key: cord-0721606-2tazu4y6
authors: Liu, Zhida; Zhou, Hang; Wang, Wenjun; Tan, Wenjie; Fu, Yang-Xin; Zhu, Mingzhao
title: A novel method for synthetic vaccine construction based on protein assembly
date: 2014-12-01
journal: Sci Rep
DOI: 10.1038/srep07266
sha: 5d492015c79953419dd1cfc47ebf6b50297e0334
doc_id: 721606
cord_uid: 2tazu4y6

In the history of vaccine development, the synthetic vaccine is a milestone that is in stark contrast with traditional vaccines based on live-attenuated or inactivated microorganisms. Synthetic vaccines not only are safer than attenuated or inactivated microorganisms but also provide the opportunity for vaccine design for specific purposes. The first generation of synthetic vaccines has been largely based on DNA recombination technology and genetic manipulation. This de novo generation is occasionally time consuming and costly, especially in the era of genomics and when facing pandemic outbreaks of infectious diseases. To accelerate and simplify the R&D process for vaccines, we developed an improved method of synthetic vaccine construction based on protein assembly. We optimized and employed the recently developed SpyTag/SpyCatcher technique to establish a protein assembly system for vaccine generation from pre-prepared subunit proteins. As proof of principle, we chose a dendritic cell (DC)-targeting molecule and specific model antigens to generate desired vaccines. The results demonstrated that a new vaccine generated in this way does not hamper the individual function of different vaccine components and is efficient in inducing both T and B cell responses. This protein assembly strategy may be especially useful for high-throughput antigen screening or rapid vaccine generation.

In the history of vaccine development, the synthetic vaccine is a milestone that is in stark contrast with traditional vaccines based on live-attenuated or inactivated microorganisms. Synthetic vaccines not only are safer than attenuated or inactivated microorganisms but also provide the opportunity for vaccine design for specific purposes. The first generation of synthetic vaccines has been largely based on DNA recombination technology and genetic manipulation. This de novo generation is occasionally time consuming and costly, especially in the era of genomics and when facing pandemic outbreaks of infectious diseases. To accelerate and simplify the R&D process for vaccines, we developed an improved method of synthetic vaccine construction based on protein assembly. We optimized and employed the recently developed SpyTag/ SpyCatcher technique to establish a protein assembly system for vaccine generation from pre-prepared subunit proteins. As proof of principle, we chose a dendritic cell (DC)-targeting molecule and specific model antigens to generate desired vaccines. The results demonstrated that a new vaccine generated in this way does not hamper the individual function of different vaccine components and is efficient in inducing both T and B cell responses. This protein assembly strategy may be especially useful for high-throughput antigen screening or rapid vaccine generation.

S ince the creation of the first vaccine, for cowpox, by Edward Jenner in the late eighteenth century 1 , immunological research on vaccines has focused on deconstruction analysis, or evaluation of the importance and mechanisms of each component of a vaccine that may determine its effect. This research strategy has led to the discovery of a large, increasing number of functional elements of different categories including antigens, immune modulators and adjuvants, and delivery systems, among others 2 . A successful vaccine is usually composed of multiple elements, such as those listed above. Given the multitude of choices, the construction of different elements into an integrated, functional whole has become a new challenge in the field. Although genebased synthetic and recombinant DNA technologies provide great flexibility for construction, certain limitations still exist: (1) large fusion proteins containing multiple functional elements are occasionally technically difficult to express or purify, and (2) de novo generation is usually a tedious and long process that is especially inadequate in the face of emergent pandemics of infectious diseases, when screening and identification of antigens are crucial for vaccine development 3, 4 . Facing such difficulties and demands, instead of making complex fusion-protein candidate vaccines de novo every time, it would be easier, faster, more flexible and more efficient to prepare the smaller building blocks first and then to assemble them into a whole, as needed.

