key: cord-0747153-k812c3t9
authors: Cheng, Chun-Chia; Yang, Wan-Yu; Hsiao, Ming-Chen; Lin, Kuan-Hao; Lee, Hao-Wei; Yuh, Chiou-Hwa
title: Transcriptomically Revealed Oligo-Fucoidan Enhances the Immune System and Protects Hepatocytes via the ASGPR/STAT3/HNF4A Axis
date: 2020-06-12
journal: Biomolecules
DOI: 10.3390/biom10060898
sha: fc396e20999242ea5fa1051d7f1653bd2d0dedc8
doc_id: 747153
cord_uid: k812c3t9

Oligo-fucoidan, a sulfated polysaccharide extracted from brown seaweed, exhibits anti-inflammatory and anti-tumor effects. However, the knowledge concerning the detailed mechanism of oligo-fucoidan on liver cells is obscure. In this study, we investigate the effect of oligo-fucoidan in normal hepatocytes by transcriptomic analysis. Using an oligo-fucoidan oral gavage in wild-type adult zebrafish, we find that oligo-fucoidan pretreatment enhances the immune system and anti-viral genes in hepatocytes. Oligo-fucoidan pretreatment also decreases the expression of lipogenic enzymes and liver fibrosis genes. Using pathway analysis, we identify hepatocyte nuclear factor 4 alpha (HNF4A) to be the potential driver gene. We further investigate whether hepatocyte nuclear factor 4 alpha (HNF4A) could be induced by oligo-fucoidan and the underlying mechanism. Therefore, a normal hepatocyte clone 9 cell as an in vitro model was used. We demonstrate that oligo-fucoidan increases cell viability, Cyp3a4 activity, and Hnf4a expression in clone 9 cells. We further demonstrate that oligo-fucoidan might bind to asialoglycoprotein receptors (ASGPR) in normal hepatocytes through both in vitro and in vivo competition assays. This binding, consequently activating the signal transducer and activator of transcription 3 (STAT3), increases the expression of the P1 isoform of HNF4A. According to our data, we suggest that oligo-fucoidan not only enhances the gene expression associated with anti-viral ability and immunity, but also increases P1-HNF4A levels through ASGPR/STAT3 axis, resulting in protecting hepatocytes.

The liver is the biggest organ in the body, and there are many factors that can cause liver damage and lead to liver diseases [1] , which is a progressive process from inflammation, steatohepatitis, fibrosis, and cirrhosis, to eventually liver cancer. Effective and therapeutic means of preventing liver fish using flexible tubing. Here, five-month-old wild-type fish (N = 40) were divided into two groups, either no treatment (mock) or OF administrations via an oral gavage with OF (300 mg/kg) thrice a week for one month. After one month of oral feeding, the fish were sacrificed, and the hepatic tissue was immediately frozen in liquid nitrogen and stored at −80 • C for later RNA isolation and quantitative polymerase chain reaction (qPCR) analysis. Two batches of wild-type fish fed with OF were performed.

Total RNA isolation and complementary DNA (cDNA) synthesis was conducted as described previously [25] . The RNA was isolated using a NucleoSpin ® RNA kit (Macherey-Nagel, Duren, Germany). The RNA samples were stored at −80 • C. The cDNA was synthesized using an iScriptTM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). The cDNA was stored at −20 • C for long-term preservation.

ZebGene 1.1 ST Array Plates (Affymetrix, Santa Clara, CA, USA) were used for the whole-genome transcriptome analysis. Transcriptome analysis console (TAC) software (version 4.0.2) (Affymetrix) was used for the data processing including normalization, probe summarization, and data quality control. Guanine cytosine count normalization (GCCN) and signal space transformation (SST) algorithms were used for normalization to adjust CytoScan raw data (CEL files) intensities, allowing inter-platform comparisons. After we used TAC for data interpretation, differentially expressed genes of OF were identified for both the treated and control samples. The expression analysis settings were as follows: gene-level fold change <−2 or >2, gene-level p-value <0.05, analysis of variance (ANOVA) method: Ebayes. The raw data of the microarray have been submitted to the National Center for Biotechnology Information (NCBI) gene expression omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under accession code GSE148324.

The gene ontology analysis was performed using WebGestalt (WEB-based GEne SeT AnaLysis Toolkit, http://www.webgestalt.org/) and activated pathways were selected and matched according to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

The qPCR experiments were performed as described previously [25] by using the KAPA SYBR ® FAST qPCR Master Mix (Roche, Basel, Switzerland) and ABI Real-Time PCR System. The information for primers used in the qPCR are listed in Table 1 .

The analysis of the qPCR results were performed as described previously [25] , by normalization to actin as an internal control, and calculated the fold change between wild-type zebrafish with or without oligo-fucoidan feeding. All the experiments were performed three times, each time with triplicated samples. The median and standard deviation were calculated from three sets of qPCR experiments. 

Cell culture condition and cell viability assay were performed as described previously [26] . Cell viability was determined by using WST-1 assay (Water Soluble Tetrazolium Salts) (Takara Bio., Kusatsu, Shiga, Japan) and performed at least three independent batches. The knockdown of HNF4A was conducted using a short-hairpin RNA (shRNA) (target sequence: CGAACAGATCCAGTTCATCAA) in the vector pLKO.1-puro using a lentivirus system. The knockdown of ASGPR1 was conducted using two different shRNA (target sequence: GCACCACATAGGCCCTG-TGAA and ACGTGAAGCAGTTCGTGTCTG) in the vector pLKO.1-puro using a lentivirus system. All shRNA were purchased from the National RNAi Core Facility of Academia Sinica (Taipei, Taiwan).

