therapy strategy for the control of FIV infection is to obtain FIV-resistant Tlymphocytes. However, the transduction efficiency of a same retrovirus vector used in this study containing a fluorescence marker gene, ZsGreen, into feline peripheral blood mononuclear cells was 5-6% at MOI 10 whereas more than 90% into FL4 cells (data not shown). Further investigation is necessary to improve the transduction efficiency of the retrovirus vector in primary T cells. Another candidate of target cells for RNAi gene therapy to control FIV infection is hematopoietic stem cells (HSC). Development of antiviral gene therapy strategies that target HSC has been proposed as a long-term treatment for AIDS induced by HIV infection. In theory, permanent resistance to HIV infection can be achieved through the introduction of antiviral genes into pluripotent HSC because of their capacity of self-renewal as well as proliferation and differentiation into lymphoid lineage. Recently, HSCs transduced with siRNA construct directed to HIV were shown to allow to mature into T-lymphocytes in vivo in SCID-hu mouse thy/liv grafts and these HSC-derived siRNA-expressing T cells and macrophages showed marked resistance to HIV infection (Banerjea et al., 2003) . Although isolation and purification system of feline HSC has not been established, viral vector-mediated transfer of anti-FIV shRNA into HSC will be a useful gene therapy strategy for the control of FIV infection in cats in future.

In summary, we demonstrated that siRNAs homologous to FIV gag gene efficiently inhibited the replication of FIV in fibroblastic cells chronically infected with FIV. Moreover, we showed that retrovirus vector-mediated transfer of FIV-specific shRNA could inhibit the replication of FIV in lymphoid cells chronically infected with FIV. The present study indicates that RNAi technology can be useful as a gene therapy strategy for the control of FIV infection.

Inhibition of HIV-1 by lentiviral vectortransduced siRNAs in T lymphocytes differentiated in SCIDhu mice and CD34+ progenitor cell-derived macrophages

Feline immunodeficiency virus: an interesting model for AIDS studies and an important cat pathogen

Role for a bidentate ribonuclease in the initiation step of RNA interference

A phase II randomized study of HIV-specific T-cell gene therapy in subjects with undetectable plasma viremia on combination antiretroviral therapy

Gene therapy clinical trials worldwide 1989-2004-an overview

Suppression of feline immunodeficiency virus infection in vivo by 9

Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells

Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans

RNA interference of influenza virus production by directly targeting mRNA for degradation and indirectly inhibiting all viral RNA transcription

Short interfering RNA confers intracellular antiviral immunity in human cells

Association of plasma viral RNA load with prognosis in cats naturally infected with feline immunodeficiency virus

Use of two virustatica (AZT, PMEA) in the treatment of FIV and of FeLV seropositive cats with clinical symptoms

Feline immunodeficiency virus infection in cats of Japan

Modulation of HIV-1 replication by RNA interference

Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference

Nucleotide sequence of feline immunodeficiency virus: classification of Japanese isolates into two subtypes which are distinct from non-Japanese subtypes

Seroepidemiological survey of feline retrovirus infections in cats in Taiwan in 1993 and 1994

Prevalences of feline leukaemia virus and feline immunodeficiency virus infections in cats in Sydney

Quantitative analysis of Fas and Fas ligand mRNAs in a feline T-lymphoid cell line after infection with feline immunodeficiency virus and primary peripheral blood mononuclear cells obtained from cats infected with the virus

Contrastive prevalence of feline retrovirus infections between northern and southern Vietnam

Nucleotide sequence analysis of feline immunodeficiency virus: genome organization and relationship to other lentiviruses

Clinical overview of feline immunodeficiency virus

Isolation of a T-lymphotropic virus from domestic cats with an immunodeficiency-like syndrome

Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs

A lentivirusbased system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference

Hematologic manifestations of feline immunodeficiency virus infection

Inhibition of hepatitis B virus expression and replication by RNA interference

Sustained small interfering RNAmediated human immunodeficiency virus type 1 inhibition in primary macrophages

Phylogenetic analysis of feline immunodeficiency virus in Central Europe: a prerequisite for vaccination and molecular diagnostics

Inhibition of severe acute respiratory syndrome virus replication by small interfering RNAs in mammalian cells

A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV-1 RNA

siRNAmediated gene silencing in vitro and in vivo

Epidemiologic and clinical aspects of feline immunodeficiency virus infection in cats from the continental United States and Canada and possible mode of transmission

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21-23 nucleotide intervals

This study was supported by grants from the Japan Health Science Foundation and the Ministries of Education, Science, Sports and Culture, Japan.

Arai, M., Earl, D.D., Yamamoto, J.K., 2002. Is AZT/3TC therapy effective against FIV infection or immunopathogenesis? Vet. Immunol. Immunopathol. 85, 189-204.