key: cord-0752842-l3u7spr1
authors: Chandrashekar, Abishek; Liu, Jinyan; Yu, Jingyou; McMahan, Katherine; Tostanoski, Lisa H.; Jacob-Dolan, Catherine; Mercado, Noe B.; Anioke, Tochi; Chang, Aiquan; Gardner, Sarah; Giffin, Victoria M.; Hope, David L.; Nampanya, Felix; Patel, Shivani; Sanborn, Owen; Sellers, Daniel; Wan, Huahua; Martinot, Amanda J.; Baczenas, John J.; O’Connor, Shelby L.; Pessaint, Laurent; Valentin, Daniel; Espina, Benjamin; Wattay, Lauren; Ferrari, Maria G.; Brown, Renita; Cook, Anthony; Bueno-Wilkerson, Deandre; Teow, Elyse; Andersen, Hanne; Lewis, Mark G.; Barouch, Dan H.
title: Prior infection with SARS-CoV-2 WA1/2020 partially protects rhesus macaques against reinfection with B.1.1.7 and B.1.351 variants
date: 2021-11-03
journal: Sci Transl Med
DOI: 10.1126/scitranslmed.abj2641
sha: d41af73b6b530f48cde5995fd506186d6956a001
doc_id: 752842
cord_uid: l3u7spr1

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants that result in increased transmissibility and partial evasion of neutralizing antibodies have recently emerged. Whether natural immunity induced by the original SARS-CoV-2 WA1/2020 strain protects against rechallenge with these SARS-CoV-2 variants remains a critical unresolved question. In this study, we show that natural immunity induced by the WA1/2020 strain leads to partial but incomplete protection against the SARS-CoV-2 variants B.1.1.7 (alpha) and B.1.351 (beta) in rhesus macaques. We challenged rhesus macaques with B.1.1.7 and B.1.351 and showed that infection with these variants resulted in high viral replication in the upper and lower respiratory tract. We then infected rhesus macaques with the WA1/2020 strain and rechallenged them on day 35 with the WA1/2020, B.1.1.7, or B.1.351 variants. Natural immunity to WA1/2020 led to robust protection against rechallenge with WA1/2020 but only partial protection against rechallenge with B.1.351. An intermediate degree of protection was observed in rhesus macaques against rechallenge with B.1.1.7. These data demonstrate partial but incomplete protective efficacy of natural immunity induced by WA1/2020 against SARS-CoV-2 variants of concern. Our findings have important implications for both vaccination and public health strategies in the context of emerging SARS-CoV-2 variants of concern.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variants (1) have recently emerged, and the proliferation of variants worldwide pose challenges for global pandemic control. B.1.1.7 (alpha) was originally identified in the United Kingdom and has shown increased transmissibility (2, 3) , and B.1.351 (beta) was first identified in South Africa and has demonstrated partial evasion of antibody responses (3) (4) (5) (6) (7) . Previous studies in macaques have demonstrated robust natural immunity against homologous rechallenge with SARS-CoV-2 WA1/2020 (8, 9) , but the efficacy of natural immunity induced by the original WA1/2020 strain against SARS-CoV-2 variants of concern has not yet been determined. This is a critical question, because human epidemiologic studies have reported substantial reinfection with SARS-CoV-2 variants in previously infected individuals. For example, studies from Manaus, Brazil demonstrated a surge of coronavirus disease 2019 infections with the P.1 (gamma) variant in a population with 76% immunity to the original SARS-CoV-2 strain (10, 11) . These data suggest that emerging SARS-CoV-2 variants of concern may pose a threat to achieving herd immunity from natural infection. Moreover, SARS-CoV-2 variants may reduce vaccine efficacy. In the present study, we assess the protective efficacy of natural immunity after WA1/2020 infection on rechallenge with WA1/2020, B.1.1.7, or B.1.351 variants in rhesus macaques.

