key: cord-0704457-ad623urt
authors: Alcántara, Roberto; Peñaranda, Katherin; Mendoza-Rojas, Gabriel; Nakamoto, Jose A.; Dueñas, Eva; Alvarez, Daniela; Adaui, Vanessa; Milón, Pohl
title: UnCovid: A versatile, low-cost, and open-source protocol for SARS-CoV-2 RNA detection
date: 2021-09-25
journal: STAR Protoc
DOI: 10.1016/j.xpro.2021.100878
sha: 2bdaaa367497ec99703ba53733cef3a4da676eef
doc_id: 704457
cord_uid: ad623urt

Here, we describe a detailed step-by-step protocol to detect SARS-CoV-2 RNA using RT-PCR-mediated amplification and Crispr/Cas-based visualization. The optimized assay uses basic molecular biology equipment such as conventional thermocyclers and transilluminators for qualitative detection. Alternatively, a fluorescence plate reader can be used for quantitative measurements. The protocol detects two regions of the SARS-CoV-2 genome in addition to the human RNaseP sample control. Aiming to reach remote regions, this work was developed to use the portable molecular workstation from BentoLab.

In vitro transcription (IVT) requires a double-stranded DNA (dsDNA) template containing the T7 promotor sequence. Here, we used the following dsDNA templates to transcribe crRNAs, complemental to two SARS-CoV-2 genes and for the human RNaseP as sample quality control:

Sequence (5' -3')

ORF1ab TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATTTAGAGACGGTTGGGAAATTG N TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATCCCCCAGCGCTTCAGCGTTC RNaseP TAATACGACTCACTATAGGTAATTTCTACTAAGTGTAGATAATTACTTGGGTGTGACCCT *The T7 promotor sequence is highlighted in red.

Note: Use the in vitro transcription kit of your choice to prepare crRNA. Here, the TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher) was used.

CRITICAL: Pay attention to the following general recommendations to avoid RNase contamination (Green & Sambrook, 2019) : (1) Maintain a separate pipette set, pipette tips, and any other material required for RNA lab work.

(2) Use gloves at all times. Change them frequently. (3) Preferably use RNase-free water (i.e., nuclease-free water aliquots) to prepare reactions or buffers. (4) Clean working surfaces, pipettes, and equipment with 20% bleach or alternative. commercial solutions. To avoid accelerated deterioration of any plastics and metals, wipe down with 70% ethanol after using 20% bleach.

a. Dissolve the dsDNA templates using nuclease-free water to 100 µM concentration. b. Thaw all reagents and maintain the enzyme mix on ice. c. Prepare the 25 mM NTPs (ATP, GTP, CTP, and UTP) mix by adding an equal volume of each nucleotide (100 mM stock) in a single tube. d. Prepare the master mix for 40 µL reactions as follows:

Initial concentration Final volume 39 117 * Water volume can be adjusted depending on template volume e. Dispense 39 µL of master mix in a 1.5 mL tube. f. Add 4 µg of the respective dsDNA template to the reaction tube. Here, one microliter of a 100 µM dsDNA stock (100 pmoles) was used. g. Incubate the reaction at 37°C for 3 hours.

2. crRNA purification J o u r n a l P r e -p r o o f Note: Use the RNA purification kit of your choice to purify the transcribed crRNA. Here, the Direct-zol RNA Miniprep purification Kit from Zymo Research was used. a. Add 3 volumes (i.e., 120 µL for a 40 µL reaction) of TRI-Reagent® (Zymo Research) or other similar product (TRIzol®, RNAzol®, TriPureTM, or TriSureTM) to each volume the in vitro transcription reaction. Mix thoroughly and spin briefly. b. Add 1 volume (i.e., 160 µL) of 95% -100% cold ethanol. Mix thoroughly and spin briefly. c. Transfer the mixture to the spin column and centrifuge at 10000 x g for 30 seconds.

Discard the flow-through (FT). d. Add 400 µL of RNA wash buffer and centrifuge at 10000 x g for 30 seconds. Discard the FT. Discard the FT. g. Add 700 µL of RNA wash buffer and centrifuge at 10000 x g for 30 seconds. Discard the FT. h. Transfer the column to a clean collection 1.5 mL tube i. Add 80 µL of nuclease-free water. Incubate for 2-5 seconds, and centrifuge at 10000 x g for one minute. Collect the tube and place it on ice. j. Quantify the RNA by measuring the absorbance at 260 nm (A260) in a spectrophotometer. Here, the NanoDrop One microvolume UV-Vis spectrophotometer was used (Thermo Fisher Scientific). An A260 nm absorbance of 1 is equivalent to 40 µg/mL single-stranded RNA. k. Calculate the molar concentration using the corresponding molecular weight (ORF1ab = 13.5 kDa, N = 13 kDa, RNaseP = 13 kDa). l. Dilute your RNA stocks to 10-20 µM using pre-cooled nuclease-free water, mix briefly and spin down. m. Dispense 20 µL aliquots in 0.5-1.5 mL tubes and store at -80°C. Table   Uploaded Step-by-Step Method Details