Western blots analyses were performed as described previously [25] using OF-treated Clone 9 cells, while immunoreactive proteins were detected by an enhanced chemiluminescence kit (Bio-Rad). The specific antibodies against STAT3 (signal transducer and activator of transcription 3), phosphorylated STAT3 (pSTAT3), HNF4A (hepatocyte nuclear factor 4, alpha), and GAPDH (glyceraldehyde 3-phosphate dehydrogenase) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA).

Clone 9 cells were trypsinized from the culture plates. Detached cells were rinsed with phosphate-buffered saline (PBS) and underwent 300 g centrifugation for 5 min totally thrice. Then, the cells were immersed into a staining buffer for 1 h at room temperature. The staining buffer was composed of fluorescein isothiocyanate-conjugated asialofetuin (ASF-FITC) with 1 mg/mL of OF or PBS, respectively. Subsequently, discarding the staining buffer, the cells were washed with PBS and centrifuged at 300 g for 5 min, totally thrice. Then, cells were resuspended into 1 mL of PBS and were analyzed by a FACSCalibur Flow Cytometer (Becton, Dickinson and Company (BD), Franklin Lakes, NJ, USA).

The in vivo competition assay was performed as described previously [26] . Adult Bagg albino strain c (BALB/c) mice were purchased from the National Laboratory Animal Center and kept in clean conventional conditions. The animals were fed ad libitum. The 68 Ga-NOTA-HL ( 68 Ga-2,2 ,2"-(1,4,7-triazonane-1,4,7-triyl) triacetic acid-hexavalent lactoside) was synthesized by the Institute of Nuclear Energy Research (Atomic Energy Council, Yonghe Dist., New Taipei City, Taiwan) and was capable of binding to ASGPR in the body [27] , which could be considered as the ligand for ASGPR. To confirm whether OF binds to ASGPR on hepatocytes in vivo, 100 mg OF and PBS was administrated respectively 1 h prior to the 68 Ga-NOTA-HL intravenous injection. The injection dose of 68 Ga-NOTA-HL was 200 ± 20 µCi. The in vivo competition studies were approved by the ethical review committee of the Institute of Nuclear Energy Research.

The OF-treated and BBI608-treated clone 9 cells were collected respectively, and a commercial kit was used to measure CYP3A4 activity (BioVision, Inc., Milpitas, CA, USA). In brief, the assay utilizes a non-fluorescent CYP3A4 substrate that is converted into a fluorescent metabolite detected in the visible range (Ex/Em = 535/587 nm). The CYP3A4 activity was presented by percentage whereas the cells without treatment was set as 100%.

The statistical analyses of the current study were all performed by GraphPad Prism v8.02 (GraphPad Software, Inc., San Diego, CA, USA). Here, p-values <0.05 were considered to be statistically significant and are presented as follows herein: * 0.01 < p ≤ 0.05; ** 0.001 < p ≤ 0.01; *** 0.0001 < p ≤ 0.001; **** p ≤ 0.0001.

To observe the effect of OF on wild-type zebrafish, we administered OF (300 mg/kg) orally to five-month-old wild-type fish thrice a week in a one-month period. Then, liver tissue was excised for RNA extraction and cDNA synthesis. In order to explore OF-mediated gene expression in hepatocytes, the whole-genome expression profiles were analyzed by a GeneTitan array. Comparing two batches of OF-fed wild-type fish, we identified 124 genes that were upregulated at least two-fold with a p-value less than 0.05 ( Figure 1A ). The gene ontology analysis revealed that those upregulated genes were involved in immune system development ( Figure 1B) . Especially, notch1a, interleukin 7 receptor (il7r), interleukin-1 receptor-associated kinase 3 (irak3), cytochrome P450, family 2, subfamily R, polypeptide 1 (cyp2r1), TLE family member 3, transcriptional corepressor b (tle3b), and PTTG1 interacting protein B (pttg1ipb) were upregulated by OF treatment in the wild-type fish. Interestingly, we found the anti-viral gatekeeper mxf [28] and hepcidin, the host defense multiple microbial, hamp, in zebrafish [29] , were also upregulated. The selected genes upregulated by OF from the microarray analysis are shown in Figure 1C . Currently, the world is experiencing the COVID-19 pandemic [30] , and it will be very intriguing to see the upregulation of anti-viral, anti-microbial, and immune modulation proteins in OF-fed wild-type fish. Hence, we would like to verify these results using qPCR. Comparing two batches of OF-fed wild-type fish, we identified 114 genes that were downregulated at least two-fold with a p-value less than 0.05 ( Figure 2A ). The pathway analysis revealed that genes involved in fatty acid metabolism, the peroxisome proliferator-activated receptors (PPAR) signaling pathway, and steroid biosynthesis were enriched ( Figure 2B ). Interestingly, we found that the expressions of key enzymes in fatty acid metabolism such as fatty acid synthase (fasn) and salicylate decarboxylase (scd) [31] , were downregulated in the OF-fed group. We also found lysyl oxidase like 2 (loxl2), a gene that involved in liver fibrosis [32] as well as the sterol O-acyltransferase 1 (soat1), a potential biomarker for hepatocellular carcinoma [33] , were also downregulated by OF. The selected genes that were downregulated in OF-fed groups are shown in Figure 2C .

Nonalcoholic fatty liver disease (NAFLD) affects one-third of the population worldwide [34] . Nonalcoholic steatohepatitis (NASH) is a progressive type of NAFLD that can lead to cirrhosis and liver cancer [35] . Therefore, we are very interested to know whether the downregulation of lipogenesis enzyme in OF-fed wild-type fish could also reduce the gene expression that is involved in NAFLD, NASH, cirrhosis, and HCC. Therefore, we would like to verify these results by using qPCR. Comparing two batches of OF-fed wild-type fish, we identified 114 genes that were downregulated at least two-fold with a p-value less than 0.05 ( Figure 2A ). The pathway analysis revealed that genes involved in fatty acid metabolism, the peroxisome proliferator-activated receptors (PPAR) signaling pathway, and steroid biosynthesis were enriched ( Figure 2B ). Interestingly, we found that the expressions of key enzymes in fatty acid metabolism such as fatty acid synthase (fasn) and salicylate decarboxylase (scd) [31] , were downregulated in the OF-fed group. We also found lysyl oxidase like 2 (loxl2), a gene that involved in liver fibrosis [32] as well as the sterol O-acyltransferase 1 (soat1), a potential biomarker for hepatocellular carcinoma [33] , were also downregulated by OF. The selected genes that were downregulated in OF-fed groups are shown in Figure 2C .