We developed SARS-CoV-2 B.1.1.7 and B.1.351 challenge stocks by expansion of seed stocks in Calu-3 cells. Deep sequencing confirmed that the B.1.1.7 and B.1.351 stocks did not contain any unexpected mutations in the spike protein, and specifically, there were no mutations in the furin cleavage site [National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) accession numbers SRR14313078 and SRR14313077]. To verify the infectivity of these stocks, we infected six rhesus macaques with 5 × 10 5 median tissue culture infectious dose (TCID 50 ) B.1.1.7 (n = 3) or B.1.351 (n = 3) by the intranasal and intratracheal routes. Both viruses resulted in viral replication in the upper and lower respiratory tracts, as measured by subgenomic RNA (sgRNA) (12, 13) . Median peak log sgRNA copies per milliliter in bronchoalveolar lavage (BAL) were 5.59 and 6.05, and peak log sgRNA copies per swab in nasal swabs were 5.61 and 5.60 for the B. (6, 7) have now spread globally. The B.1.351 variant is particularly worrisome for natural and vaccine immunity, because it contains mutations in the receptor binding domain (RBD), including E484K, and the N-terminal domain (NTD), which collectively lead to partial escape from NAb responses (3) (4) (5) (6) (7) . To assess the extent of protective efficacy of WA1/2020 natural immunity against the B.1.1.7 and B.1.351 variants, we infected 18 rhesus macaques with 5 × 10 5 TCID 50 WA1/2020 by the intranasal and intratracheal routes. All animals developed high viral replication in BAL and nasal swabs, with peak log sgRNA copies per milliliter in BAL of 4.69 (range 3.60 to 6.15) and peak log sgRNA copies per swab in nasal swabs of 5.86 (range 4.17 to 6.95) on day 2 after infection ( Fig. 1) , similar to our prior reports (8, 9, 15, 16) . Viral replication resolved by day 10 in the majority of animals.

On day 35 after initial infection, we rechallenged these 18 animals with 5 × 10 5 TCID 50 WA1/2020, B.1.1.7, or B.1.351 by the intranasal and intratracheal routes (n = 6 per group) ( fig. S4 ). An additional three naïve macaques were concurrently challenged with 5 × 10 5 TCID 50 B.1.351 as positive controls. Rechallenge of WA1/2020 convalescent animals with WA1/2020 resulted in undetectable sgRNA copies per milliliter in BAL, except for a single animal that showed a low blip of detectable virus on day 1, and a median peak of 2.57 (range of less than 1.70 to 3.12) log sgRNA copies per swab in nasal swabs (Fig. 2, A and B ). Animals rechallenged with B.1.1.7 developed slightly higher concentrations of breakthrough virus, including a median peak of 2.13 (range of less than 1.70 to 2.90) log sgRNA copies per milliliter in BAL and a median peak of 3.30 (range of less than 1.70 to 4.52) log sgRNA copies per swab in nasal swabs. In contrast, animals rechallenged with B.1.351 developed higher concentrations of breakthrough virus, including a median peak of 4.04 (range 3.31 to 4.89) log sgRNA copies per milliliter in BAL and a median peak of 3.71 (range of less than 1.70 to 5.30) log sgRNA copies per swab in nasal swabs. Deep sequencing of breakthrough B.1.351 virus in BAL after rechallenge showed no mutations compared with the B.1.351 viral stock sequence (NCBI SRA BioProject PRJNA744242). Naïve animals that were concurrently infected with B.1.351 demonstrated a median peak of 6.73 (range 5.82 to 6.97) log sgRNA copies per milliliter in BAL and a median peak of 5.87 (range 5.84 to 6.51) log sgRNA copies per swab in nasal swabs, consistent with the initial infection study ( fig. S2 ).

In WA1/2020-infected animals that were rechallenged, median peak viral loads were greater than 2.38 and 1.51 logs higher after rechallenge with B.1.351 than rechallenge with WA1/2020 in BAL and nasal swabs, respectively (P = 0.0022 and P = 0.0152, respectively, two-sided Wilcoxon rank sum tests; Fig. 2C ). Moreover, median peak viral loads in previously naïve animals that were infected with B.1.351 were 2.35 and 1.71 logs higher than in WA1/2020 convalescent macaques that were rechallenged with B.1.351 in BAL and nasal swabs, respectively (P = 0.0022 and P = 0.0022, respectively, two-sided Wilcoxon rank sum tests; Fig. 2C ). Together, these data demonstrate that natural immunity to WA1/2020 provided partial but incomplete protection against rechallenge with B.1.351 in macaques. Intermediate outcomes were observed after rechallenge with B.1.1. S5 ). These data suggest that variant-specific antibody responses were directed more against RBD than full-length spike protein.

