key: cord-0721660-w1vp9hsc
authors: Dong, Wenjuan; Mead, Heather; Tian, Lei; Park, Jun-Gyu; Garcia, Juan I.; Jaramillo, Sierra; Barr, Tasha; Kollath, Daniel S.; Coyne, Vanessa K.; Stone, Nathan E.; Jones, Ashley; Zhang, Jianying; Li, Aimin; Wang, Li-Shu; Milanes-Yearsley, Martha; Torrelles, Jordi B.; Martinez-Sobrido, Luis; Keim, Paul S.; Barker, Bridget Marie; Caligiuri, Michael A.; Yu, Jianhua
title: The K18-Human ACE2 Transgenic Mouse Model Recapitulates Non-severe and Severe COVID-19 in Response to an Infectious Dose of the SARS-CoV-2 Virus
date: 2022-01-12
journal: J Virol
DOI: 10.1128/jvi.00964-21
sha: a842248c82dd8d2828c607f034bae0012a10c354
doc_id: 721660
cord_uid: w1vp9hsc

A comprehensive analysis and characterization of a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection model that mimics non-severe and severe coronavirus disease 2019 (COVID-19) in humans is warranted for understating the virus and developing preventive and therapeutic agents. Here, we characterized the K18-hACE2 mouse model expressing human (h)ACE2 in mice, controlled by the human keratin 18 (K18) promoter, in the epithelia, including airway epithelial cells where SARS-CoV-2 infections typically start. We found that intranasal inoculation with higher viral doses (2 × 10(3) and 2 × 10(4) PFU) of SARS-CoV-2 caused lethality of all mice and severe damage of various organs, including lung, liver, and kidney, while lower doses (2 × 10(1) and 2 × 10(2) PFU) led to less severe tissue damage and some mice recovered from the infection. In this hACE2 mouse model, SARS-CoV-2 infection damaged multiple tissues, with a dose-dependent effect in most tissues. Similar damage was observed in postmortem samples from COVID-19 patients. Finally, the mice that recovered from infection with a low dose of virus survived rechallenge with a high dose of virus. Compared to other existing models, the K18-hACE2 model seems to be the most sensitive COVID-19 model reported to date. Our work expands the information available about this model to include analysis of multiple infectious doses and various tissues with comparison to human postmortem samples from COVID-19 patients. In conclusion, the K18-hACE2 mouse model recapitulates both severe and non-severe COVID-19 in humans being dose-dependent and can provide insight into disease progression and the efficacy of therapeutics for preventing or treating COVID-19. IMPORTANCE The pandemic of coronavirus disease 2019 (COVID-19) has reached nearly 240 million cases, caused nearly 5 million deaths worldwide as of October 2021, and has raised an urgent need for the development of novel drugs and therapeutics to prevent the spread and pathogenesis of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To achieve this goal, an animal model that recapitulates the features of human COVID-19 disease progress and pathogenesis is greatly needed. In this study, we have comprehensively characterized a mouse model of SARS-CoV-2 infection using K18-hACE2 transgenic mice. We infected the mice with low and high doses of SARS-CoV-2 to study the pathogenesis and survival in response to different infection patterns. Moreover, we compared the pathogenesis of the K18-hACE2 transgenic mice with that of the COVID-19 patients to show that this model could be a useful tool for the development of antiviral drugs and therapeutics.

indicating a recovery from the viral infection in low-dose groups. Consistent with body weight data, 90% of the mice infected with 2 Â 10 3 PFU (high) or 2 Â 10 4 PFU (highest) died approximately at day 7, whereas 50% of the mice infected with 2 Â 10 1 PFU or 2 Â 10 2 PFU died approximately at day 10 ( Fig. 1C) . One or two mice out of five infected with 2 Â 10 1 PFU or 2 Â 10 2 PFU, respectively, and none infected with 2 Â 10 3 PFU or 2 Â 10 4 PFU, recovered and survived until the end of follow-up on day 20 p.i. (Fig. 1C) .