Nonalcoholic fatty liver disease (NAFLD) affects one-third of the population worldwide [34] . Nonalcoholic steatohepatitis (NASH) is a progressive type of NAFLD that can lead to cirrhosis and liver cancer [35] . Therefore, we are very interested to know whether the downregulation of lipogenesis enzyme in OF-fed wild-type fish could also reduce the gene expression that is involved in NAFLD, NASH, cirrhosis, and HCC. Therefore, we would like to verify these results by using qPCR.

Our qPCR results indicated that mxf, hamp, and irak3 were upregulated by OF (Figure 3 ), and five hepatocellular carcinoma-associated genes (fasn, scd, loxl2a, foxo3b and soat1) were downregulated by OF (Figure 4 ). The results in Figure 3 echo the findings of Figure 1B , and the gene expression in Figure 4 echo the findings of Figure 2B . Together, we found that OF consumption increased the anti-viral and anti-microbial genes, enhanced the immunity-related genes, and downregulated the expression of lipogenesis, fibrosis, and HCC-related genes in the zebrafish model. These alterations hinted that OF might offer a cytoprotective effect; thus, we next utilized normal hepatocytes cell lines for the mechanism study. Our qPCR results indicated that mxf, hamp, and irak3 were upregulated by OF (Figures 3) , and five hepatocellular carcinoma-associated genes (fasn, scd, loxl2a, foxo3b and soat1) were downregulated by OF (Figures 4) . The results in Figure 3 echo the findings of Figure 1B , and the gene expression in Figure 4 echo the findings of Figure 2B . Together, we found that OF consumption increased the anti-viral and anti-microbial genes, enhanced the immunity-related genes, and downregulated the expression of lipogenesis, fibrosis, and HCC-related genes in the zebrafish model. These alterations hinted that OF might offer a cytoprotective effect; thus, we next utilized normal hepatocytes cell lines for the mechanism study. (A-C) The fold changes of oligo-fucoidan fed wild-type (WT+OF) zebrafish versus the no-treatment control (WT), where each dot represents the average of two fish from the same batch. (D-F) Quantitative polymerase chain reaction (qPCR) analyses for the same samples that were used in microarray, where each dot represents average of two fish from the same batch. (G-I) Quantitative polymerase chain reaction (qPCR) analyses for the all OF-fed wild-type fish (red) versus the untreated controls (black), where each dot represents one fish. Statistical analyses were performed with Student's t-test (* 0.01 < p ≤ 0.05; ** 0.001 < p ≤ 0.01; *** ≤ 0.001, ns: non-significance).

Biomolecules 2020, 10, x FOR PEER REVIEW 9 of 19 (L-P) qPCR analyses for all OF-fed fish (red) versus untreated controls (black), where each dot represents one fish. Statistical analyses were performed with student's t-test (* 0.01 < p ≤ 0.05; ** 0.001 < p ≤ 0.01; *** 0.0001 < p ≤ 0.001; **** p ≤ 0.0001).

Clone 9, a rat normal hepatocyte line, was treated with oligo-fucoidan to examine whether oligofucoidan offers a cytoprotective effect. Intriguingly, we found that oligo-fucoidan significantly increased the viability of normal liver cells ( Figure 5A ). Healthy hepatocytes contain abundant Cyp3a4, which is a critical enzyme for oxidizing toxins and drugs mainly in the liver and intestines, whose activity displays a decreasing trend with nonalcoholic fatty liver disease (NAFLD) progression [36, 37] . We found that oligo-fucoidan treatment enhanced the Cyp3a4 activity in Clone 9 cells ( Figure  5B ). We further investigated the upstream regulator of Cyp3a4, the Hnf4a, which is a critical nuclear transcriptional factor that is associated with improved liver function: a previous study demonstrated that Hnf4a expression is decreased in hepatic cirrhosis, but the overexpression of Hnf4a resets the transcription factor network in hepatocytes and prevents hepatic failure [38] . We found that oligofucoidan significantly upregulated the expression of Hnf4a in Clone 9 cells ( Figure 5C ). 

Clone 9, a rat normal hepatocyte line, was treated with oligo-fucoidan to examine whether oligo-fucoidan offers a cytoprotective effect. Intriguingly, we found that oligo-fucoidan significantly increased the viability of normal liver cells ( Figure 5A ). Healthy hepatocytes contain abundant Cyp3a4, which is a critical enzyme for oxidizing toxins and drugs mainly in the liver and intestines, whose activity displays a decreasing trend with nonalcoholic fatty liver disease (NAFLD) progression [36, 37] . We found that oligo-fucoidan treatment enhanced the Cyp3a4 activity in Clone 9 cells ( Figure 5B ). We further investigated the upstream regulator of Cyp3a4, the Hnf4a, which is a critical nuclear transcriptional factor that is associated with improved liver function: a previous study demonstrated that Hnf4a expression is decreased in hepatic cirrhosis, but the overexpression of Hnf4a resets the transcription factor network in hepatocytes and prevents hepatic failure [38] . We found that oligo-fucoidan significantly upregulated the expression of Hnf4a in Clone 9 cells ( Figure 5C ). whose activity displays a decreasing trend with nonalcoholic fatty liver disease (NAFLD) progression [36, 37] . We found that oligo-fucoidan treatment enhanced the Cyp3a4 activity in Clone 9 cells ( Figure  5B ). We further investigated the upstream regulator of Cyp3a4, the Hnf4a, which is a critical nuclear transcriptional factor that is associated with improved liver function: a previous study demonstrated that Hnf4a expression is decreased in hepatic cirrhosis, but the overexpression of Hnf4a resets the transcription factor network in hepatocytes and prevents hepatic failure [38] . We found that oligofucoidan significantly upregulated the expression of Hnf4a in Clone 9 cells ( Figure 5C ). 