To assess potential immune correlates of protection, we compared humoral immune responses before rechallenge with viral loads after rechallenge. ELISA and NAb titers against the rechallenge virus before rechallenge correlated with peak sgRNA copies per milliliter in BAL after rechallenge (P < 0.0001, R = −0.8302 and P = 0.0007, R = −0.7243, respectively; fig. S6 ). Similarly, NAb titers before rechallenge also correlated with peak sgRNA copies per swab in nasal swabs (P = 0.0150, R = −0.5631; fig. S7 ) after rechallenge.

In contrast with the differences observed with antibody responses against certain variants, T cell responses after infection with WA1/2020 and after rechallenge with WA1/2020, B.1.1.7, and B.1.351 were comparable across all variants tested. Spike protein-specific cellular immune responses were assessed by pooled peptide interferon (IFN)-γ enzyme-linked immunospot (ELISPOT) and intracellular cytokine staining (ICS) assays using peripheral blood mononuclear cells (PBMCs). Cellular immune responses were comparable by IFN-γ ELISPOT assays against multiple SARS-CoV-2 variants, including WA1/2020, B.1.351, B.1.1.7, P.1, and CAL.20C (Fig. 5) . Similarly, multiparameter ICS assays demonstrated comparable responses for total and CD28 + CD95 + central memory CD8 + and CD4 + T cells against these variants (figs. S8 and S9). B.1.1.7 and B.1.351 strains of SARS-CoV-2 were protected against reinfection with the WA1/2020 strain In a pilot experiment, we rechallenged the six macaques originally infected with B.1.1.7 and B.1.351 (figs. S1 and S2) with WA1/2020 on day 35 after initial infection. Macaques initially infected with B.1.1.7 demonstrated no detectable viral loads in BAL or nasal swabs after rechallenge with WA1/2020 (figs. S10 and S11). In contrast, one of the three macaques initially infected with B.1.351 showed breakthrough virus in BAL and nasal swabs after rechallenge with WA1/2020 (figs. S10 and S11). These data further demonstrate partial protection after rechallenge with heterologous SARS-CoV-2 variants.

Multiple SARS-CoV-2 variants have recently emerged, some of which increase transmissibility and pathogenicity, and some of which partially evade NAbs induced by the Wuhan, WA1/2020, and D614G strains (1-7). Our data demonstrate that natural immunity induced by the WA1/2020 strain provides partial but incomplete protection against the B.1.351 variant in rhesus macaques. These data are consistent with human epidemiologic studies that have documented COVID-19 surges with partially resistant SARS-CoV-2 variants in populations with a high degree of immunity to the original strain (10, 11) . Together, these findings demonstrate that natural immunity provides robust short-term protection against rechallenge with the same SARS-CoV-2 strain but reduced protection against rechallenge with certain SARS-CoV-2 variants.

These data build on prior studies from our laboratory and others, showing that infection of macaques with the WA1/2020 strain led to robust natural immunity against rechallenge with the same strain (8, 18, 19) . Our current data confirm and extend these studies and define the protective efficacy of natural immunity induced by WA1/2020 against the B.1.1.7 and B.1.351 SARS-CoV-2 variants of concern in this model. Further work will be required to define mechanistic correlates of protection against SARS-CoV-2 variants. In particular, whether the partial protection of WA1/2020 natural immunity against B.1.351 resulted from the reduced but still detectable antibody responses or the robust and unchanged T cell responses, or a combination of these immune parameters, remains to be determined.