The present protocol describes the procedure for a conventional RT-PCR reaction with local produced enzymes (Mendoza-Rojas et al. 2021) coupled with CRISPR/Cas12a detection using a fluorescence microplate reader, or direct fluorescence visualization (Alcántara et al., 2021) . This protocol is intended to be used for SARS-CoV-2 RNA detection. However, the described methodology could be set up as a base protocol for molecular detection of nucleic acid molecules (RNA/DNA) of any other pathogen or microorganism of interest.

Note: In this protocol, we describe RT-PCR and CRISPR/Cas recipes for 32 reactions, to fit in the J o u r n a l P r e -p r o o f 2. Elute RNA with 100 µL of nuclease-free water.

Note: A negative extraction control (NEC) should be included during the RNA extraction step to evaluate contamination during sample handling. A NEC could be a pool of verified negative patient samples, commercial alternatives (i.e., human DNA in stabilizing synthetic matrix, such as the one available in the HDPCR TM SARS-CoV-2 assay (ChromaCode)), or even molecular-grade nuclease-free water.

One-Step RT-PCR

This protocol was standardized to amplify two gene SARS-CoV-2 targets, at the 5'-and 3'-end of the genome, as well as a region of the RNAseP human gene as RNA extraction control using a one-step RT-PCR reaction. Examples used M-MLV reverse transcriptase (RT) and Taq DNA polymerase produced in the laboratory. Commercial enzymes can be used as an alternative.

The following commercial kits have been evaluated in replacement of the enzymes mentioned here, M-MLV reverse transcriptase and/or Taq-polymerase. Commercial kits can be used as one-or two-step RT-PCR reactions without interfering with the CRISPR/Cas detection assay. For one-step reactions we tested the 2X One- Step No. M0273S, NEB). Other commercial enzymes are expected to be suitable for nucleic acid amplification followed by detection with the proposed CRISPR/Cas system described in this protocol.

The one-step RT-PCR reaction produces first a DNA copy (cDNA) of the target RNA molecules extracted from nasopharyngeal swabs or saliva samples. After this reverse transcription step, the cDNA template is amplified by the Taq DNA polymerase to generate dsDNA copies of the target region of interest (Álvarez-Fernández, 2013; Chaubal et al., 2018; Graham et al., 2021; Mahony et al., 2011) .

Note: Each gene target is amplified individually by RT-PCR.

CRITICAL: It is strongly recommended to prepare the master mix in a different laboratory area from where clinical samples are manipulated or where the samples are analyzed. Amplicon contamination can severely compromise your results. Follow the general recommendations for molecular analysis of clinical samples (WHO. Dos and don'ts for molecular testing, 2021)

Pause point: Thaw all reagents on ice, while pre-heating a thermoblock or thermocycler at 50°C.

J o u r n a l P r e -p r o o f a. Prepare the master mix according to the following recipe (i.e., scale the required volume of each reagent depending on the total number of samples to test). Here we work with 33 reactions corresponding to a final volume of 660 µL considering a 2 µL sample to be analyzed and a total volume of 20 µL for each reaction. Final volume 18 594 Note: It is recommended to prepare 1-2 additional reactions due to some volume loss by pipetting.

CRITICAL: We strongly recommend preparing and maintain the master mix on ice (or use an IsoFreeze® PCR rack) to avoid unspecific product amplification (i.e., primer dimerization) (Graham et al., 2021) . b. Mix by gently vortexing and spin down for few seconds. c. Dispense 18 µL in PCR tubes (0.2 mL). Individual tubes or PCR strips can be used. d. Securely close all tubes and spin down the tubes for few seconds.

Place the tubes on ice (or using an IsoFreeze® PCR rack) CRITICAL: To avoid amplicon contamination, the addition of RNA samples extracted from clinical samples should be performed in a dedicated laboratory area, pipette set, and BSL2 hood. This area should be restricted to any incoming amplified material. Gloves and coats should also be dedicated to this area.

2. Add 2 µL of extracted RNA samples to each reaction (Step 2). To evaluate potential reaction contamination and reaction performance, a no template control (NTC), a NEC (Step 1), and a positive control should be included in each assay, respectively.

Note: For the NTC, nuclease-free water must be added to the respective PCR tube. For the positive control, genomic RNA, RNA standards (e.g., as the ones available in the BEI Resources catalogue (https://www.beiresources.org/)) or sample pools from certified positive samples for SARS-CoV-2 can be used.