To achieve this goal, in the present study, we have developed a new method for synthetic vaccine construction based on a novel protein-protein conjugation technique. The SpyTag/SpyCatcher conjugation technique was recently developed based on the split protein CnaB2 from Streptococcus pyogenes [5] [6] [7] . This protein contains two fragments: one named SpyTag (13aa), and the other named SpyCatcher (138aa). Once combined under nearly any common conditions, SpyTag and SpyCatcher can rapidly and efficiently covalently conjugate to each other through an isopeptide bond 5 . We hypothesized that this conjugation technique could allow us to achieve our goal and assemble vaccines based on different pre-prepared functional components.

Dendritic cell (DC) targeting has emerged as an important strategy for vaccine development due to the increasing recognition of this small population of cells in both cellular and humoral immune responses [8] [9] [10] [11] [12] [13] . DEC205 is a C-type lectin endocytic receptor that is highly expressed on CD8a 1 DCs in mice 14 and on CD141 1 DCs in humans 15 . An antibody against DEC205 has been developed as a useful targeted delivery molecule. When conjugated to this antibody, an antigen can be efficiently delivered to DCs, an approach that has been found to be superior in mediating both cytotoxic T cell responses [16] [17] [18] and antibody responses 19, 20 .

Recently, CDX1401, a vaccine composed of an anti-human DEC205 mAb fused with the tumor antigen NY-ESO-1, demonstrated promising biological activity in a phase I clinical trial 21 .

In the current work, we have tested the novel method of proteinassembly based vaccine construction. Employing the optimized SpyTag/SpyCatcher system, we have assembled vaccines composed of a single-chain antibody against DEC205 and model antigens (including the model T-cell epitope chicken ovalbumin 257-264 (OVA 8 ) and tick-borne encephalitis virus envelope protein domain 3 (TBEV ED3)) 22, 23 . This new synthetic vaccine was shown to be fully functional and to generate efficient cytotoxic T-cell and antibody responses. Thus, this protein-based synthetic vaccine strategy may be a significant improvement over the conventional gene-based synthetic vaccine strategy and may serve as a useful platform for faster and easier vaccine development.

Optimization of SpyCatcher. The current SpyTag/SpyCatcher system consists of a 13 aa SpyTag and a 138 aa SpyCatcher. To further simplify this system for engineering purposes and to minimize its immunogenicity, we tried to truncate the SpyCatcher protein while maintaining its conjugation activity. A structural analysis found that aa 53-118 are probably essential for the conjugation activity. An immunogenicity analysis revealed four major immune epitopes at the N-terminus (aa 32-50, aa 57-66) and C-terminus (aa 104-112, aa 121-138) ( Figure S1 ). Considering these together, we performed several truncations, as shown in Figure 1a . The truncation with deletion at the N-terminus (24-47 aa) was named SpyCatcherDN, and the truncation with deletions at both the N-terminus and the C-terminus (24-47 and 121-138 aa) was named SpyCatcherDNC. The truncated SpyCatcher proteins were expressed in Escherichia coli and purified by Ni-NTA chromatography ( Figure 1b) . The full-length and truncated SpyCatcher proteins were then used to immunize C57BL/6 mice. Fourteen days later, antibody levels in the sera were determined by ELISA. As shown in Figure 1c , the antibody levels induced by SpyCatcherDN and SpyCatcherDNC were significantly lower than those induced by full-length SpyCatcher. No significant difference was found between SpyCatcherDN and SpyCatcherDNC. Next, we further tested the efficiency of the binding of the truncated SpyCatcher proteins to the SpyTag fusion protein, aDEC205-SpyTag, which was made by genetic fusion of SpyTag with a single-chain antibody against murine DEC205 (aDEC205) at its C-terminus. As shown in Figures 1d and  1e , there was no significant difference in binding efficiency between SpyCatcherDN and full-length SpyCatcher, consistent with the results of a recent study 24 . However, the binding efficiency of SpyCatcherDNC was obviously lower than that of full-length SpyCatcher. Therefore, SpyCatcherDN was chosen for further studies.