We previously reported that purified immunoglobulin G (IgG) was sufficient to protect macaques against SARS-CoV-2 if antibody titers exceeded a threshold, but that CD8 + T cells also contributed to protection if antibodies were subprotective (9) . Robust CD4 + and CD8 + T cell responses have been reported in SARS-CoV-2-infected humans by our laboratory and others (20) (21) (22) (23) . The potential role of CD8 + and CD4 + T cells in natural or vaccine protection against SARS-CoV-2 variants remains to be determined, but a contribution of cellular immune responses in protecting against SARS-CoV-2 variants that partially evade antibody responses may be plausible. In the present study, the reduction of NAb titers to B.1.351 compared with WA1/2020, with unchanged T cell responses, likely accounts for the observed reduced protection.

Our data also demonstrate that B.1.351 infection led to more rapid kinetics, higher magnitude, and more prolonged virus replication than did WA1/2020 infection in rhesus macaques. If B.1.351 or other variants similarly lead to more robust virus replication in humans, then such variants would likely be more transmissible and less well controlled by vaccines, with substantial implications for public health. Further research will be required to compare viral loads with additional viral variants in nonhuman primates and humans.

Our study has several limitations. First, studies of viral variants in nonhuman primates may not be fully translatable to humans, because the virus specifically adapts to humans. Second, our study only assessed the B.1.1.7 (alpha) and B.1.351 (beta) variants, and thus further studies will be required to evaluate other variants, such as the B.1.617.2 (delta) variant. Third, our data do not evaluate the durability of immune responses associated with protection against viral variants.

Together, our data suggest partial but reduced short-term protective efficacy of WA1/2020 natural immunity against SARS-CoV-2 variants of concern. A greater reduction of efficacy was observed against B.1.351 as compared with B.1.1.7, likely because B.1.351 includes multiple RBD and NTD mutations that partially evade NAb responses. Our findings have important implications for vaccination and public health strategies in regions that have circulating SARS-CoV-2 variants of concern. Moreover, future studies will define protective efficacy against other SARS-CoV-2 variants and will define immunologic mechanisms of protection against these variants.

Twenty-seven outbred Indian origin adult male and female rhesus macaques (Macaca mulatta) ages 6 to 10 years old were randomly allocated to groups. All animals were housed at BIOQUAL Inc. Animals were challenged with 5 × 10 10 Deep sequencing of these stocks revealed no unexpected mutations in the spike protein at any position at greater than 2.5% frequency. Moreover, the B.1.351 stock contained no unexpected mutations elsewhere in virus at >13% frequency. All the sequence data generated from viruses isolated from animals can be found in NCBI SRA BioProject PRJNA744242. The sequence of the challenge stock can be found under the NCBI SRA accession numbers SRR14313078 and SRR14313077. Virus was administered as 1 ml by the intranasal route (0.5 ml in each nare) and 1 ml by the intratracheal route. All immunologic and virologic studies were performed blinded. Animal studies were conducted in compliance with all relevant local, state, and federal regulations and were approved by the BIOQUAL Institutional Animal Care and Use Committee.

The SARS-CoV-2 pseudoviruses expressing a luciferase reporter gene were generated essentially as described previously (8, (14) (15) (16) . Briefly, the packaging plasmid psPAX2 To determine the neutralization activity of the plasma or serum samples from participants, HEK293Thuman angiotensin converting enzyme 2 (hACE2) cells (8, (14) (15) (16) were seeded in 96-well tissue culture plates at a density of 1.75 × 10 4 cells per well overnight. Threefold serial dilutions of heat-inactivated serum or plasma samples were prepared and mixed with 50 μl of pseudovirus. The mixture was incubated at 37°C for 1 hour before adding to HEK293T-hACE2 cells. Forty-eight hours after infection, cells were lysed in Steady-Glo Luciferase Assay (Promega) according to the manufacturer's instructions. SARS-CoV-2 neutralization titers were defined as the sample dilution at which a 50% reduction in relative light unit (RLU) was observed relative to the average of the virus control wells.