Expression distribution of viral genes in the tissues of K18-hACE2 mice infected with high or low doses of SARS-CoV-2. To further investigate the viral infection pattern, we used reverse transcriptase (RT)-PCR to measure viral spike protein RNA levels in the brain, trachea, lung, liver, spleen, small intestine, stomach, large intestine, kidney, and testis. The mean viral copy numbers in tissues, where the dose-dependent effect is expected, were similar for the high and highest two doses in all tissues. Interestingly, mice infected with 2 Â 10 1 PFU did not present virus in the spleen ( Fig.  2A) . We observed three types of dose-response relationships. In the stomach, there was a stepwise dose-response relationship. In the heart, liver, spleen, and small intestine, we observed a plateau, with the 3 higher dose groups having similar viral copy numbers. In the brain, large intestine, and testis, mice infected with 2 Â 10 1 PFU and 2 Â 10 2 PFU had similar viral copy numbers, and mice infected with 2 Â 10 3 PFU and 2 Â 10 4 PFU had similar viral copy numbers, but much higher than those of the two lower doses. This indicates that there are tissue-specific factors modulating the effect of dose on viral copy number. Viral RNA levels were high in the lungs of animals in all dose groups ( Fig. 2A) , consistent with the notion that the lung is an important site of infection, especially at lower viral doses. Viral RNA levels were also very high in the brain of mice infected with 2 Â 10 3 PFU or 2 Â 10 4 PFU. We used immunohistochemistry (IHC) to measure the expression of SARS-CoV-2 nucleocapsid protein (NP) in formalin-fixed, paraffin-embedded (FFPE) tissues, which confirmed the infection pattern in the lung and brain of the K18-hACE2 mice infected with a series of increasing viral doses, demonstrating that viral spread in tissues was also dose-dependent (Fig. 2B) . We also measured the infectious virus titer of the lung harvested from mice infected with the highest 2 Â 10 4 PFU dose at different time points p.i., by a plaque assay on homogenized tissues. The infectious virus titer peaked at day 2 p.i. and then decreased in a time-dependent manner, reaching almost complete virus clearance at day 5 p.i. (Fig. 2C ). Our data are consistent with a previous report using a higher dose (16) .

To evaluate lung cell types that are susceptible to SARS-CoV-2 infection, we performed double IHC staining on samples from mice infected with different doses of SARS-CoV-2. We double stained lung sections for viral NP and CCL10, which is the marker of club (clara) cells, or surfactant protein C (SPC), the marker of alveolar epithelial type 2 cells, respectively. We found that some club cells and many alveolar type 2 cells co-localized with NP, suggesting they are susceptible to SARS-CoV-2 infection (Fig. 3A ). Macrophages are a major immune cell population in the lung, where they act as a first-line defense against invading pathogens. We therefore used CD68 as a macrophage marker to examine if SARS-CoV-2 could infect tissue-resident macrophages in the lung. We noticed that that CD68 positive cells migrated dramatically to the lung in response to SARS-CoV-2 infection, although only a few macrophages stained positive for NP, suggesting that it could be possible for SARS-CoV-2 to suppress immune response via infection of lung macrophages (Fig. 3A) . Consistent with the finding in the K18-hACE2 mouse model, in postmortem lung samples from COVID-19 patients, a few viral spike proteins (teal) were colocalized with alveolar epithelial type 2 cells (yellow) and CD68-positive cells (yellow) (Fig. 3B ). These results are in line with another SARS-CoV-2 infection mouse model that uses CRISPR/Cas9 knock-in of hACE2 into Exon 2 of the mAce2 gene, as well as COVID-19 patient samples, which show SARS-CoV-2 in macrophages of pulmonary alveolus (14, 17) . Given the high levels of SARS-CoV-2 in the brain, we examined whether neurons were infected with SARS-CoV-2. We found strong overlap between staining for the neuronal marker Neu and staining for NP (Fig. 3A) .

