key: cord-0711512-8cyssuuz
authors: Romanowska, M.; Stefanska, I.; Donevski, S.; Brydak, L. B.
title: Infections with A(H1N1)2009 Influenza Virus in Poland During the Last Pandemic: Experience of the National Influenza Center
date: 2012-06-29
journal: Respiratory Regulation - The Molecular Approach
DOI: 10.1007/978-94-007-4549-0_34
sha: 715cab7ce45bfdd89014f31e99e2211fdf38bd33
doc_id: 711512
cord_uid: 8cyssuuz

This study presents epidemiological and clinical data on non-sentinel patients considered by physicians as suspected to be infected with pandemic A(H1N1)2009 virus, from whom clinical specimens were sent for testing to the National Influenza Center, NIPH-NIH in Warsaw, Poland. Between April 28, 2009 and August 10, 2010, 988 (15.7%) out of the 6,311 specimens were tested by the National Influenza Center, including 798 from non-sentinel sources and 190 from sentinel influenza surveillance network. The non-sentinel specimens were tested by conventional RT-PCR to detect influenza A and in the case of positive specimens – one-step real-time RT-PCR to detect the pandemic virus A(H1N1)2009. In 145 (18.2%) cases, infections with the pandemic virus were confirmed, with the highest number in patients aged 15–25. In 45% of the confirmed cases, a history of travel to other countries was registered. The most common symptoms were fever ≥38°C (72.7%), cough (50%), sore throat, and myalgia (26.1%). In 40.7% of the swabbed patients, clinical and epidemiological criteria for the novel influenza A(H1N1)2009, set by the European Commission, were met. There were, however, specimens from persons without any reasonable indication for testing for the pandemic virus, specimens collected incorrectly, and documentation without basic information. These weaknesses resulted in unnecessary costs and overload of health care units. An improvement should be achieved in the area of communication between different pandemic players in the future. More attention is also needed to ensure that requirements and recommendations are known and used.

The data presented in this report include specimens collected between April 28, 2009 and August 10, 2010. In each case, a decision which patient should be swabbed was made by a physician. Detailed instructions regarding collection of clinical material, including its storage and transport, were prepared by the NIC and available on the website. Similarly, appropriate information was available on the website of the Chief Sanitary Inspectorate and the Ministry of Health. Phone information was also provided by the staff of the NIC and the National IHR Focal Point. Clinical materials were nasal and throat swabs, less often bronchoalveolar liquid, or tracheal washings. The NIC performed diagnostics of the pandemic in fl uenza A(H1N1)2009 virus by nucleic acid ampli fi cation techniques. RNA was extracted from a specimen volume of 140 m L with QIAamp RNA Mini Viral Kit (Qiagen, Germany) according to the manufacturer's instruction. As the fi rst step, conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay was done to detect M gene of in fl uenza virus A using Transcriptor One-Step RT-PCR Kit (Roche Diagnostics, Switzerland) and the following sets of primers: until December 2009 primers M30F (TTCTAACCGAGGTCGAAACG) and M264R2 (ACAAAGCGTCTACGCTGCAG) were used (WHO Collaborating Centre for Reference and Research on In fl uenza, National Institute of Infectious Diseases, Tokyo, Japan) and since December 2009 the modi fi ed primers were used:

M30F2/08 (ATGAGYCTTYTAACCGAGGTCGAAACG) and M264R3/08 (TGGACAAANCGTCTACGCTGCAG) (WHO Collaborating Centre for Reference and Research on In fl uenza, National Institute of Infectious Diseases, Tokyo, Japan) (WHO 2009g ) . The temperature pro fi le was the following: reverse transcription for 30 min at 50°C; inactivation of reverse transcriptase and initial denaturation for 7 min at 94°C; then 45 cycles of denaturation at 94°C for 10 s, annealing at 55°C for 30 s, and extension at 68°C for 55 s. The reaction was completed by a fi nal extension at 68°C for 7 min. All specimens positive for in fl uenza A were then tested by onestep real-time RT-PCR assay performed on the LightCycler 2.0 machine (Roche), using the protocol developed by the Centers for Disease Control and Prevention (CDC; Atlanta, USA) and SuperScript™III Platinum® One-Step Quantitative RT-PCR System (Invitrogen, USA) to detect HA gene of the pandemic in fl uenza virus A(H1N1)2009 (WHO 2009a ) .