WA1/2020, B.1.1.7, and B.1.351 RBD-specific binding antibodies were assessed by ELISA essentially as described previously (8, 15, 16) . Briefly, 96-well plates were coated with RBD protein (0.5 μg/ml) in 1× Dulbecco's phosphate-buffered saline (DPBS) and incubated at 4°C overnight. After incubation, plates were washed once with wash buffer (0.05% Tween 20 in 1× DPBS) and blocked with 350 μl of casein block (Thermo Fisher Scientific) per well for 2 to 3 hours at room temperature. After incubation, block solution was discarded, and plates were blotted dry. Serial dilutions of heat-inactivated serum diluted in casein block were added to wells, and plates were incubated for 1 hour at room temperature before three further washes and a 1-hour incubation with a 1 μg/ml dilution of anti-macaque IgG horseradish peroxidase (Nonhuman Primate Reagent Resource) at room temperature in the dark. Plates were then washed three times, and 100 μl of SeraCare KPL 3,3′,5,5′-tetramethylbenzidine (TMB) SureBlue Start solution was added to each well; plate development was halted by the addition of 100 μl of SeraCare KPL TMB Stop solution per well. The absorbance at 450 nm was recorded using a VersaMax microplate reader. For each sample, ELISA end point titer was calculated in GraphPad Prism software using a four-parameter logistic curve fit to calculate the reciprocal serum dilution that yields an absorbance value of 0.2 at 450 nm. Log 10 end point titers are reported.

ECLA plates (Meso Scale Discovery SARS-CoV-2 IgG cat. no.: N05CA-1; Panel 7) were designed and produced with up to nine antigen spots in each well, and assays were performed essentially as described previously (17) . The antigens included were WA1/2020, B.1.1.7, P.1, and B.1.351 spike protein and RBD. The plates were blocked with 50 μl of Blocker A (1% bovine serum albumin in Milli-Q water) solution for at least 30 min at room temperature shaking at 700 rpm with a digital microplate shaker. During blocking, the serum was diluted 1:5000 in Diluent 100. The plates were then washed three times with 150 μl of the Meso Scale Discovery (MSD) kit wash buffer and blotted dry, and 50 μl of the diluted samples was added in duplicate to the plates and set to shake at 700 rpm at room temperature for at least 2 hours. The plates were again washed three times, and 50 μl of SULFO-tagged anti-human IgG detection antibody diluted to 1× in Diluent 100 was added to each well and incubated shaking at 700 rpm at room temperature for at least 1 hour. Plates were then washed three times, 150 μl of MSD GOLD Read buffer B was added to each well, and the plates were read immediately after on a MESO QuickPlex SQ 120 machine. MSD titers for each sample were reported as RLUs, which were calculated as sample RLU minus blank RLU for each spot for each sample. The limit of detection was defined as 1000 RLU for each assay.

ELISPOT assays were performed using PBMCs essentially as described previously (8, 15, 16) . Peptide pools consisted of 15 amino acid peptides overlapping by 11 amino acids spanning the SARS-CoV-2 spike protein from the WA1/2020 strain or variant strains. ELISPOT plates were coated with mouse anti-human IFN-γ mono-clonal antibody (mAb) from BD Pharmingen at 5 μg per well and incubated overnight at 4°C. Plates were washed with DPBS wash buffer (DPBS with 0.25% Tween 20) and blocked with R10 media [RPMI with 10% heat-inactivated fetal bovine serum (FBS) with 1% of 100× penicillinstreptomycin] for 1 to 4 hours at 37°C. SARS-CoV-2 peptides (21st Century Biochemicals; the variants peptides contain the wild-type backbone) were prepared and plated at a concentration of 1 μg per well, and 200,000 cells per well were added to the plate. The peptides and cells were incubated for 18 to 24 hours at 37°C. Positive control wells were cells with phytohemagglutinin, and negative control wells were cells with media. All steps following this incubation were performed at room temperature. The plates were washed with ELISPOT wash buffer (11% 10× DPBS and 0.3% Tween20 in 1 liter of Milli-Q water) and incubated for 2 hours with rabbit polyclonal anti-human IFN-γ biotin from U-CyTech (1 μg/ml). The plates were washed a second time and incubated for 2 hours with streptavidinalkaline phosphatase from SouthernBiotech (2 μg/ml). The final wash was followed by the addition of nitro-blue tetrazolium chloride/5-bromo-4-chloro 3′-indolyphosphate p-toluidine salt (chromagen) substrate solution for 7 min. The chromagen was discarded, and the plates were washed with water and dried in a dim place for 24 hours. Plates were scanned and counted on a Cellular Technology Limited immunospot analyzer.