Furthermore, human lung alveolar epithelial type II cells were injured significantly by SARS-CoV-2 virus infection (Fig. 3B ). This was identified by the reduction of the number and stain intensity of SPC positive cells (yellow) in the infected lung of the postmortem samples compared to the non-infected lung (Fig. 3B) . In COVID-19 lung sample #1, which has the highest virus amount (teal), the SPC positive cells are almost completely lost, whereas in the other lungs, SPC positive cells are low and have fallen off from the epithelium into the alveolar lumen (Fig. 3B ). Our results indicated that the K18-hACE2 mice could be a suitable model for mimicking the infections of the COVID-19 patients. Histopathology of tissues of K18-hACE2 mice infected with SARS-CoV-2. To assess disease severity, H&E staining was performed for histopathological evaluation in various organs from K18-hACE2 mice infected with a series of increasing doses of SARS-CoV-2. As expected, lung tissues showed the most severe damage. Mice in the low-dose groups showed an average of 30-60% more alveolar congestion and consolidation compared to uninfected mice (Fig. 4A ). Some lung tissues showed alveolar hemorrhage as well as lymphocytic pneumonitis with alveolar thickening and peripheral parenchymal collapse. Lung damage in the high-dose groups was even more extensive, consisting of ;20% alveolar collapse with ruptured septa, as well as thickened alveolar and intra-alveolar septa. Parenchymal consolidation was evident in 50% 

Journal of Virology of the tissue, along with interstitial inflammation and pneumonitis (Fig. 4A) . Similarly, trachea tissues showed mild epithelial damage in the lower-dose groups and more severe epithelial damage in the higher-dose groups. Consistent with the brain showing high viral gene expression for the higher-dose groups ( Fig. 2A ), brain tissues showed mild congestion in some mice from the low-dose groups, with more extensive congestion in the high-dose groups. In liver tissues, the low-dose groups showed several foci of spotty and patchy necrosis (focal perivenular), Kupffer cell hyperplasia, and focal portal inflammation; the high-dose groups also showed Kupffer cell hyperplasia along with congestion, reactive change, apoptotic hepatocytes, and focal lobular inflammation (Fig. 4A ). In the spleen, the low-dose groups showed red pulp congestion while the high-dose groups also showed lymphoid hyperplasia and mild extramedullary hematopoiesis. The stomach and small and large intestines in the low-dose groups appeared normal but in the high-dose groups, the stomach showed reactive changes, diffuse epithelial sloughing, and chronic inflammation along the myenteric plexus, while the small and large intestine showed myenteric plexus inflammation. The testis in the low-dose groups also appeared normal but showed focal tubular damage and congestion in the high-dose groups. In the kidney, both the low-dose and high-dose groups showed cortical congestion, tubular damage, and focal tubular collapse. Meanwhile, both the low-dose and high-dose groups showed ischemic change and disarray in the heart (Fig. 4A ). These findings indicate that SARS-CoV-2 infection damages multiple tissues, with a dose-dependent effect in most tissues.

To compare the pathological findings in the mouse model to COVID-19 patients, we also examined postmortem samples of COVID-19 patients. We identified congestion and inflammation in multiple organs, as well as epithelial damage and necrosis, which was consistent with our findings in the SARS-CoV-2-infected K18-hACE2 mouse model (Fig. 4B) .

Expression of hACE2 in K18-hACE2 mice and human tissues. To better understand the infection pattern and virus distribution in this mouse model, we measured hACE2 RNA expression levels in various tissues of K18-hACE2 mice by RT-PCR. We found that, compared to the expression of hACE2 in the lung, there was also high expression in the brain, trachea, heart, stomach, small intestine, large intestine, kidney, and testis; whereas there was lower expression in the liver and spleen (Fig. 5A) . We also confirmed the hACE2 expression in the brain, trachea, lung, and kidney of the k18-hACE2 mice at the protein level by IHC (Fig. 5B ). The expression of hACE2 in the brain, trachea, and lung tissues in mice is consistent with the finding that they had the highest viral copy numbers (Fig. 5B vs. Fig. 2A) , further confirming the K18-hACE2 mouse is a good model for studying in vivo SARS-CoV-2 infection. We also examined hACE2 expression in a human tissue array (Fig. 5C ). We found that hACE2 is not only highly expressed in the lung but also in the stomach, small and large intestine, kidney, and testis. However, the expression of ACE2 in the human brain was not as high as in the brain of K18-hACE2 mice; this could be due to the insertion of the K18 promoter, which confers higher expression of hACE2 in the mouse model (Fig. 5C ). This finding is consistent with another transgene driven by a human K18 regulatory element in mice (18) .