Assembly of synthetic DEC205-targeted vaccine using optimized SpyTag/SpyCatcher system. A full vaccine usually consists of at least an immunoregulatory functional unit in addition to the antigen. The modified single-chain antibody aDEC205-SpyTag was used as a functional unit in the present study. The OVA 8 -TBEV ED3 DNA sequence, which encodes model antigens including both a CD8 Tcell epitope (ovalbumin 257-264 ) and a B-cell epitope (TBEV ED3), was genetically fused to the C-terminus of SpyCatcherDN (Sc-OVA 8 -ED3). Conjugation of aDEC205-SpyTag and Sc-OVA 8 -ED3 would result in a fully functional vaccine ( Figure 2a ). aDEC205-SpyTag was expressed in FreeStyle TM 293-F cells and purified by Protein A chromatography ( Figure 2b , Lane 1). The Sc-OVA 8 -ED3 fusion protein was expressed in E. coli and purified by Ni-NTA chromatography ( Figure 2b , Lane 2). The covalent binding reaction was tested under different conditions and with different molar ratios. A 151.5 molar ratio of aDEC205-SpyTag:Sc-OVA 8 -ED3 at 4uC for 2 h was found to give rise to an optimal binding efficiency for the proteins. SDS-PAGE analysis showed that more than 90% of the input aDEC205-SpyTag was conjugated ( Figure 2b , Lane 3). The synthetic DEC205-targeted vaccine (aDEC205-Sc-OVA 8 -ED3) was then purified by Protein A chromatography, with a purity above 90% (Figure 2b , Lane 4).

Synthetic aDEC205-Sc-OVA 8 -ED3 vaccine can bind to DEC205 1 DCs both in vitro and in vivo. To test the DC-targeting ability of the synthetic aDEC205-Sc-OVA 8 -ED3 fusion protein, splenocytes isolated from naïve WT C57BL/6 mice were incubated with the fusion protein or an isotype-control protein. After staining with a fluorescent secondary antibody, the cells were analyzed by flow cytometry. As shown in Figure 3a , conventional DCs were gated as MHC class II high and CD11c high cells, and the CD8a 1 DC and CD8a 2 DC subsets were then each further gated and analyzed. As shown in Figure 3b (top panel), the aDEC205 fusion protein preferentially bound to CD8a 1 DCs, rather than to CD8a 2 DCs or other immune cells (data not shown), which is consistent with the and assembly. The cDNA encoding the single chain of aDEC205 was genetically fused to SpyTag at the C-terminus, and the antigen containing the OT1 epitope and TBEV ED3 was fused to the C-terminus of SpyCatcherDN. Once mixed, an amide bond efficiently forms between SpyTag and SpyCatcher. (b) Synthetic vaccine production and purification. Purified aDEC205-SpyTag was mixed with SpyCatcherDN-OVA 8 -TBEV ED3 at a molar ratio of 151.5 at 4uC for 2 h. The assembled aDEC205-Sc-OVA 8 -ED3 adduct was purified by Protein A chromatography. Both the efficiency of the reaction and the purified adduct can be analyzed by SDS-PAGE. specific expression of DEC205 on the former subset of DCs. To further test its targeting ability in vivo, naïve WT mice were immunized with the aDEC205 fusion protein, together with CpG/ Poly I:C. Next, 24 h after immunization, draining lymph nodes (DLNs) were isolated and digested to form single-cell suspensions. aDEC205 fusion protein-bound cells were visualized with fluorescent secondary antibody staining followed by flow cytometry. Preferential targeting to CD8a 1 DCs was confirmed (Figure 3b , bottom panel). Thus, the SpyTag/SpyCatcher system allows assembly of SpyCatcher fusion proteins with aDEC205-SpyTag, without influencing its DC-targeting ability.