Data regarding individual patients were analyzed by sex, age, seasonal in fl uenza vaccination status, symptoms of illness, and epidemiological and clinical criteria included into the case de fi nition of the pandemic in fl uenza A(H1N1)2009 (European Commission 2009 ) .

Data on the age of the swabbed patients, their sex, and the vaccination status is presented in Table 34 .1 . The highest proportion of specimens was received from patients aged 15-44 (61.7%, if patients of the unknown age were excluded). The specimens collected from men and women were relatively equally represented (47.7% vs. 52.3%). In 537 (67.3%) out of the 798 patients, information on the vaccination status against seasonal in fl uenza in the epidemic season 2008/2009 or 2009/2010 was given by a physician. Among them, there were 7.3% of the vaccinated patients.

In 145 (18.2%) cases of 798 non-sentinel specimens, infections with the pandemic virus were con fi rmed. Most of the con fi rmed cases were found in the age group 15-25 years (42.8%). Similarly to the total number of specimens analyzed, the positive specimens were collected equally from men and women (51.0% vs. 49.0%). In the case of 99 patients, information on the vaccination status was known. Among them only 6.1% were vaccinated against seasonal in fl uenza in the epidemic season 2008/2009 or 2009/2010 . Detailed information is given in Table 34 .2 .

The fi rst laboratory-con fi rmed case in Poland was diagnosed on May 6, 2009 May 6, (week no. 19/2009 ). This specimen was collected from a woman aged 37 old who visited the USA and developed symptoms less than a week after the return to Poland.

The highest number of the non-sentinel specimens was received by the NIC in weeks 30-31/2009 (July 20, 2009 -August 2, 2009 ). During summer holidays, i.e., between week 27/2009 (June 29, November 23-29, 2009 ) an increase in the number of specimens was observed ( Fig. 34.1 ) . A proportion of positive specimens among all specimens tested between the age groups ranged from 7.1% in the patients aged 45-64 to 31.4% in those aged 5-14 ( Fig. 34 .2 ). In 45.5% of patients with laboratory con fi rmed infection with A(H1N1)2009 in fl uenza virus, a history of travel to other countries was registered ( Fig. 34 .3 ). Among them, almost 40% returned from Spain and 30% visited the USA and/or Canada or Mexico ( Fig. 34.4 ) .

Information on the clinical symptoms was available for 88 out of the 145 patients with laboratory con fi rmed A(H1N1)2009 infection. Among them, the most common symptoms were fever ³ 38°C (72.7% of patients), cough (50.0%), sore throat (26.1%), myalgia (26.1%), and coryza (20.5%) (Table 34 .3 ). 40.7% of all swabbed patients met the European Commission's (EC 2009 ) clinical and epidemiological criteria for novel in fl uenza A(H1N1)2009. When the population of patients was broke down to infected and non-infected persons, 56% (56 out of the 75) of those with con fi rmed infection and 38.1% (167 out of the 438) of those with not con fi rmed infection met these criteria. Detailed data for all swabbed patients are presented in Table 34 .4 .

The results presented in this article indicate two different aspects of the in fl uenza pandemic A(H1N1)2009 in Poland. The fi rst is the similarity of the infection picture to that in other countries, while the second reveals weaknesses in the response to a pandemic situation which should be treated as a lesson for the future.

Since the fi rst information on the emergence of the novel in fl uenza virus in Europe, the NIC started preparations for the diagnosis of infections caused by this pathogen. A formal cooperation was maintained with WHO and the European Centre for Disease Prevention and Control (ECDC) and there were informal contacts with the members of the WHO Global In fl uenza Surveillance Network (GISN) and the European In fl uenza Surveillance Network (EISN). Certainly, cooperation with the most important national bodies was also in place, including the Ministry of Health, the Chief Sanitary Inspectorate, and the Government Center for Security. The NIC regularly participated in the meetings of the National In fl uenza Pandemic Committee providing scienti fi c background and advice on the interventions or recommendations that should be prepared for physicians, laboratory workers, and the community. In the fi rst step, the NIC prepared detailed instructions regarding the collection of clinical specimens (types of specimens, technical ways of their collection, the optimal time for specimen collection, storage and transport conditions, etc.) that were available on the website of the NIPH-NIH and on other relevant websites. Moreover, staff of the NIC was able to respond to any questions regarding the diagnostics of the pandemic virus and in the fi rst months of the pandemic, until the end of July 2009, this type of information, along with the diagnostics, was given to all interested parties on a 24-h basis. Most of the specimens (80.8%) tested by the NIC were from outside the sentinel in fl uenza surveillance network, i.e. , mainly from hospitals. This resulted from the recommendations of the Minister of Health, the National Adviser for the Infectious Diseases, the National Adviser for Epidemiology, and other members of the National In fl uenza Pandemic Committee. According to them, all patients meeting clinical criteria and epidemiological criteria of the infection with the novel in fl uenza virus A(H1N1)2009 had to be admitted to hospital infectious wards and the hospitals were responsible for the specimen collection and sending for laboratory testing. Since August 3, 2009, the above recommendations were modi fi ed and patients not severely ill were treated at home. This change of the recommendations also explained a decrease of the number of specimens received by the NIC since week 33/2009 33/ (August 10-16, 2009 ). This decrease also resulted from the fact that laboratories of the VSESs gradually became able to perform laboratory diagnostics of A(H1N1)2009 virus. Thus, since August 2009, the NIC played mainly a role of a national reference laboratory verifying questionable results and coordinating the sentinel in fl uenza surveillance system. It is interesting that following the decrease above outlined, a secondary increase in the number of non-sentinel specimens between weeks 45-48/2009 was observed. This situation could be partially associated with a signi fi cant EC epidemiological criteria met when at least one of the following three occurred in 7 days before disease onset:

(1) close contact to a con fi rmed case of novel in fl uenza A(H1N1) virus infection while the case was ill, (2) traveling to an area where sustained human-to-human transmission of novel in fl uenza A(H1N1) was documented, and (3) working in a laboratory where samples of the novel in fl uenza A(H1N1) virus were tested EC clinical criteria met when one of the following three occurred: (1) fever >38°C and signs and symptoms of acute respiratory infection, (2) pneumonia (severe respiratory illness), and (3) 2009a, b, c ) . This study shows that adolescents and young adults were the most frequently affected subjects; 48.2% of con fi rmed cases in the 15-25 years old and only 2.7% in the ³ 65 years old group. This fi nding is consistent with the observations made in most of other countries (WHO 2009c ) . Metaanalysis performed by Khandaker et al. ( 2011 ) on data pooled from fi ve studies from the United Kingdom, Germany, Peru, the USA, and Saudi Arabia showed that 64% of the con fi rmed cases were in patients aged 10-29. The authors also show that the highest proportion of positive cases among all specimens collected in a given age group was present in patients up to 25 years of age (29.7% of positive specimens in 0-4 years old; 31.4% in 5-14 years old, and 23% in 15-25 years old subjects).

This higher rate of infections at younger age and lower in the elderly are not surprising as HA glycoprotein of the A(H1N1)2009 pandemic virus is more similar to HA glycoprotein of the 1918 pandemic virus and its close descendants than to the seasonal in fl uenza viruses A(H1N1) circulating recently (Garten et al. 2009 ; Greenbaum et al. 2009 ; Krause et al. 2010 ; Smith et al. 2009 ; Xu et al. 2010 ) . This was also con fi rmed by the seroepidemiological studies showing that people aged >60 years have pre-existing cross-reactive speci fi c antibodies to the pandemic virus A(H1N1)2009 Hancock et al. 2009 ; Ikonen et al. 2010 ; Miller et al. 2010 ; Rizzo et al. 2010 , WHO 2009d . The fi nding of this study that the most affected group was patients aged up to 25 may also be related to summer holidays. During 9 weeks of the holiday time, 52% of all non-sentinel specimens from a 67-week long period of analysis were collected. The present study shows that 45.5% of infected patients had a history of travel to other countries earlier affected by the pandemic in fl uenza virus. It is also a reasonable assumption that young people were more likely to travel than older ones. It is also known that at least to mid-August 2009 all con fi rmed in fl uenza cases in Poland, i.e., those diagnosed at the NIC and VSESs laboratories were imported or linked with the imported cases. A similar situation was observed in other European countries, while a sustained virus transmission at a national level was observed in Spain, Germany, and the United Kingdom.