Protective role of sera from previously infected mice and resistance of lowdose-infected surviving mice to high-dose rechallenge in the K18-hACE2 model. To evaluate if the sera from infected mice could protect the mice from viral infection, sera were collected from mice infected with 2 Â 10 4 PFU SARS-CoV-2 at day 6 p.i. Collected sera were injected intravenously (i.v.) into virus-naive mice. Two days later, mice receiving a prior dose of sera were intranasally infected with 2 Â 10 4 PFU SARS-CoV-2, followed by an immediate i.v. injection of second dose of sera. Body weights of treated versus control mice were monitored daily. Mice treated with sera from infected mice showed a delayed and slower body weight drop compared to the untreated group (Fig. 6A) , suggesting sera from infected mice had a protective effect on newly infected mice. Sera from infected mice did not significantly protect but show a trend against death after virus rechallenge, which might be due to the little amount of sera that we could collect to have a large enough sample size of transfused mice for the sera protection experiments (Fig. 6B) . Another reason for the moderate protective effect could be that the neutralizing antibody titer at day 6 may be low. To investigate this possibility, mice were infected with a lower dose, 1 Â 10 3 PFU, so that some mice could survive long enough to collect sera. We collected sera at days 6 and 13 p.i. and measured relative anti-spike antibody levels by ELISA. Our data indeed showed that anti-spike antibody levels at day 6 p.i. were significantly lower than those at day 13 p.i. (Fig. 6C) . These data indicate that the small amount of neutralizing antibody in sera collected at day 6 p.i. may not be enough for protecting mice receiving passive transfer of the sera.

In addition, we rechallenged the mice that survived 2 Â 10 1 or 2 Â 10 2 PFU infection with 2 Â 10 4 PFU virus when they recovered to their initial body weight. We found that all mice survived the high-dose virus re-challenge without showing a substantial body weight drop, suggesting that recovery from low-dose infection conferred antiviral activity that protected against rechallenge with high dose virus (Fig. 6B) . These results suggest that patients who survive from SARS-CoV-2 infection should be more resistant to the next infection with the same SARS-CoV-2 strain than people without prior infection. 

The recent outbreak of SARS-CoV-2 that has claimed the lives of nearly 5 million people to date has led to an urgent need for a mouse infection model that accurately mirrors inoculation, development, and progression of the human disease termed COVID-19. The K18-hACE2 model was developed to study coronavirus infection (11) . In the current study, we performed a comprehensive analysis of viral distribution and tissue pathology based on a range of inoculation doses and compared the results to observations in postmortem samples from COVID-19 patients. We found a dose-response relationship between infectious dose and loss of body weight, viral titer, tissue pathology, and mortality. Notably, there was not a uniform relationship between infectious dose and viral copy numbers, with some tissues accumulating virus at lower while others at higher copy number. We evaluated hACE2 levels in K18-hACE2 mice and found similarity to ACE2 levels in humans. We also showed that challenge with a low dose of SARS-CoV-2 protected against the lethality of rechallenge with a higher dose. Overall, our results indicate that low-dose infection in the K18-hACE2 model mimics non-severe COVID-19, while infection with higher doses mimics severe COVID-19. of mice treated with sera from previously infected mice and prior low dose-infected mice being challenged with a high dose of SARS-CoV-2. Mice with serum protection were infected with 2 Â 10 4 PFU per mouse SASR-CoV-2 24 h after being infused with sera from mice infected with 2 Â 10 4 PFU virus per mouse for 6 days. For the rechallenge, mice were infected with the low dose of 2 Â 10 1 PFU or 2 Â 10 2 PFU per mouse SASR-CoV-2 for 2 weeks and then were rechallenged with the high dose of 2 Â 10 4 PFU per mouse SASR-CoV-2. Survival of mice was analyzed by the Kaplan-Meier method and the log-rank test. (C) Mice were infected with 1 Â 10 3 PFU at day 0. Sera in the peripheral blood were collected via tail vein bleeding 6 days postinfection (dpi) or right before mice were sacrificed at 13 dpi. Relative anti-spike antibody levels were measured by ELISA. Data are presented as mean 6 standard deviations. Statistical analyses were performed by one-way ANOVA with P values corrected for multiple comparisons by the Bonferroni test (n = 4 or 5 mice). **, P , 0.01; ***, P , 0.001; ****, P , 0.0001.