Synthetic aDEC205-Sc-OVA 8 -ED3 vaccine generates enhanced cytotoxic T-cell response. We next tested whether the synthetic vaccine could generate an efficient cytotoxic T-cell response. This was measured by IFNc intracellular staining and in vivo specific killing assays. Naïve WT C57BL/6 mice were immunized twice with the aDEC205-Sc-OVA 8 -ED3 fusion protein or the Sc-OVA 8 -ED3 protein at a 7-day interval. CpG1826/Poly I:C was used as adjuvant. For the IFNc intracellular staining assay, 5 days after the last injection, splenocytes were isolated from the immunized mice and stimulated with 5 mg/ml OT1 peptide in a U-bottom 96-well plate for 6 h. The IFNc-producing CD8 T cells were then stained and analyzed by flow cytometry. The splenocytes from the aDEC205-Sc-OVA 8 -ED3-vaccinated mice showed a significantly higher percentage of IFNc-producing CD8 T cells compared with the splenocytes from Sc-OVA 8 -ED3-immunized mice (Figures 4a  and 4b ). For the in vivo specific killing assay, 4 days after the secondary injection, target cells (an equal mixture of OVA 8 peptide-loaded, CFSE-high, labeled naïve splenocytes and non-loaded, CFSE-low, labeled naïve splenocytes) were transferred to the immunized mice. Next, 20 h later, the proportion of CFSE-labeled cells in the spleen was analyzed. A significantly higher specific killing rate was found in mice immunized with the aDEC205-Sc-OVA 8 -ED3 vaccine Synthetic aDEC205-Sc-OVA 8 -ED3 vaccine induces better antigenspecific antibody response. It has been shown that targeting antigens to DEC205 can induce strong antibody responses in the presence of adjuvants. We next tested whether synthetic aDEC205-Sc-OVA 8 -ED3 can elicit a better antibody response against the antigen TBEV ED3. Naïve WT C57BL/6 mice were immunized twice with 300 pmol aDEC205-Sc-OVA 8 -ED3 fusion protein or Sc-OVA 8 -ED3 protein, together with CpG1826/Poly I:C as an adjuvant, at a 14-day interval. Seven days after the last vaccination, the mice were bled, and anti-TBEV ED3 antibody was measured by ELISA. Compared with the Sc-OVA 8 -ED3 control vaccine, aDEC205-Sc-OVA 8 -ED3 elicited a significantly increased antibody response against TBEV ED3 ( Figure 5) . Thus, the synthetic DCtargeting vaccine is efficient in inducing both T-and B-cell responses.

A successful vaccine is an integral, functional whole composed of different elements. The discovery of effective antigens and immunomodulatory molecules is a major challenge in the field of vaccine development 3, 4 . Modern immunology and genomics provide a large amount of candidates for each. Simple, rapid and efficient experimental screening of the optimal composition of a vaccine is generally in demand, especially when facing pandemic outbreaks of infections, such as SARS-CoV in 2003 25 , H1N1 influenza in 2009 26 and MERS-CoV in 2012 27 . The traditional de novo generation of gene-based synthetic vaccines is both time consuming and costly. In our present study, based on the SpyTag/SpyCatcher technique, we have developed a novel method of vaccine construction by protein assembly based on pre-prepared vaccine components. We have employed this technique for the construction of a DC-targeting vaccine and have found it highly efficient to induce both T-and B-cell responses. Although this strategy still relies on genetic manipulation and protein production, it does not require synthesizing a large, complex fusion protein de novo every time; the strategy only produces smaller protein components as building blocks, which is easier and faster. This block-building strategy may allow people to construct various formulations of vaccines conveniently and efficiently when needed. The approach may simplify the whole process of vaccine generation and accelerate antigen screening and verification ( Figure 6 ). In addition, certain vaccine components (building blocks) may be easily reused for the construction of other vaccines.