Oligo-Fucoidan exhibits many bioactivities including anti-inflammation, anti-angiogenic, and anti-cancer. However, the receptor for OF remains unknown. Oligo-Fucoidan is a novel platelet agonist for C-type lectin-like receptor 2 (CLEC-2) [7] . The hepatocyte-specific CLEC-2 receptor is an asialoglycoprotein receptor (ASGPR), which is a transmembrane hetero-oligomeric glycoprotein complex composed of two ASGPR1 subunits and one ASGPR2 subunit [8] . We hypothesized that OF binds to the hepatocyte lectin receptor ASGPR1/2 and promotes the expression of HNF4A through the JAK2/STAT3 axes. Then, HNF4A resets transcription networks and prevents hepatic failure. To prove this hypothesis, we first examined whether OF binds to ASGPR1/2 in hepatocytes in vitro and in vivo. In OF-treated Clone 9 cells, we found that OF reduced the binding capacity of fluorescein isothiocyanate (FITC)-labeled asialofetuin (an ASGPR-binding protein) in liver cells ( Figure 6A,B) . Using the in vivo model, mouse tail veins were injected with an isotope labeled 68 Ga-NOTA-HL (galactose binding to ASGPR) together with OF for an in vivo competition assay. Our results indicated that OF reduced the binding capacity in 68 Ga-NOTA-HL PET imaging ( Figure 6C,D) . These data suggest that oligo-fucoidan binds to highly conserved hepatic ASGPR in normal livers.

prove this hypothesis, we first examined whether OF binds to ASGPR1/2 in hepatocytes in vitro and in vivo. In OF-treated Clone 9 cells, we found that OF reduced the binding capacity of fluorescein isothiocyanate (FITC)-labeled asialofetuin (an ASGPR-binding protein) in liver cells ( Figure 6A,B) . Using the in vivo model, mouse tail veins were injected with an isotope labeled 68 Ga-NOTA-HL (galactose binding to ASGPR) together with OF for an in vivo competition assay. Our results indicated that OF reduced the binding capacity in 68 Ga-NOTA-HL PET imaging ( Figure 6C, D) . These data suggest that oligo-fucoidan binds to highly conserved hepatic ASGPR in normal livers. 

The ASGPR on hepatocytes has been linked to the activation of the JAK2-STAT3 signaling cascades in response to inflammatory inducing platelets de-sialylation [9] . We hypothesized that oligo-fucoidan binds to ASGPR and activates the JAK2/STAT3 signaling pathway and enhances the nuclear translocation of pSTAT3, thereby increasing Hnf4a mRNA expression. Indeed, we found that OF treatment increased pSTAT3 and Hnf4a protein expression in Clone 9 cells (Figure 7) .

The ASGPR on hepatocytes has been linked to the activation of the JAK2-STAT3 signaling cascades in response to inflammatory inducing platelets de-sialylation [9] . We hypothesized that oligo-fucoidan binds to ASGPR and activates the JAK2/STAT3 signaling pathway and enhances the nuclear translocation of pSTAT3, thereby increasing Hnf4a mRNA expression. Indeed, we found that OF treatment increased pSTAT3 and Hnf4a protein expression in Clone 9 cells (Figure 7 ). The back color indicated no treatment control, while the blue color denoted oligo-fucoidan treatment for 15, 30, or 120 min as indicated at the X-axis. The pSTAT3 intensity was quantified from Western blotting, and the fold changes were compared to control cells (0 min group). (C) Statistical analysis of Hnf4a levels in three batches of oligo-fucoidan-treated Clone 9 cells. The back color indicated no treatment control, the blue color denoted oligo-fucoidan treatment for 15, 30, or 120 min, as indicated at the X-axis. The Hnf4a level was quantified from Western blotting, and the fold changes were compared to control cells (0 min group). Statistical significance was calculated by Student's t-test (* p ≤ 0.05; ** p ≤ 0.01).