Due to the unprecedented impact of the COVID-19 pandemic, many models of human COVID-19 are under investigation. In addition to the K18-hACE2 model, other mouse models have been described. Hassan et al. used replication-defective adenoviruses encoding human ACE2-tranduced mice to infect BALB/c mice, followed by SARS-CoV-2 infection, to model COVID-19 (15) . Following infection by 10 5 focus-forming units (FFU) of SARS-CoV-2, the body weight of mice was maintained but did not drop, therefore it seems that the model is not a lethal model. Using CRISPR/Cas9 technology to knock-in hACE2, Sun et al. established a model (14) . In response to 4 Â 10 5 PFU of SARS-CoV-2, the animals experienced robust viral replication in multiple tissues and interstitial pneumonia, but no obvious clinical symptoms or mortality; only 10% of aged mice lost their weight at day 3 p.i. and recovered. With the low incidence rate and very mild symptoms, this model is not ideal to recapitulate human COVID-19. This might be due to the nature of the knock-in with only one copy of hACE2 systemically existing in mice. Qin and colleagues developed a hACE2 transgenic mouse model with a mouse ACE2 promoter for SARS and used the model to study SARS-CoV-2 infection (13, 19) . Infected by 1 Â 10 5 TCID50 of SARS-CoV-2, the mouse body weights dropped at day 1 and continued until day 5, and then almost completely recovered on day 14 without lethality, suggesting that this model at least does not mimic severe COVID-19 patients. This might be due to lower promoter activity or gene expression of murine (m)ACE2 compared to the K18 promoter (19) . Ostrowski et al. developed transgenic mice using the promoter of the human FOXJ1, a transcription factor required for differentiation of ciliated epithelial cells in the airway, to drive hACE2 expression (20) . Jiang and colleagues used this model to study SARS-CoV-2 (12). Infected with 3 Â 10 4 PFU SARS-CoV-2, among 10 mice, 2 had no infection, 4 had no drop in body weight, and 4 had body weight drops with 3 deaths and 1 recovery (12) . In contrast, for the K18-hACE2 model that we characterized here, with the dose of 2 Â 10 3 PFU, which is lower than the doses used in all above mouse models, all mice succumbed to infection with body weight drops and mortality of 100% by day 8. With lower dose infection such as 2 Â 10 1 and 2 Â 10 2 PFU, 30% of the mice recovered. Collectively, these suggest that the K18-hACE2 model is the most sensitive model for COVID-19, with ability to recapitulate aspects of human disease from both non-severe and severe COVID-19 patients. Our results are supported by those from other groups (16, (21) (22) (23) (24) . This might be due to unique aspects of the K18-hACE2 model: 1) hACE2 is used, where in contrast other models including golden hamster, ferret, cat, Chinese tree shrew, and even mouse models with an endogenous ACE2 promoter recapitulate human expression levels (25) ; 2) multiple copies of hACE2 are placed in the murine genome (11), whereas one copy of hACE2 may not be ideal, evidenced by the knock-in study by Sun et al. (14) ; and 3) the human K18 promoter is likely stronger than the promoters in other models, such as the human FOXJ1 in the study by Jiang et al. (12) . Apart from the animal models mentioned above, some mouse-adapted models of SARS-CoV-2 were also used for studying pathogenesis of SARS-CoV-2. In these models, recombinant mouse-adapted strains of SARS-CoV-2 bind the mouse ACE2 for viral entry; however, it is possible that accumulated mutations may not occur in humans (26) (27) (28) (29) .