Different methods have been developed to construct synthetic vaccines. The traditional way is genetic manipulation, which provides great flexibility. However, this de novo generation usually takes a long time, and it is occasionally difficult to express large molecules. Chemical conjugation offers an alternative, fast way to overcome the shortcomings mentioned above. However, the chemical conjugation process is usually not easily controlled, resulting in poor homogeneity in terms of the degree of conjugation and the number of conjugation sites. An isopeptide bond is an amide bond formed between the side-chain amine of lysine and the side-chain carboxyl group of either glutamate or aspartate. This bond has been shown to be very useful for protein-protein coupling and protein modification 28 . SpyTag/SpyCatcher was recently developed and found to be highly efficient for site-specific protein conjugation. Impelled by the limitations of current methods for vaccine construction and inspired by the concept of synthetic vaccinology, we hypothesized that this new technique might be useful for easily and precisely assembling different vaccine components at the protein level. This approach may possess several advantages: (1) In contrast to genetic manipulation, this system does not generate a whole vaccine de novo; instead, it produces different protein components and assembles them as needed. This method may thus significantly reduce the time spent and the cost, especially when many designs need to be tested. (2) In contrast to chemical conjugation-based approaches, this system allows quantitative and site-specific installation of antigens at a designated position in the antibody that does not influence the antibody-targeting ability. (3) SpyTag and SpyCatcher can efficiently react with each other to form a stable covalent bond under diverse conditions. (4) SpyTag is reactive no matter it is at the N-terminus, the C-terminus, or the internal site of a protein and therefore offers greater flexibility than other split protein-derived systems or intein/ sortase tag systems do 29, 30 . In addition, recent work by the Howarth group has optimized this system to potentially provide further advantages 31 : (1) SpyCatcher can be shortened to KTag, allowing SpyTag and KTag to form a peptide-peptide ligation. Thus, this new system could further reduce the influence of SpyCatcher's own immunogenicity, if any. (2) The SpyTag-and-KTag system allows cycles of conjugation, which enables assembly of a vaccine with multiple components, such as protein-based adjuvants and multivalent antigens. (3) The short KTag makes high-throughput screening of epitopes feasible because the short KTag-epitope fusion peptides can be easily prepared by total synthesis.

The results of the present study showed that the optimized SpyCatcherDN exhibits much lower immunogenicity than wildtype SpyCatcher does, without influencing the ability to bind to aDEC205-SpyTag. The antigen-containing fusion protein Spy-CatcherDN-OVA 8 -ED3 can also efficiently bind to aDEC205-SpyTag, without affecting the targeting ability of DEC205 either in vitro or in vivo. Subsequent results from the animal study showed that an aDEC205 adduct vaccine can elicit enhanced T-cell and Bcell responses. Furthermore, this new method is highly translatable; in fact, our unpublished data demonstrated its usefulness and efficacy in the construction of other vaccines.

In summary, we have established a convenient and efficient platform for conjugating antigens of interest to specific antibodies using the optimized SpyTag/SpyCatcher system. This platform could be very useful in antigen screening and vaccine development against infectious diseases and cancers. Furthermore, the use of this method is probably not limited to vaccine development; it may have broader applications. Antibodies and recombinant proteins have been extensively studied in animal and clinical studies of various diseases for preventative and therapeutic purposes. The strategy proposed in our current study may provide an easy and efficient protein-engineering method for generating bi-specific antibodies and producing multifunctional fusion proteins or antibodies.

Mice. Female C57BL/6 mice (6-8 weeks old) were purchased from Vital River Laboratory Animal Technology Co. (Beijing, China). All mice were housed under specific pathogen-free conditions in the animal care facilities at the Institute of Biophysics, Chinese Academy of Sciences. All animal experiments were performed in accordance with the guidelines of the Institute of Biophysics, Chinese Academy of Sciences, using protocols approved by the Institutional Laboratory Animal Care and Use Committee.