Multiparameter ICS assays were performed essentially as described previously (8, 15, 16) . PBMCs (10 6 ) per well were resuspended in 100 μl of R10 media [RPMI 1640 (Thermo Fisher Scientific) with 10% FBS (Omega) and 1% of 100× penicillin-streptomycin (Thermo Fisher Scientific)] supplemented with CD49d mAb (1 μg/ml). Each sample was assessed with mock (100 μl of R10 plus 0.5% dimethyl sulfoxide; background control), SARS-CoV-2 peptides (2 μg/ml; 21st Century Biochemicals; the variants peptides contain the wild-type backbone), or phorbol myristate acetate (10 pg/ml) and ionomycin (1 μg/ml; Sigma-Aldrich) (100 μl; positive control) and incubated at 37°C for 1 hour. After incubation, 0.25 μl of GolgiStop (BD Biosciences) and 0.25 μl of GolgiPlug (BD Biosciences) in 50 μl of R10 was added to each well and incubated at 37°C for 8 hours and then held at 4°C overnight. The next day, the cells were washed twice with DPBS, stained with Near-Infrared Fixable sgRNA assay SARS-CoV-2 E gene sgRNA was assessed by reverse transcription polymerase chain reactions (RT-PCR) using primers and probes as previously described (12, 13) . A standard was generated by first synthesizing a gene fragment of the subgenomic E gene (12) . The gene fragment was subsequently cloned into a pcDNA3.1 + expression plasmid using restriction site cloning (Integrated DNA Technologies). The insert was in vitro transcribed to RNA using the AmpliCap-Max T7 High Yield Message Maker Kit (CELLSCRIPT). Log dilutions of the standard were prepared for RT-PCR assays ranging from 1 × 10 10 copies to 1 × 10 −1 copies. Viral loads were quantified from BAL fluid and nasal swabs. RNA extraction was performed on a QIAcube HT using the IndiSpin QIAcube HT Pathogen Kit according to the manufacturer's specifications (QIAGEN). The standard dilutions and extracted RNA samples were reverse-transcribed using SuperScript VILO Master Mix (Invitrogen) following the cycling conditions described by the manufacturer, 25°C for 10 min, 42°C for 1 hour, and then 85°C for 5 min. A TaqMan custom gene expression assay (Thermo Fisher Scientific) was designed using the sequences targeting the E gene sgRNA (12) . The sequences for the custom assay were as follows: forward primer, sgLeadCoV2.Fwd: CGATCTCTTGTAGATCTGTTCTC; E_Sarbeco_R: ATATTGCAG-CAGTACGCACACA; and E_Sarbeco_P1 (probe): VIC-ACACTAG-CCATCCTTACTGCGCTTCG-MGB. These primers and probes were equally reactive for both variants. Reactions were carried out in duplicate for samples and standards on the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) with the thermal cycling conditions, initial denaturation at 95°C for 20 s, then 45 cycles of 95°C for 1 s, and 60°C for 20 s. Standard curves were used to calculate sgRNA copies per milliliter or per swab; the quantitative assay sensitivity was 50 copies per milliliter or per swab.

Comparisons of virologic and immunologic data were performed using GraphPad Prism 8.4.2 (GraphPad Software). Comparison of data between groups was performed using two-sided Wilcoxon rank sum tests. Correlation analyses were performed using two-sided Spearman rank correlation tests. P values of less than 0.05 were considered significant.