The pathological damage in the lung and brain in the K18-hACE2 mouse infection model is similar to the clinical symptoms of COVID-19 patients, suggesting that this mouse model can recapitulate SARS-CoV-2 infection in humans. However, the K18-hACE2 mouse model was originally generated by inserting hACE2 in the mouse genome under the human K18 promoter, which may not result in the exact distribution of ACE2 expression as in humans. In fact, we observed high expression levels of hACE2 in mouse brains, correlating with a higher virus titer in the brain compared to most other organs or tissues; however, in the postmortem samples of humans, the hACE2 expression is very low. Nonetheless, brain infections with SARS-CoV-2 and deaths of patients from brain-specific COVID-19 have been frequently reported (30) (31) (32) . Interestingly, our study showed that SARS-CoV-2 can infect neurons in an animal model, which is consistent with previous studies using human neuron organoids (33) (34) (35) . It will be interesting to know whether this neuronal infection causes taste and smell loss, commonly found in patients with COVID-19, as neuronal circuits respond to gustatory and olfactory cues (36) .

In summary, we characterized the K18-hACE2 model for COVID-19 in comparison to human postmortem samples. The model shows dose-dependent sensitivity to SARS-CoV-2 infection. Infection with low doses recapitulates the disease observed in nonsevere COVID-19 patients, while infection with higher doses recapitulates the disease observed in patients with severe COVID-19. The K18-hACE2 humanized COVID-19 mouse model is excellent to study COVID-19 and develop preventive and therapeutic drugs, as well as vaccines, for coronavirus diseases.

Ethics statement. Mouse-model studies were performed in an animal biosafety level 3 (ABSL3) facility. The animal protocol of these studies was reviewed and approved by the institutional animal care and use committee (IACUC) of Northern Arizona University (protocol #20-005) and the committee of Texas Biomedical Research Institute (protocol #1718MU). Human postmortem COVID-19 patient samples were previously described (37) and were collected under the approval of the institutional review board.

Viruses, cells, and mice. The SARS-CoV-2 strain used in the mouse model was SARS-CoV-2/human/ USA/WA-CDC-WA1/2020, which was obtained from the Biodefense and Emerging Infections Research Resources (BEI Resources). The viruses were amplified using Vero-E6 cells (ATCC). Vero-E6 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal bovine serum (FBS) at 37°C and 5% CO 2 . Cells were inoculated with virus at a multiplicity of infection (MOI) of 0.001 and cultured for 96 h. Then the supernatant was collected and titrated using a plaque assay.

The K18-hACE2 transgenic mice, in which the human keratin 18 (KRT18) promoter was used to direct human ACE2 expression, were purchased from The Jackson Laboratory.

Mouse infection. Female and male 6-to 8-week-old K18-hACE2 transgenic mice under the C57BL/6J background were anesthetized and intranasally (i.n.) infected with SARS-CoV-2 virus at a dose of 2 Â 10 1 , 2 Â 10 2 , 2 Â 10 3 , or 2 Â 10 4 PFU/mouse. The uninfected control mice were inoculated with phosphate-buffered saline (PBS). All the mice were observed and weighed daily. Peripheral blood was collected on day 6 from high dose groups and used for serum protection experiments. The mice were euthanized at day 6 postinfection, and the tissues were collected for further analysis.

Viral rechallenge model. The mice that survived i.n. infection with 2 Â 10 1 PFU and 2 Â 10 2 PFU of virus were rechallenged with 2 Â 10 4 PFU virus i.n. 2 weeks after the initial infection when they recovered to the initial body weight. The body weight was continuously monitored.

Serum protection model. Sera of the mice infected by 2 Â 10 4 PFU virus were collected at day 6 postinfection. Half of the sera were intraperitoneally injected into the non-infected mice 2 days before the mice were i.n. infected with 2 Â 10 4 PFU virus. The other half of the sera were intraperitoneally administered right before the infection.

Tissue preparation to detect viral copy number. Mouse tissues were collected, weighed, and immediately homogenized using an electric homogenizer (Thomas Scientific). After centrifugation at 1200g for 10 min, the supernatant was isolated and used to detect viral RNA copy number by real-time PCR (see below).