Cloning, expression, and purification of fusion proteins. The full-length SpyCatcher expression plasmid pDEST14-SpyCatcher was kindly provided by Dr. Mark Howarth (University of Oxford, UK). DNA sequences of truncated forms of SpyCatcher were first amplified by PCR using the following primers: common forward primer DSc-F1 (GATTACGACATCCCAACGACCGAAAACCTGTAT-TTTCAGGGCGATAGTGCTAC) and reverse primers DSc-R1 (CGCGGA-TCCTTAAT TAACTGTAAAGGTAATAGCAGTTGCT, for SpyCatcherDN) and DSc-R2 (CGCGGATCCTTAAATATGAGCGTCACCTTTAGTTGCTTT, for SpyCatcherDNC). A 63-histidine tag coding sequence was further added by secondary PCR using DSc-F2 (GGAATTCCATATGTCGTACTACCATCACC ATCACCATCACGATTACGACATCCCAA) and DSc-R1 or DSc-R2. The bold font indicates an NdeI or BamHI site. The underlined letters encode a tobacco etch virus (TEV) protease cleavage site or 63-histidine tag. The PCR products were cloned into pDEST14 using the NdeI and BamHI sites.

For protein expression, BL21(DE3) competent E. coli cells were transformed with respective plasmids, and single colonies were picked and cultured in 5 ml LB at 37uC overnight. The cultures were then amplified to 400 ml and induced by 1 mM IPTG for 6 h. The bacterial cultures were harvested and lysed, and the targeting proteins were purified using a Ni-NTA agarose column (ComWin Biotech, Beijing, China) according to the manufacturer's protocol.

To generate a SpyCatcherDN-OVA 8 -TBEV ED3 expression plasmid, cDNA encoding TBEV ED3 was PCR amplified with the plasmid pET-30a(1)-TBEV ED3, provided by Dr. Xiaoping Kang (Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, China), and G 4 S linker and the OVA 8 epitope (chicken ovalbumin 257-264 , or SIINFEKL) were added at the N-terminus during PCR. The primers used in the PCR were as follows: OE F (CCGCTCGAGGGCGGTG-GTGGCAGCCAGCTTGAGAGTATAATCAACTTTGAAAAAC TGACTG-AATGGACATAC ACAATGTGCG) and OE R (CCGCGAGCTCTTATCA TTTTTGGAACCATTG), in which the bold font indicates an XhoI or SacI site. The SpyCatcherDN fragment was amplified using the primers DNSc-F (GCAATTCCATATGTC GTACTACCATCAC) and DNSc-R (CCGCTCGAGAATATGAGCGTCACCTTTA G), in which the bold font indicates an NdeI or XhoI site. The SpyCatcherDN and OVA 8 -TBEV ED3 fragments were then ligated and cloned into pDEST14 at the NdeI and SacI sites. Expression and purification of the SpyCatcherDN-OVA 8 -TBEV ED3 protein were performed as described above.

A plasmid encoding the DNA sequence of the variable regions of the heavy and light chains of anti-DEC205 (clone NLDC145) was kindly provided by Dr. Ralph Steinman (The Rockefeller University, USA). The single chain-encoding DNA was PCR amplified using the following primers: DEC205 F, GCG CGTACGGAGG-TGAAGCTGTTGGAATC and DEC205 R, GCGTTCGAACCGTTT CAATT-CCAGCTTGG. The DNA was then cloned into the pEE12.4 expression plasmid (Lonza, Basel, Switzerland) between the IgGk leading sequence and the human IgG Fc sequence using BsiWI and BstBI (bold font). The SpyTag-encoding sequence (GCTCACATCGTGATGGTGGACGCCTACAAGCCCACCAAG) and a GSGESG linker (GGATCCGGCGAGTCCGGC) were then genetically fused to the C-terminus of the human IgG Fc fragment by PCR to construct the final plasmid pEE12.4 aDEC205-SpyTag. Figure 6 | Perspective on protein assembly-based synthetic vaccine R&D. During the R&D of vaccines against cancer and infectious diseases, especially in the era of big data, many functional units (such as immune molecules) and antigens are available for screening and optimization. The conventional way (left) of making synthetic vaccines usually completely depends on de novo construction, and each combination has to be made individually, which is time consuming and costly. By taking advantage of a protein assembly-based method (right), each vaccine component can be prepared and then simply assembled into a full vaccine, as needed. This procedure could be easier, faster, more flexible and more efficient. Ag, antigen. For the in vivo assay, naïve WT C57BL/6 mice were injected subcutaneously in the tail base with 200 pmol of the aDEC205-Sc-OVA 8 -ED3 adduct, aDEC205-SpyTag or isotype-control antibody. After 20 h, inguinal DLNs were collected and digested to form a single-cell suspension. The cells were stained with an anti-FccR mAb, followed by PE-conjugated anti-human IgG antibody staining before flow cytometry analysis.