There are two isoforms of hepatocyte nuclear factor-4α (HNF4A), the P1-and P2-isoform. The P1-HNF4A exhibits a tumor-suppressive effect, and P2-HNF4A acts as an oncogene in hepatocyte [39] . Beta-catenin repressed the activity of P1-Hnf4a expression and has been reported to be responsible for colon tumorigenesis [40] . We examined whether the P1 isoform was enhanced by OF treatment. Our results indicated that OF treatment promoted the P1-Hnf4a expression, but it suppressed the P2-Hnf4a dramatically in Clone 9 cells ( Figure 8A ). The expression level of Asgpr2 was also increased by OF treatment in the 10 µg/mL OF-treated group but there were no changes in the 100 µg/mL OF treatment group ( Figure 8B ). To explore the role of Hnf4a isoforms in hepatocytes, the chemical carcinogen thioacetamide (TAA) was utilized to treat Clone 9 cells. We found that TAA exhibited an opposite effect to hepatocytes compared to OF. TAA treatment downregulated P1-Hnf4a but upregulated P2-Hnf4a expression in Clone 9 cells ( Figure 8C ). Thioacetamide also reduced the Asgpr1 and Asgpr2 expression levels ( Figure 8D ). suppressed the P2-Hnf4a dramatically in Clone 9 cells ( Figure 8A ). The expression level of Asgpr2 was also increased by OF treatment in the 10 μg/mL OF-treated group but there were no changes in the 100 μg/mL OF treatment group ( Figure 8B ). To explore the role of Hnf4a isoforms in hepatocytes, the chemical carcinogen thioacetamide (TAA) was utilized to treat Clone 9 cells. We found that TAA exhibited an opposite effect to hepatocytes compared to OF. TAA treatment downregulated P1-Hnf4a but upregulated P2-Hnf4a expression in Clone 9 cells ( Figure 8C ). Thioacetamide also reduced the Asgpr1 and Asgpr2 expression levels ( Figure 8D ). hepatocytes. The black color indicated control cells without oligo-fucoidan treatment, the red color denoted oligo-fucoidan at 10 µg/mL, and blue color represented the oligo-fucoidan at 100 µg/mL concentration. The expression of P1-Hnf4a or P2-Hnf4a (indicated below the bar) was measured by qPCR, and the fold changes were compared to control cells. (B) Gene expression profiles of ASGPR1/2 after different concentrations of OF in Clone 9 hepatocytes. The black color indicated control cells without oligo-fucoidan treatment, the red color denoted oligo-fucoidan at 10 µg/mL, and the blue color represented the oligo-fucoidan at 100 µg/mL concentration. The expression of Asgpr1 or Asgpr2 (indicated below the bar) was measured by qPCR, and the fold change was compared to control cells. (C) Expression profiles of the P1 and P2 isoforms of Hnf4a after being treated with different concentrations of thioacetamide (TAA) in clone 9 hepatocytes. The black color indicated control cells without oligo-fucoidan treatment, the red color denoted TAA at 2 µg/mL, and blue color represented the oligo-fucoidan at 20 µg/mL concentration. The expression of P1-Hnf4a or P2-Hnf4a (indicated below the bar) were measured by qPCR, and the fold changes were compared to control cells. (D) Gene expression profiles of Asgpr1/2 after different concentrations of TAA in Clone 9 hepatocytes. The black color indicated control cells without oligo-fucoidan treatment, the red color denoted TAA at 2 µg/mL, and the blue color represented the TAA at 20 µg/mL concentration. The expression of Asgpr1 or Asgpr2 (indicated below the bar) was measured by qPCR, and the fold changes were compared to control cells. Statistical significance was calculated by t-test (* p ≤ 0.05; ** p ≤ 0.01).

Since we assume that OF mediates Hnf4a through the activation of STAT3, hence, we further applied a STAT3 inhibitor, BBI608, to investigate the hypothesis. Our data revealed that BBI608 decreased either the viability or the Cyp3a4 activity in Clone 9 cells (Figure 9 and B). We further confirmed that BBI608 is capable of suppressing the expression of Hnf4a ( Figure 9C ). This data suggest that the expression of Hnf4a was regulated by STAT3 in Clone 9 cells.

represented the TAA at 20 µ g/mL concentration. The expression of Asgpr1 or Asgpr2 (indicated below the bar) was measured by qPCR, and the fold changes were compared to control cells. Statistical significance was calculated by t-test (*p ≤ 0.05; **p ≤ 0.01).

Since we assume that OF mediates Hnf4a through the activation of STAT3, hence, we further applied a STAT3 inhibitor, BBI608, to investigate the hypothesis. Our data revealed that BBI608 decreased either the viability or the Cyp3a4 activity in Clone 9 cells (Figure 9 and B). We further confirmed that BBI608 is capable of suppressing the expression of Hnf4a ( Figure 9C ). This data suggest that the expression of Hnf4a was regulated by STAT3 in Clone 9 cells. Figure 9 . STAT3 regulated Hnf4a expression in Clone 9 cells. (A) STAT3 inhibitor (BBI608) decreased the viability of normal liver cells. The black color indicated control cells without STAT3 inhibitor treatment, the red color denoted BBI608 treatment at different concentrations. The cellular viability was measured by WST-1 assay, and the cell viability (%) was compared to control cells. (B) Cyp3a4 activity in Clone 9 cells was decreased by treatment with a STAT3 inhibitor (BBI608). The black color indicated control cells without STAT3 inhibitor treatment, and the red color denoted BBI608 treatment at different concentration. The Cyp3a4 activities of the STAT3 inhibitor-treated cells or control cells were measured by CYP3A4 Activity Assay Kit assay, and the activity (%) was compared to the average of activity of the control cells. (C) The mRNA expression level of Hnf4a was decreased by treatment with a STAT3 inhibitor (BBI608). The black color indicated control cells without STAT3 inhibitor treatment, and the red color denoted BBI608 treatment at 0.1 µ g/ml. The expression of Hnf4a was measured by qPCR, and the fold changes were compared to control cells. Statistical significance was calculated by Student's t-test (*0.01 < p ≤ 0.05; **0.001 < p ≤ 0.01; ***0.0001 < p ≤ 0.001; ****p ≤ 0.0001). Figure 9 . STAT3 regulated Hnf4a expression in Clone 9 cells. (A) STAT3 inhibitor (BBI608) decreased the viability of normal liver cells. The black color indicated control cells without STAT3 inhibitor treatment, the red color denoted BBI608 treatment at different concentrations. The cellular viability was measured by WST-1 assay, and the cell viability (%) was compared to control cells. (B) Cyp3a4 activity in Clone 9 cells was decreased by treatment with a STAT3 inhibitor (BBI608). The black color indicated control cells without STAT3 inhibitor treatment, and the red color denoted BBI608 treatment at different concentration. The Cyp3a4 activities of the STAT3 inhibitor-treated cells or control cells were measured by CYP3A4 Activity Assay Kit assay, and the activity (%) was compared to the average of activity of the control cells. (C) The mRNA expression level of Hnf4a was decreased by treatment with a STAT3 inhibitor (BBI608). The black color indicated control cells without STAT3 inhibitor treatment, and the red color denoted BBI608 treatment at 0.1 µg/ml. The expression of Hnf4a was measured by qPCR, and the fold changes were compared to control cells. Statistical significance was calculated by Student's t-test (* 0.01 < p ≤ 0.05; ** 0.001 < p ≤ 0.01; *** 0.0001 < p ≤ 0.001; **** p ≤ 0.0001).