An equal frequency of infection in either sex, a fairly mild course, and the presence of gastrointestinal symptoms in about 14% of cases seen in the present study are all in accord with the observations made in other studies Neumann and Kawaoka 2011 ; WHO 2009c, e ) . We also analyzed vaccination status of the swabbed patients regarding seasonal in fl uenza vaccination in the epidemic season 2008/2009 and 2009/2010. These seasonal vaccines did not provide any protection against the A(H1N1)2009 pandemic virus. Nevertheless, it was interesting to fi nd out how many of the swabbed patients were vaccinated with the seasonal vaccine, especially taking into account a strong interest of the community in acquiring the pandemic vaccine, on the one hand, and a low seasonal in fl uenza vaccination rate in the general Polish population, on the other hand. The results show that barely 7.3% of the swabbed patients were vaccinated. The vaccination rate was no different among the positive cases, amounting to 6.1%. These values are similar to the seasonal in fl uenza vaccination rates registered for a few epidemic seasons in the total population in Poland. In the epidemic season 2008/2009 barely 5.2% of the total Polish population was vaccinated against in fl uenza, in 2009/2010 -5.5%, and in 2010/2011 -5.0% (Brydak 2010 (Brydak , 2011 . According to the European Union's Council Recommendation 2009/1019/EU of December 22, 2009, all member states should prepare and implement national, regional, and local plans or appropriate policies to improve seasonal in fl uenza vaccination coverage to be able to achieve a target of 75% vaccination coverage in the older age groups and, if possible, also in other risk groups and healthcare workers, preferably by the season 2014 /2015 (European Council 2009 ) . In Poland, there is no speci fi c national program for human seasonal in fl uenza. There is a National Health Program prepared for the years 2007-2015 and one of its strategic objectives is to increase the effectiveness of prevention against infectious diseases and infections. One of the priorities of this program is to reduce the incidence of infectious diseases that are preventable by vaccinations. Nevertheless, in fl uenza is not mentioned in the program by name (National Health Program for years 2007 -2015 . A low interest in in fl uenza prophylaxis causes that there is still much to do to increase in fl uenza vaccination coverage in Poland.

Considering the emergence of the pandemic in fl uenza virus A(H1N1)2009, the ECDC prepared, on the request of the EC, a case de fi nition for the illness caused by this pathogen, including clinical, epidemiological, and laboratory criteria (European Commission 2009 ) . The de fi nition determines that a case under investigation is any person meeting both clinical and epidemiological criteria. Certainly, the use of this case de fi nition has been important, particularly in the fi rst months of the pandemic when there was no sustained transmission of the virus observed and the majority of the cases were imported. The results of this study show that the above case de fi nition has not been known or used by many physicians who collected clinical specimens and sent it to the NIC. Both types of criteria were met in 40.7% of the swabbed patients. It is also known that among patients with the laboratory con fi rmed infection, clinical and epidemiological criteria were met in 56.0% of them, while among non-infected patients -in 38.1% of them. These results con fi rm that collection of specimens from patients meeting both types of criteria could increase a probability to single out persons really infected with the pandemic virus. The EC case de fi nition was available in Polish on the most important websites providing information to physicians and the community during the pandemic, and in the recommendations prepared for physicians by the Minister of Health, the National Adviser for the Infectious Diseases and the National Adviser for Epidemiology. Therefore, there is a question of whether distribution of this information was poor and ineffective or physicians just did not use the information in practice. The problem was repeatedly discussed during the meetings of the National Pandemic Committee. There is a probability that physicians acted under strong pressure put out by patients and consequently tried to avoid any negative reactions. Nevertheless, testing the specimens collected from patients who did not meet both epidemiological and clinical criteria resulted in unnecessary costs and overload of laboratory staff and healthcare workers. Even when transmission of the pandemic virus was already sustained and con fi rmed in the Polish community, laboratory diagnostics should be performed for patients meeting clinical criteria and preferably for patients from the risk groups or with a severe course of the disease, according to WHO recommendations (WHO 2009h ) . The experience of the NIC shows that some specimens have been collected from asymptomatic patients, e.g., from seven healthcare workers from the same hospital department who had no symptoms, but had contact with a con fi rmed case. Moreover, these healthcare workers asked the NIC to perform diagnostics for in fl uenza A(H1N1)2009 and for in fl uenza B, despite the fact that in the con fi rmed case infection with the pandemic variant was diagnosed. This examples show the lack of knowledge on the nature of in fl uenza viruses, even among healthcare workers.