ELISA. Microtiter plates (Corning Life Sciences, Tewksbury, MA, USA) were coated with 2 mg/ml (100 ml/well) full-length SpyCatcher or TBEV ED3 protein in carbonate buffer at 0.1 M (pH 9.5) overnight at 4uC. After washing away the unbound proteins, the plates were incubated with PBS containing 5% FBS at 37uC for 1.5 h. Serially diluted serum samples from immunized mice were added and incubated at 37uC for 1.5 h. HRP-labeled anti-mouse IgG was used as the detection antibody (Zhong Shan-Golden Bridge Biological Technology Co., Ltd, Beijing, China). The plates were visualized by adding 100 ml TMB (eBioscience) and were read at 450 nm using a SpectraMax Plus (Molecular Devices, Sunnyvale, CA, USA).

Intracellular cytokine staining assay. Naïve WT C57BL/6 mice were subcutaneously immunized twice with 30 pmol of aDEC205-Sc-OVA 8 -ED3 or Sc-OVA 8 -ED3, along with 30 mg CpG1826 (Invitrogen Life Technologies, Beijing, China) and 30 mg Poly I:C (InvivoGen, San Diego, CA, USA) as an adjuvant, at a 7-day interval. Five days after the secondary vaccination, the spleens of the immunized mice were harvested and processed into single-cell suspensions. Splenocytes (1 3 10 6 cells/well in triplicate) were restimulated in U-bottom 96-well plates with 5 mg/ml OT1 peptide (SIINFEKL) (ChinaPeptides, Suzhou, China) for 6 h in the presence of brefeldin A (5 mg/ml) at 37uC with 5% CO 2 . After restimulation, the cells were first surface stained with APC-conjugated anti-mouse CD8a antibody (53-6.7) before fixation/ permeabilization and intracellular staining for IFNc (XMG1.2). All of the reagents and antibodies were purchased from eBioscience, and the manufacturer's protocol was followed for the surface and intracellular staining.

In vivo cytotoxicity assay. Naïve WT C57BL/6 mice were immunized subcutaneously with 30 pmol of aDEC205-Sc-OVA 8 -ED3 or Sc-OVA 8 -ED3, along with CpG1826 and Poly I:C as an adjuvant, as described above. Five days after the secondary vaccination, the immunized mice were injected intravenously with the peptide-pulsed target cells for in vivo killing. Briefly, congenic naïve splenocytes (2 3 10 7 cells/ml) were pulsed with 10 mg/ml OT1 peptide for 1.5 h at 37uC. After one wash in PBS, the cells were labeled with 5 mM CFSE (CFSE high ) (Invitrogen, Carlsbad, CA, USA) for 10 min, after which 20% FBS was immediately added to terminate the labeling reaction. The cells were then washed twice in PBS before use. Meanwhile, unpulsed splenocytes were labeled with 0.5 mM CFSE (CFSE low ) following the same procedure. A 151 mixture of CFSE high and CFSE low cells (2.5 3 10 6 cells from each population) was co-transferred to the immunized mice. Twenty hours later, the spleens were harvested, and single-cell suspensions were prepared and analyzed by flow cytometry. The percentage of specific killing was evaluated with the following formula: % specific killing 5 1 2 % survival, in which % survival 5 (the number of OT1-pulsed target cells remaining)/(the number of un-pulsed target cells remaining).