We hypothesized Hnf4a contributes to the cyto-protection effect of oligo-fucoidan; thus, we knocked down Hnf4a in Clone 9 cells. We found that the enhancement of Cyp3a4 activity promoted by OF was neutralized in Clone 9-shHnf4a ( Figure 10A ), suggesting that the cyto-protection effect of OF is through activating Hnf4a. Moreover, we knocked down Asgpr1 and found that the OF-promoted effect in cell viability was eliminated in Clone 9-shAsgpr1 ( Figure 10B ). Together, our data confirm that the hepatocyte-protective effect of oligo-fucoidan is through the ASGPR/STAT3/HNF4A axis.

Biomolecules 2020, 10, x FOR PEER REVIEW 14 of 19

We hypothesized Hnf4a contributes to the cyto-protection effect of oligo-fucoidan; thus, we knocked down Hnf4a in Clone 9 cells. We found that the enhancement of Cyp3a4 activity promoted by OF was neutralized in Clone 9-shHnf4a ( Figure 10A ), suggesting that the cyto-protection effect of OF is through activating Hnf4a. Moreover, we knocked down Asgpr1 and found that the OFpromoted effect in cell viability was eliminated in Clone 9-shAsgpr1 ( Figure 10B ). Together, our data confirm that the hepatocyte-protective effect of oligo-fucoidan is through the ASGPR/STAT3/HNF4A axis. The red color indicated first short hairpin RNA (shRNA) against Asgpr1-transfected cells, and the blue color denoted the second sh-RNA against Asgpr1-transfected cells, and the black color showed the control-transfected cells. The cellular viability was determined using WST-1 assay, and the fold changes were compared to control cells. Statistical significance was calculated by Student's t-test (* p ≤ 0.05; ** p ≤ 0.01).

Oligo-fucoidan has been demonstrated to have several beneficial effects, including anti-obesity, anti-inflammatory, and anti-tumorigenic effects [41] [42] [43] [44] [45] . The oligo-fucoidan used in this study has a lower molecular weight (approximately 667 Da), which shows 40% superior effects and bioactivity compared to polymerized fucoidan. The lower molecular weight might be a critical factor that could further affect the biocompatibility or therapeutic effects, especially at the gene, protein, or even cellular levels. We demonstrate the hepatocyte-protective effect in oligo-fucoidan fed zebrafish, which upregulates immune development-related genes and anti-viral proteins and suppresses lipogenesis and fibrosis genes in a zebrafish model. In addition, oligo-fucoidan enhances cell viability and CYP3A4 activity in normal liver cells. We uncover the potential mechanism of oligo-fucoidan in liver protection, possibly through the ASGPR-STAT3-HNF4A axis. Further investigations of oligo-fucoidan dosages is needed in the clinical practices due to the divergence oligo-fucoidan sources, and various dosages have been used in different demands [43] . We suggest that there will be many benefits and much understanding gained from studying the proper use of oligo-fucoidan.

We used four-month-old wild-type zebrafish to feed oligo-fucoidan for a one-month period by oral gavaging and then sacrificed the fish to collect liver specimens for RNA extraction and microarray analyses. Afterwards, we performed two independent batches at different time courses and compared the differential genes. We found only 124 upregulated genes, and 114 downregulated genes were overlapped between two batches, the reasons could be that oligo-fucoidan has many bioactivities, from anti-inflammation, anti-oxidant, immunoregulation, anti-viral, and anti-coagulant [46, 47] . We compared two batches of wild-type fish treated with oligo-fucoidan to find out the most common differentially regulated genes and identified that genes involved in immune development revealed the most significant differences in response to oligo-fucoidan-fed condition. Using zebrafish gene expression profiling, we can obtain the systematic information regarding upregulated or downregulated genes in liver between oligo-fucoidan-fed and wild-type zebrafish. The liver was composed of several cell lineages, 60% of cells in the liver are hepatocytes, and the remaining 40% are non-parenchymal cells (NPCs), liver sinusoidal endothelial cells (LSECs), resident macrophage Kupffer cells (KCs), hepatic stellate cells (HSCs), cholangiocytes, and diverse immune cell types. The current study used Clone 9 normal hepatocytes as in vitro model; the alterations in the gene expression profiling using intact fish liver might be different from those of pure hepatocytes if those changes occurred in non-hepatocyte cells. It has been revealed that NASH pathogenesis is linked to the cell-type-specific reprogramming of the liver cell transcriptomes [48] . Therefore, we revealed that oligo-fucoidan enhancements to the immune system might benefit from the changing of Kupffer cells and monocyte-derived macrophages in the liver.

The hepatocyte-protective effect of oligo-fucoidan is an interesting finding in this study. Oligo-fucoidan is considered as a food supplement without potential toxicity. In our experiment, we have used oligo-fucoidan to feed zebrafish, and we have provided evidence that oligo-fucoidan not only boosts the immune system and enhance anti-viral-associated gene expression but also declines lipogenic enzymes and liver fibrosis-related genes. In fact, brown seaweeds containing fucoidan are widely consumed as part of a normal diet in East Asia, particularly in Japan, Korea, Taiwan, and mainland China. However, liver cancer incidence is relatively higher in these countries/regions, which is possibly due to the insufficient regular consumption to reach the effective dose. The main reason for the manufacturing of oligo-fucoidan specifically is because consuming brown seaweed can only ingest very limited amounts of fucoidan. Approximately 6 kg of seaweed extraction can only refine to 1 g of oligo-fucoidan. However, human patients need to consume 8 g of oligo-fucoidan per day, and it is obviously impossible for a patient to consume 48 kg daily. Hence, although the consumption of brown seaweed in Eastern Asia is common in daily diets, there are some limitations and concerns for brown seaweed consumption; namely, brown seaweed contains an abundant amount of iodide, which might be another restriction for cancer patients or those with thyroid or renal diseases. Secondly, different species of seaweed exhibit different compositions of fucoidan (different molecular weight or polymer form) that may have different efficacies of therapeutic effects.