Beside specimens collected from persons without any reasonable indication for laboratory testing for the pandemic virus, there have also been specimens collected incorrectly, e.g., those with too much volume of transport medium, collected too late after the onset of symptoms, stored for too long a time, or with attached documentation without basic information on the patient and/or physician who ordered the testing. Speci fi c data on such issues were not presented in the present article. However, these weaknesses also resulted in unnecessary costs, waste of valuable time, and overload of health care units and the staff of the NIC. It is unjusti fi ed that after the end of the pandemic was announced by WHO, i.e., since August 2010 through the epidemic season 2010/2011, physicians kept on sending specimens to the NIC asking to perform diagnostics only for the pandemic virus A(H1N1)2009. They excluded from the diagnostics the in fl uenza virus B and other respiratory viruses causing in fl uenzalike illnesses such as respiratory syncytial virus, parain fl uenza viruses, human metapneumovirus, coronaviruses, adenoviruses, or rhinoviruses which all can be detected in one PCR reaction by using multiplex commercially available kits, e.g., Labopass™ RV detection kit (Cosmo), ResPlex II Plus Panel RUO (Qiagen), Seeplex RV12 ACE Detection kit (Seegene), or Seeplex RV15 OneStep ACE Detection kit (Seegene) (Brunstein et al. 2008 ; Do et al. 2011 ; Kim et al. 2009 ; Lee et al. 2010 ; Roh et al. 2008 ; Yoo et al. 2007 ) .

There are some limitations of this study. The problem was that speci fi c clinical and epidemiological information was not provided by physicians for all the swabbed patients. Nevertheless, available data presented in this study show that the picture of the infections caused by the pandemic A(H1N1)2009 in fl uenza virus in Poland was similar to that in other countries and point to a few key elements that have to be improved before the outbreak of the next in fl uenza pandemic. These elements are the need for rapid and effective communication between different pandemic players, effective access to timely, concise, and legible information and the recommendations to increase the seasonal in fl uenza vaccination rates.

Con fl icts of interest : The authors declare no con fl icts of interest in relation to this article.

Cross-reacting antibodies against the pandemic (H1N1) 2009 in fl uenza virus in older Australians

Evidence from multiplex molecular assays for complex multipathogen interactions in acute respiratory infections

In fl uenza -A disease of the 21st century

In fl uenza -A family disease

Viral etiologies of acute respiratory infections among hospitalized Vietnamese children in Ho Chi Minh City

Council Recommendation of 22 December 2009 on seasonal in fl uenza vaccination (2009/1019/EU)

European 2009 in fl uenza pandemic timeline, 11 August, ECDC In fl uenza Programme

ECDC special report. The 2009 A(H1N1) pandemic in Europe. A review of the experience

Commission Decision of

Pre-existing immunity against swine-origin H1N1 in fl uenza viruses in the general human population

Cross-reactive antibody responses to the 2009 pandemic H1N1 in fl uenza virus

High frequency of cross-reacting antibodies against 2009 pandemic in fl uenza A(H1N1) virus among the elderly in Finland

Systematic review of clinical and epidemiological features of the pandemic in fl uenza A (H1N1) 2009. In fl uenza and Other Respiratory Viruses

Rapid detection and identi fi cation of 12 respiratory viruses using dual priming oligonucleotide system-based multiplex PCR assay

Naturally occurring human monoclonal antibodies neutralize both 1918 and 2009 pandemic in fl uenza A (H1N1) viruses

Identi fi cation of adenovirus, in fl uenza virus, parain fl uenza virus, and respiratory syncytial virus by two kinds of multiplex polymerase chain reaction (PCR) and a shell vial culture in pediatric patients with viral pneumonia

Incidence of 2009 pandemic in fl uenza A H1N1 infection in England: A cross-sectional serological study

The fi rst in fl uenza pandemic of the new millennium

Cross-reactive antibody responses to the 2009 A/H1N1v in fl uenza virus in the Italian population in the pre-pandemic period

Comparison of the Seeplex reverse transcription PCR assay with the R-mix viral culture and immuno fl uorescence techniques for detection of eight respiratory viruses

Origins and evolutionary genomics of the 2009 swineorigin H1N1 in fl uenza A epidemic

In fl uenza pandemic plan. The Role of WHO and guidelines for national and regional planning

CDC realtime RTPCR (rRTPCR) protocol for detection and characterization of swine in fl uenza (version

Global in fl uenza surveillance network: Laboratory surveillance and response to pandemic H1N1

Epidemiological summary of pandemic in fl uenza A (H1N1) 2009 virus -Ontario, Canada

WHO information for laboratory diagnosis of pandemic (H1N1) 2009 virus in humans -revised

Clinical management of human infection with pandemic (H1N1) 2009: Revised guidance . 1-15

Seroepidemiological studies of pandemic in fl uenza A (H1N1) 2009 virus

Structural basis of preexisting immunity to the 2009 H1N1 pandemic in fl uenza virus

Detection of respiratory viruses with two-set multiplex reverse transcriptase-PCR assay using a dual priming oligonucleotide system