Viral RNA copy number detection. Viral RNA was isolated from homogenized tissues using the PureLink RNA minikit (Invitrogen). A one-step RT-PCR kit (Bio-Rad) was used to detect the viral RNA using Applied Biosystems QuantStudio 12K Flex real-time PCR system with the following cycling protocol: reverse transcription at 50°C for 10 min; hot start at 95°C for 10 min; and 40 cycles of denaturation at 95°C for 10 s and annealing at 60°C for 30 s. The primer sequences were CoV2-S_19F (59 -GCTGAACATGTCAACAACTC-39) and CoV2-S_143R (59 -GCAATGATGGATTGACTAGC-39), which were designed to target a 125 bp region of the SARS-CoV-2 spike protein (38) . The standard samples were serial 10-fold dilutions of a known copy number of the HKU1 virus. The results were normalized and expressed as genome equivalent copies per gram of tissue.

Infectious viral load measurement. Lungs from infected mice were collected and homogenized. Confluent monolayers of Vero E6 cells were infected with serial dilutions of supernatants obtained from the lung homogenates. The immuno-plaque assay with the SARS-CoV-2 NP antibody was performed to measure the viral load.

Measurement of anti-spike antibody. His-tagged full-length SARS-CoV-2 S protein (Cat. # 40589-V08B1, Sino Biological) was used as a coating protein. The plate was incubated with mouse serum samples for 2 h. The HRP-conjugated goat anti-mouse IgG antibody (Cat# 05-4220, Invitrogen) was used as the detecting antibody. Absorbance was measured at 450 nm by a Multiskan FC Microplate Photometer (Fisher Scientific).

Human ACE2 RNA quantification. Total RNA from the indicated tissues of the K18-hACE2 mice was isolated using the PureLink RNA minikit (Invitrogen), and cDNA was synthesized using SuperScript Reverse Transcriptase (Thermo Fisher). Human ACE2 expression was examined using the following primers: F: CGAAGCCGAAGACCTGTTCTA; R: GGGCAAGTGTGGACTGTTCC, under the following PCR conditions: 98°C for 30 s, followed by 40 cycles of 98°C for 15 s, 62°C for 30 s, and 72°C for 60 s.

Immunohistochemistry and HandE staining. Tissues were harvested from the infected K18-hACE2 mice and immediately fixed in 10% neutral buffered formalin. Dehydration, clearing, and paraffinization were performed on a Tissue -Tek VIP Vacuum Infiltration Processor (SAKURA). The samples were embedded in paraffin using a Tissue-Tek TEC Tissue Embedding Station (SAKURA). Samples were then sectioned at 5 mm and put on positively charged glass slides. The slides were deparaffinized, rehydrated, and stained with Modified Mayer's Hematoxylin and Eosin Y Stain (America MasterTech Scientific) on an H&E Auto Stainer (Prisma Plus Auto Stainer, SAKURA) according to standard laboratory procedures.

Single or double IHC stains were performed on Ventana Discovery Ultra (Ventana Medical Systems, Roche Diagnostics, Indianapolis, USA) IHC Auto Stainer. Briefly, slides were loaded on the machine, and deparaffinization, rehydration, endogenous peroxidase activity inhibition, and antigen retrieval were first performed. For single IHC staining, primary antibodies were incubated with DISCOVERY anti-Rabbit HQ, followed by DISCOVERY anti-HQ-HRP incubation. For double IHC staining, two antigens were sequentially detected and heat inactivation was used to prevent antibody cross-reactivity between the same species. Following each primary antibody incubation, DISCOVERY anti-Rabbit HQ or NP or DISCOVERY anti-Mouse HQ or NP and DISCOVERY anti-HQ-HRP or anti-NP-AP were incubated. The stainings were visualized with DISCOVERY ChromoMap DAB Kit, DISCOVERY Yellow Kit, DISCOVERY Teal Kit, or DISCOVERY Purple Kit, and accordingly counterstained with hematoxylin (Ventana) and coverslipped. The following primary antibodies used were: SPIKE (40150-T62, Sino Biological, at 1:2000), NP (NB100-56576, NOVUS, 1/100), hACE2 (AMAB91262, Sigma, at 1:1000), CCL10 (SC-365992#, Santa Cruz at 1/ 5000), Pro-SPC (AB37386, Millipore at 1/500), CD68 (ab125212, abcam, at 1/100), and NeuN (24307, cell signaling, at 1/100).