Oligo-fucoidan is provided by Hi-Q Marine Biotech that is not only highly concentrated, but also smaller in molecular weight, enabling efficient uptake for cells. In our study, we have demonstrated that oligo-fucoidan is capable of enhancing the immune system and increasing the amount of anti-viral associated genes in hepatocytes. In addition, oligo-fucoidan suppressed the expression of lipogenic enzymes and liver fibrosis-related genes. A putative intrinsic signaling cascade ASGPR/STAT3/HNF4A has also been investigated via qPCR and PET imaging. Hence, we propose that oligo-fucoidan might have the potential for protecting hepatocyte in zebrafish.

Fucoidan exhibits an anti-cancer effect through the inhibition of PI3K/AKT and MAPK, also activation of the caspase pathways, and interaction with vascular endothelial growth factor (VEGF), bone morphogenetic protein (BMP), transforming growth factor beta (TGF-β), and estrogen receptors [49] . In this study, the GeneTitan assay implied that the driving force of this axis is HNF4A. In a previous study, the role of HNF4A in rodents was reported to be a critical factor to prevent diethylnitrosamine-induced HCC [50] . Our data found that oligo-fucoidan activates HNF4A via the P1 promoter, suggesting that oligo-fucoidan is capable of modulating HNF4A expression through the P1 promoter. This might be the key step of the pathway because of the divergent results of HNF4A when bound to different promoters. We have demonstrated the hepatocyte-protective effect of oligo-fucoidan in WT zebrafish. We propose that the most significant effect of oligo-fucoidan is the prevention of liver damage. Our data strongly support the beneficial effects of oligo-fucoidan with a boosted immune system, fibrosis prevention, lipogenesis suppression, and even attenuating the tumor progression of HCC. Oligo-fucoidan-induced P1-HNF4A expression through the phosphorylation of STAT3 elucidates the potential mechanisms that differentially induce cell growth in normal livers and suppress hepatocarcinogenesis. Moreover, from the gene expression, we can understand other possible mechanisms behind the beneficial effects of oligo-fucoidan treatment.

The STAT3 has both tumor-suppressing and tumor-promoting properties, constituting an active version of Stat3alpha that suppresses transformation in mouse embryonic fibroblast [51] . The significant finding of our study is that oligo-fucoidan can bind to the ASGPR1/2 receptor to activate pSTAT3, which can increase the expression of the tumor suppressor P1-HNF4A. Another anti-inflammation and anti-tumor gene, heme oxygenase-1 (HO-1) is induced by Interleukin 6 (IL-6) through the IL-6/Janus kinase (JAK)/STAT3 pathways in hepatoma cells [52] . In addition to STAT3, there are other possible upstream regulators in mediating the expression of HNF4A. In the adult liver, HNF6/Onecut 1(OC1), HNF1B, and HNF1A regulate the expression of HNF4A [53] . However, none of them has connected to the fucoidan activation.

In this study, we have proven that oligo-fucoidan binds to ASGPR1/2 receptors on hepatocytes. This is the first report to reveal the potential receptor for oligo-fucoidan. Our study provides insight into oligo-fucoidan through activation of the ASGPR1/2/STAT3/P1-HNF4A axis, which results in resetting the genetic regulatory networks of hepatocytes and enhancing the overall healthy physiological status of the cells. We suggest that oligo-fucoidan not only protects hepatocytes against microbial and virus infections, but also increases hepatocyte viability and activity. Oligo-fucoidan could be a robust potential candidate for future drug development in liver diseases and even virus infections.

Using transcriptomic analysis of the liver from wild-type zebrafish after feeding oligo-fucoidan, we found that genes involved in immune system development were upregulated, especially in that we verified the expression of anti-viral, anti-microbial, and immune modulation proteins by qPCR. Our data suggest that oligo-fucoidan might enhance the anti-viral ability and increase the immunity against virus infection. We also found that genes involved in lipid metabolism, fibrosis, and liver cancer were downregulated, and especially we verified the expression of fasn, scd, loxl2a, foxo3b, and soat1 by qPCR. We have proven that oligo-fucoidan binds to the ASGPR1/2 receptors on hepatocytes, and this is the first report to identify the potential receptor for oligo-fucoidan. We also provide strong evidence that the signal transduction cascade is activated after oligo-fucoidan binds to the ASGPR1/2 receptors, such as a STAT3-mediated signaling cascade. Our study provides insight into oligo-fucoidan through activation of the ASGPR1/2/STAT3/P1-HNF4A axis, which results in resetting the genetic regulatory networks of hepatocytes and enhancing the overall healthy physiological status of the cells.

