key: cord-0735842-0o593hg6
authors: Gómez, Juan; Melón, Santiago; Boga, José A.; Alvarez-Argüelles, Marta E.; Rojo-Alba, Susana; Leal-Negredo, Alvaro; Castello-Abietar, Cristian; Alvarez, Victoria; Cuesta-Llavona, Elías; Coto, Eliecer
title: Capillary Electrophoresis of PCR fragments with 5´-labelled primers for testing the SARS-Cov-2
date: 2020-07-10
journal: J Virol Methods
DOI: 10.1016/j.jviromet.2020.113937
sha: 74c964d18dcebf17812d4fc2d586f96dc8d5cefb
doc_id: 735842
cord_uid: 0o593hg6

Due to the huge demand for SARS-Cov-2 determination,alternatives to the standard qtPCRtestsare potentially useful for increasing the number of samples screened. Our aim was to develop a direct fluorescent PCR capillary-electrophoresis detection of the viral genome. We validated this approach on several SARS-Cov-2 positive and negative samples.We isolated the naso-pharingealRNA from 20 positive and 10 negative samples. The cDNA was synthesised and two fragments of the SARS-Cov-2 were amplified. One of the primers for each pair was 5´-end fluorochrome labelled. The amplifications were subjected to capillary electrophoresis in ABI3130 sequencers to visualize the fluorescent peaks.The two SARS-Cov-2 fragments were successfully amplified in the positive samples, while the negative samples did not render fluorescent peaks. In conclusion, we describe and alternative method to identify the SARS-Cov-2 genome that could be scaled to the analysis of approximately 100 samples in less than 5 hours. By combining a standard PCR with capillary electrophoresis our approach would overcome the limits imposed to many labs by the qtPCR and increase the testing capacity.

 -We designated an alternative to qtPCR for the identification of SARS-Cov-2  -The method was a PCR with 5-end fluorescent primers and capillary electrophoresis  -Two viral fragments amplified in several SARS-Cov-2 positive and negative specimens  -This approach would increase the testing capacity of diagnostic labs Abstract.

Due to the huge demand for SARS-Cov-2 determination,alternatives to the standard qtPCRtestsare potentially useful for increasing the number of samples screened. Our aim was to develop a direct fluorescent PCR capillary-electrophoresis detection of the viral genome. We validated this approach on several SARS-Cov-2 positive and negative samples.We isolated the naso-pharingealRNA from 20 positive and 10 negative samples. The cDNA was synthesised and two fragments of the SARS-Cov-2 were amplified. One of the primers for each pair was 5´-end fluorochrome labelled. The amplifications were subjected to capillary electrophoresis in ABI3130 sequencers to visualize the fluorescent peaks.The two SARS-Cov-2 fragments were successfully amplified in the positive samples, while the negative samples did not render fluorescent peaks. In conclusion, we describe and alternative method to identify the SARS-Cov-2 genome that could be scaled to the analysis of approximately 100 samples in less than 5 hours. By combining a standard PCR with capillary electrophoresis our approach would overcome the limits imposed to many labs by the qtPCR and increase the testing capacity. FCE has several advantages compared to other techniques such as visualization of PCR fragments on agarose or polyacrilamide gels. It requires lower amounts of the target nucleic acid, and the whole process is automated and consume less time and resources.

Moreover, the absence/presence of a PCR-fragment is interpreted by a software that measures the fluorescent intensity, that is proportional to the amount of the target sequence in the sample. FCE has also advantages relative to the qtPCR, such as the rapid and sensitive detection of dozens of different PCR fragments in single runs (Lian et al., 2016) . During the first months of the COVID19 pandemic we faced a demand for SARS-Cov-2 testing that exceeded our qtPCR capacity. Nowadays, the COVID 19 pandemic scenario is being increasing over the world. Furthermore, a second wave of the infection in countries that have already dropped down the epidemic curve it is a real possibility. For this reason we worked in the design and validation of an alternative method that could take advantage of capillary sequencers, available in many labs.

We describe a technical approach to SARS-Cov-2 testing by amplifying fragments of the viral genome with 5´-fluorescent primers followed by capillary electrophoresis in an (supplementary figure 1) . The 20 positive samples amplified the two SARS-Cov-2 fragments, that were not detected in the 10 negative samples (Figure 1) . The viral fragments from the 20 positive samples were Sanger sequenced with BigDye chemistry in an ABI3130xl equipment (supplementary figures 2, 3) . The SARS-Cov-2 primers were designated from the reference sequence in the NCBI Virus In conclusion, we present an alternative method for the detection of the SARS-Cov-2 genome in biological samples. Our approach was based on capillary electrophoresis of fluorescent PCRs, and permits the screening of 96 samples in less than 5 hours. The method was validated with 20 virus positive and 10 virus negative samples, and would require a validation by each lab before its application. Our aim was not to "substitute" the gold qtPCR technique, but to develop an alternative to facilitate the analysis when the demand for COVID19 testing exceeds the capacity of the qfPCR of any lab that can implement the FCE technique.

Contributorship. All the authors contributed to this work by recruiting the cohorts or performing the genetic and statistical analysis. 1-11) . G and N, lack of amplification in the tubes containing genomic DNA and water (negative controls).Lower: PCR of a SARS-Cov-2 genome in cDNAs from viral positives (4-11) and negatives (1-3). These fragments were Sanger sequenced (supplementary figures).

Briefly, two µL of the RT reactions were subjected to 32 PCR cycles with primer-pairs specific for either ACTB or the viral genome in a final vol of 30 µL. 10 µL of the PCRs were electrophoresed on 3% agarose gels to visualize the presence of the corresponding fragments.

L= 1 kb ladder, size marker.

J o u r n a l P r e -p r o o f

Genomic Analysis and Comparative Multiple Sequence of SARS-CoV2

Guidelines for Laboratory Diagnosis of Coronavirus Disease

Rapid Detection of Respiratory Pathogens for Community-Acquired Pneumonia by Capillary Electrophoresis-Based Multiplex PCR

Capillary electrophoresis based on nucleic acid detection for diagnosing human infectious disease

Rapid and sensitive detection of 68 unique varicella zoster virusgene transcripts in five multiplex reverse transcription polymerasechain reactions

Clinical evaluation of a SARS-CoV-2 RT-PCR assay on a fully automated system for rapid on-demand testing in the hospital setting

Evaluation of a quantitative RT-PCR assay for the detection of the emerging coronavirus SARS-CoV-2 using a high throughput system

The establishment of reference sequence for SARS-CoV-2 and variation analysis

Genotyping coronavirus SARS-CoV-2: methods and implications

Comparison of Four Molecular In Vitro Diagnostic Assays for the Detection of SARS-CoV-2 in Nasopharyngeal Specimens

Figure 2. Capillary electrophoresis of the fluorescent PCR fragments from three SARS-Cov-2 positive cDNAs (three upper lines) and a negative sample (lower line). The two peaks corresponded to fragment 1 (180 bp) and fragment 2

same tube (30 µL final volume; 32 cycles of 95ºC-30 s, 62ºC-30s, 72ºC-30s). The primers for fragment 1 were 5-FAM-5´CTTCACACTCAAAGGCGGTGCACC (forward) and 5´GCGAACTCATTTACTTCTGTACCGAGTTC (fragment size=180 bp). The primers for fragment 2 were HEX-5´GCTG TCAAATTACAGAATAATGAGCTTAGTCC (forward) and 5´CGGATAACA GTGCAAGTACAAACCTACC (fragment size=162 bp).10 µL of the PCRs were mixed with 20 µL of deionised formamide