Statistical analysis. Comparison of 2 groups was performed using Student's two-tailed t test (for unpaired samples) or a paired t test (for paired samples). Multiple groups were compared using one-way or two-way ANOVA, and P values were adjusted for multiple comparisons by Holm's procedure or the Bonferroni test. A P value of less than 0.05 was considered statistically significant. Kaplan-Meier analysis was performed on the survival curves.

The incubation period of coronavirus disease 2019 (COVID-19) from publicly reported confirmed cases: estimation and application

COVID-19 acute respiratory distress syndrome (ARDS): clinical features and differences from typical pre

COVID-19 and metabolic disease: mechanisms and clinical management

COVID-19 and autoimmune diseases

COVID-19 and autoimmune diseases: a systematic review of reported cases

Immune determinants of COVID-19 disease presentation and severity

Piroth L, the LYMPHONIE study group. 2020. The dysregulated innate immune response in severe COVID-19 pneumonia that could drive poorer outcome

Impaired immune cell cytotoxicity in severe COVID-19 is IL-6 dependent

Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein

Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus

Pathogenesis of SARS-CoV-2 in Transgenic mice expressing human angiotensin-converting enzyme 2

The pathogenicity of SARS-CoV-2 in hACE2 transgenic mice

A mouse model of SARS-CoV-2 infection and pathogenesis

A SARS-CoV-2 infection model in mice demonstrates protection by neutralizing antibodies

Lethality of SARS-CoV-2 infection in K18 human angiotensin-converting enzyme 2 transgenic mice

The NU SCRIPT Study Investigators. 2021. Circuits between infected macrophages and T cells in SARS-CoV-2 pneumonia

Development of an epithelium-specific expression cassette with human DNA regulatory elements for transgene expression in lung airways

Mice transgenic for human angiotensin-converting enzyme 2 provide a model for SARS coronavirus infection

Targeting expression of a transgene to the airway surface epithelium using a ciliated cell-specific promoter

SARS-CoV-2 infection in K18-ACE2 transgenic mice replicates human pulmonary disease in COVID-19

Evaluation of K18-hACE2 mice as a model of SARS-CoV-2 infection

SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung inflammation and impaired function

K18-hACE2 mice develop respiratory disease resembling severe COVID-19

Pathogenesis and transmission of SARS-CoV-2 in golden hamsters

Characterization and structural basis of a lethal mouseadapted SARS-CoV-2

A mouse-adapted SARS-CoV-2 induces acute lung injury and mortality in standard laboratory mice

A mouse-adapted model of SARS-CoV-2 to test COVID-19 countermeasures

2021. Q493K and Q498H substitutions in Spike promote adaptation of SARS-CoV-2 in mice

COVID-19 virus may have neuroinvasive potential and cause neurological complications: a perspective review

Letter to editor: severe brain haemorrhage and concomitant COVID-19 infection: a neurovascular complication of COVID-19

The COVID-19 pandemic: consideration for brain infection

Neurotropic effects of SARS-CoV-2 modeled by the human brain organoids

SARS-CoV-2 infects the brain choroid plexus and disrupts the blood-CSF barrier in human brain organoids

SARS-CoV-2 infects human neural progenitor cells and brain organoids

COVID-19 and the chemical senses: supporting players take center stage

FXa cleaves the SARS-CoV-2 spike protein and blocks cell entry to protect against infection with inferior effects in B.1.1.7 variant

Stenoparib, an inhibitor of cellular poly(ADP-ribose) polymerase, blocks replication of the SARS-CoV-2 and HCoV-NL63 human coronaviruses in vitro

This work was supported by grants from the NIH (NS106170, AI129582, CA247550, CA223400, CA210087, CA163205, and P30CA033572), the Leukemia and Lymphoma Society We declare that we have no conflicts of interest.