Refer to Web version on PubMed Central for supplementary material. Rhesus macaques were infected by the intranasal and intratracheal routes with 5×10 5 TCID 50 SARS-CoV-2 WA1/2020 (n = 18). Peak log 10 sgRNA copies per milliliter (limit of quantification 50 copies/ml) were assessed in BAL after challenge, and peak log 10 sgRNA copies per swab (limit of quantification 50 copies per swab) were assessed in nasal swabs after challenge. Red lines reflect median values. Chandrashekar 

Tracking changes in SARS-CoV-2 Spike: Evidence that D614G increases infectivity of the COVID-19 virus

Estimated transmissibility and impact of SARS-CoV-2 lineage B.1.1.7 in England

Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7

Serum neutralizing activity elicited by mRNA-1273 vaccine

Neutralizing activity of BNT162b2-elicited serum

SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma

Detection of a SARS-CoV-2 variant of concern in South Africa

SARS-CoV-2 infection protects against rechallenge in rhesus macaques

Correlates of protection against SARS-CoV-2 in rhesus macaques

Resurgence of COVID-19 in Manaus, Brazil, despite high seroprevalence

Three-quarters attack rate of SARS-CoV-2 in the Brazilian Amazon during a largely unmitigated epidemic

Virological assessment of hospitalized patients with COVID-2019

Comparison of subgenomic and total RNA in SARS-CoV-2-challenged rhesus macaques

Deletion of the SARS-CoV-2 spike cytoplasmic tail increases infectivity in pseudovirus neutralization assays

Single-shot Ad26 vaccine protects against SARS-CoV-2 in rhesus macaques

DNA vaccine protection against SARS-CoV-2 in rhesus macaques

Coronavirus-specific antibody cross reactivity in rhesus macaques following SARS-CoV-2 vaccination and infection

Primary exposure to SARS-CoV-2 protects against reinfection in rhesus macaques

Immunity elicited by natural infection or Ad26.COV2.S vaccination protects hamsters against SARS-CoV-2 variants of concern

Antigen-specific adaptive immunity to SARS-CoV-2 in acute COVID-19 and associations with age and disease severity

Immunological memory to SARS-CoV-2 assessed for up to 8 months after infection

Targets of T cell responses to SARS-CoV-2 coronavirus in humans with COVID-19 disease and unexposed individuals

Correlates of neutralization against SARS-CoV-2 variants of concern by early pandemic sera

Prior infection with SARS-CoV-2 WA1

Naïve animals (n = 3) were also infected with B.1.351 as a concurrent positive control. (A) Peak log 10 sgRNA copies per milliliter (limit of quantification 50 copies/ml) were assessed in BAL after challenge. (B) Peak log 10 sgRNA copies per swab (limit of quantification 50 copies per swab) were assessed in nasal swabs after challenge

Horizontal red bars reflect median values. P values reflect two-sided Wilcoxon rank sum tests. WA reflects naïve animals after initial infection with WA1/2020

manuscript; available in PMC

Binding antibody responses against B.1.1.7 and B.1.351 are lower than responses against WA1/2020 after rechallenge of rhesus macaques

A and B) RBD-specific binding antibody responses against the SARS-CoV-2 WA1/2020, B.1.1.7, and B.1.351 variants were assessed at weeks 0 and 4 after primary WA1/2020 infection (A) and at week 7 after rechallenge with WA1

Horizontal red bars reflect median responses. Dotted lines reflect assay limit of quantitation. P values reflect two-sided Wilcoxon rank sum tests

manuscript; available in PMC

Fig. 5. T cell responses are comparable in infected rhesus macaques after rechallenge with WA1/2020, B.1.1.7, and B.1

A and B) Cellular immune responses to pooled spike protein peptides were assessed by IFN-γ ELISPOT assays to WA1/2020, B.1.351, B.1.1.7, P.1, and CAL.20C variants at week 4 after primary WA1/2020 infection (A) and at week 7 after rechallenge with WA1/2020, B.1.1.7, and B.1.351 (B). Horizontal red bars reflect median responses

manuscript; available in PMC

We thank J. Muench, F. Paz, J. Yalley-Ogunro, S. O'Connor, A. Sigal, T. de Oliveira, J. Barrett, G. Kennedy, and M. Lifton for generous advice, assistance, and reagents. We thank Meso Scale Discovery for the ECLA kits.