Multiple liver insults synergize to accelerate experimental hepatocellular carcinoma

Precision diagnosis and treatment of liver cancer in China

Clinical applications of fucoidan in translational medicine for adjuvant cancer therapy

Protective effect of fucoidan from Fucus vesiculosus on liver fibrosis via the TGF-β1/Smad pathway-mediated inhibition of extracellular matrix and autophagy. Drug Des

Fucoidan partly prevents CCl4-induced liver fibrosis

Attenuation of N-nitrosodiethylamine-induced liver fibrosis by high-molecular-weight fucoidan derived fromCladosiphon okamuranus

Fucoidan Is a Novel Platelet Agonist for the C-type Lectin-like Receptor 2 (CLEC-2)

Carbohydrate clearance receptors in transfusion medicine

Platelet clearance by the hepatic Ashwell-Morrell receptor: Mechanisms and biological significance

Signal Transducer and Activator of Transcription 3 in Liver Diseases: A Novel Therapeutic Target

A systematic genome-wide analysis of zebrafish protein-coding gene function

The zebrafish reference genome sequence and its relationship to the human genome

The zebrafish model: Use in studying cellular mechanisms for a spectrum of clinical disease entities

Zebrafish: A model system for the study of human disease

There's Something Fishy About Liver Cancer: Zebrafish Models of Hepatocellular Carcinoma

Hepatitis B virus X antigen and aflatoxin B1 synergistically cause hepatitis, steatosis and liver hyperplasia in transgenic zebrafish

Liver-Specific Expressions of HBx and src in the p53 Mutant Trigger Hepatocarcinogenesis in Zebrafish

Overexpression of Endothelin 1 Triggers Hepatocarcinogenesis in Zebrafish and Promotes Cell Proliferation and Migration through the AKT Pathway

Ribose-5-phosphate isomerase A overexpression promotes liver cancer development in transgenic zebrafish via activation of ERK and β-catenin pathways

A Novel AURKA Mutant-Induced Early-Onset Severe Hepatocarcinogenesis Greater than Wild-Type via Activating Different Pathways in Zebrafish

Omics-based Investigation of Diet-induced Obesity Synergized with HBx, Src, and p53 Mutation Accelerating Hepatocarcinogenesis in Zebrafish Model

Up-regulation of golgi α-mannosidase IA and down-regulation of golgi α-mannosidase IC activates unfolded protein response during hepatocarcinogenesis

Gavaging Adult Zebrafish

Identification of Novel Anti-Liver Cancer Small Molecules with Better Therapeutic Index than Sorafenib via Zebrafish Drug Screening Platform

Identification of a noncanonical function for ribose-5-phosphate isomerase A promotes colorectal cancer formation by stabilizing and activating β-catenin via a novel C-terminal domain

Epidermal growth factor induces STAT1 expression to exacerbate the IFNr-mediated PD-L1 axis in epidermal growth factor receptor-positive cancers

Development of single vial kits for preparation of68Ga-labelled hexavalent lactoside for PET imaging of asialoglycoprotein receptor

Structure of Myxovirus Resistance Protein A Reveals Intra-and Intermolecular Domain Interactions Required for the Antiviral Function

Hepcidin and Host Defense against Infectious Diseases

The COVID-19 Pandemic: A Comprehensive Review of Taxonomy, Genetics, Epidemiology, Diagnosis, Treatment, and Control

Review: Nutrigenomics of marbling and fatty acid profile in ruminant meat

Insulin resistance promotes Lysyl Oxidase Like 2 induction and fibrosis accumulation in non-alcoholic fatty liver disease

Proteomic heterogeneity reveals SOAT1 as a potential biomarker for hepatocellular carcinoma

Current Status in Testing for Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH). Cells

Nonalcoholic Fatty Liver Disease/Nonalcoholic Steatohepatitis and Hepatocellular Carcinoma

Hepatic cytochrome P450 enzyme alterations in humans with progressive stages of nonalcoholic fatty liver disease

Nonalcoholic Fatty Liver Disease and Diabetes Are Associated with Decreased CYP3A4 Protein Expression and Activity in Human Liver

Resetting the transcription factor network reverses terminal chronic hepatic failure

Incompatibility of the circadian protein BMAL1 and HNF4α in hepatocellular carcinoma

P1 promoter-driven HNF4α isoforms are specifically repressed by β-catenin signaling in colorectal cancer cells

Fucoidan protects hepatocytes from apoptosis and inhibits invasion of hepatocellular carcinoma by up-regulating p42/44 MAPK-dependent NDRG-1/CAP43

Marine Algae as a Potential Source for Anti-Obesity Agents

Fucoidan and Cancer: A Multifunctional Molecule with Anti-Tumor Potential

Anti-inflammatory effect of fucoidan extracted from Ecklonia cava in zebrafish model

Brown Seaweed Fucoidan Inhibits Cancer Progression by Dual Regulation of mir-29c/ADAM12 and miR-17-5p/PTEN Axes in Human Breast Cancer Cells

Therapeutic Effects of Fucoidan: A Review on Recent Studies

Biological Activities of Fucoidan and the Factors Mediating Its Therapeutic Effects: A Review of Recent Studies

Landscape of Intercellular Crosstalk in Healthy and NASH Liver Revealed by Single-Cell Secretome Gene Analysis

Fucoidan Structure and Activity in Relation to Anti-Cancer Mechanisms

Hepatocyte nuclear factor 4 alpha deletion promotes diethylnitrosamine-induced hepatocellular carcinoma in rodents

The dark and the bright side of Stat3: Proto-oncogene and tumor-suppressor

Human Heme Oxygenase-1 Induced by Interleukin-6 via JAK/STAT3 Pathways Is a Tumor Suppressor Gene in Hepatoma Cells

The molecular functions of hepatocyte nuclear factors-In and beyond the liver

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license

Acknowledgments: We would like to thank Hi-Q Marine Biotech Co. Ltd. for providing the oligo-fucoidan for our research. We also would like to thank the Taiwan Zebrafish Core Facility at NTHU-NHRI for providing fish husbandry. Taiwan Zebrafish Core Facility at National Health Research Institutes is supported by a grant from MOST (105-2319-B-400-001). The assistance of the revision editing by Horng-Dar Wang is acknowledged.

Hi-Q Marine Biotech International Ltd. provided the oligo-fucoidan. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.