Protein structure and immunogenicity analysis. BepiPred Linear Epitope Prediction was used for immunogenicity analysis 32 , and the crystal structure data from the RCSB Protein Data Bank were used for structural analysis.

Statistical analysis. All data were analyzed using an unpaired two-tailed t test and GraphPad Prism statistical software (GraphPad Software Inc., San Diego, CA, USA). A value of P , 0.05 was considered statistically significant (*, P , 0.05; **, P , 0.01; and ***, P , 0.001).

s Inquiry; a bicentenary analysis

Modern subunit vaccines: development, components, and research opportunities

Toward a Human Vaccines Project

Reverse vaccinology: developing vaccines in the era of genomics

Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin

The Scottish Structural Proteomics Facility: targets, methods and outputs

NMR spectroscopic and theoretical analysis of a spontaneously formed Lys-Asp isopeptide bond

Designing vaccines based on biology of human dendritic cell subsets

Dendritic cells and the control of immunity

Dendritic cell immunotherapy: mapping the way

Dendritic-cell immunotherapy: from ex vivo loading to in vivo targeting

Intrinsic and cooperative antigen-presenting functions of dendritic-cell subsets in vivo

The cell biology of antigen presentation in dendritic cells

The CD81 dendritic cell subset

CD1411 dendritic cells produce prominent amounts of IFN-alpha after dsRNA recognition and can be targeted via DEC-205 in humanized mice

In vivo targeting of antigens to maturing dendritic cells via the DEC-205 receptor improves T cell vaccination

Inhibition of melanoma growth by targeting of antigen to dendritic cells via an anti-DEC-205 single-chain fragment variable molecule

The efficacy of DNA vaccination is enhanced in mice by targeting the encoded protein to dendritic cells

Antigen targeting to dendritic cells elicits long-lived T cell help for antibody responses

Targeting antigen to mouse dendritic cells via Clec9A induces potent CD4 T cell responses biased toward a follicular helper phenotype

Induction of antigen-specific immunity with a vaccine targeting NY-ESO-1 to the dendritic cell receptor DEC-205

Use of recombinant E protein domain III-based enzyme-linked immunosorbent assays for differentiation of tick-borne encephalitis serocomplex flaviviruses from mosquito-borne flaviviruses

Antigenic structure of the flavivirus envelope protein E at the molecular level, using tickborne encephalitis virus as a model

Structural analysis and optimization of the covalent association between SpyCatcher and a peptide Tag

Severe acute respiratory syndrome

An influenza A H1N1 virus revivalpandemic H1N1/09 virus

Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia

Intramolecular isopeptide bonds: protein crosslinks built for stress?

Sortagging: a versatile method for protein labeling

The naturally split Npu DnaE intein exhibits an extraordinarily high rate in the protein trans-splicing reaction

SpyLigase peptide-peptide ligation polymerizes affibodies to enhance magnetic cancer cell capture

Improved method for predicting linear B-cell epitopes

We thank Dr. Mark Howarth (University of Oxford, UK) for the SpyCatcher plasmid, Dr. Xiaoping Kang (Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, China) for the TBEV ED3 plasmid and recombinant protein, Dr. Ralph Steinman (The Rockefeller University, USA) for the pcDNA-aDEC205 (V&L) plasmid. We thank Dr. Jizhong Lou (Institute of Biophysics, Chinese Academy of Sciences) for protein structure analysis. This work was supported by grants from the Ministry of Science and Technology (2013ZX10004606 and 2012ZX10001006-002-001 to M.Z.), National Natural Science Foundation of China (81261130022 to M.Z.) and Chinese Academy of Sciences (Hundred Talents Program to M.Z.).