3. Insert the tubes or strips into the thermocycler from the BentoLab system (alternative thermocyclers can be used instead) (Figure 1 ).

CRITICAL: Thermocyclers must be in a dedicated area. Ensure that all tubes or strips are sealed properly to avoid cross-contamination between samples and to protect samples from evaporation.

4. Run the following RT-PCR program:

Step 5. Store the RT-PCR products at 4°C for short term or at -20°C for mid/long term until the CRISPR/Cas detection assay is performed.

Note: Optional, the RT-PCR product can be visualized by agarose gel electrophoresis. RT-PCR products are expected to be 168 bp for the ORF1ab target, 131 bp for the N target, and 175 bp for the RNAseP target ( Figure 2 ). If RT-PCR product bands are not visible, see Troubleshooting section -Problem 1.

This protocol was standardized to detect two loci at the 5'-and 3'-end of the SARS-CoV-2 genome, respectively, and a region of the RNAseP human gene. The following crRNA sequences were used for protocol standardization and validation: The LbCas12a enzyme detects a specific DNA sequence by recognizing the base pairing between crRNA and the target (Chen et al., 2018; Swarts et al., 2017) . Upon recognition of the target DNA, J o u r n a l P r e -p r o o f Cas12a undergoes structural changes in its RuvC active site that result in an unspecific trans-cleavage activity on any available single-stranded DNA (ssDNA) molecule in the vicinity (Chen et al., 2018; Li et al., 2019) . This has been adapted for in vitro detection of a target DNA of interest for diagnostic proofs of concept (Broughton et al., 2020; Chen et al., 2018) . The CRISPR/Cas12a assay uses a doublelabeled reporter probe (i.e., with a fluorophore and quencher) that is cleaved upon Cas12a transactivity only in the presence of the specific target DNA in the reaction, thereby generating a fluorescent signal that can be detected with a fluorescence plate reader or by direct visualization using a transilluminator (Bonini et al., 2020; Kumar et al., 2020) .

Note: The following example concentrations and volumes are indicated for the previous 32 RT-PCR reactions for the ORF1ab target that include 28 unknown samples, two positive controls and two no template controls (NTC). Each target RT-PCR product (ORF1ab, N, and RNaseP) is evaluated individually using the CRISPR/Cas12a assay. An Excel template (Supplemental File S1. Reaction recipe template) is provided to calculate the necessary volume of the required reagents for crRNA re-folding and Cas12a master mix preparation.

Note: All buffers required in this segment must be prepared in advanced.

6. Thaw all reagents on ice Note: When working with a multichannel pipette consider increasing the volumes of the first two pipetting steps to avoid inconsistent pipetting. 102 µL CrB2 and 6 µL RT-PCR product for a total of 108 µL from which 90 µL are taken with the multichannel pipette for further analysis.

e. Dispense 10 µL of the 10X Cas12a complex in every well of the 96-well microplate (Step 10c) (Figure 3 ). Read height 7 mm *If using an equipment that works with a variable bandwith (i.e., Cytation 5 Multi-Mode reader, Biotek) consider using the following wavelengths: ex 491±9 nm, and em 525±21 nm. If your instrument uses excitation and emission filters, use the corresponding set for Fluorescein (Usually pre-set as GFP)

ii. Transfer the microplate to the reading instrument and proceed with the measurement.

Note: The protocol was tested using the transilluminator -safeVIEW: LED/Blue Light (470 nm blue LEDs) (Cleaver Scientific).

i. Once the CRISPR/Cas12a reaction is prepared, incubate without light exposure for 30 minutes. ii. Transfer the microplate to the transilluminator and close the filter tap. iii. Register the results of direct fluorescence visualization using a photo camera or a smartphone.

Note: Using a black cabinet, box, or dark room improves the direct visualization of the results.

Regarding the fluorescence detection in unknown samples, the fluorescence must rapidly increase over time for positive samples. Negative samples and reaction controls do not show a marked increase. However, they can slightly increase over time. An appropriate variable to compare results is the fluorescence ratio between the analyzed sample towards to the non-template control (NTC) (see the Quantification and Statistical analysis section) (Alcántara et al., 2021; Hou et al., 2020) . The fluorescence ratio should be higher for positive samples than the negative ones. There is a positive dependence between fluorescence ratios and the viral RNA load of the sample, higher RNA loads derive in higher Fluorescence ratios ( Figure 4A ). In the validation study with 100 clinical samples, the median fluorescence ratio for positive samples was higher for ORF1ab target (11.4) than the one observed for the N target (7.9) ( Figure 4B ) (Alcántara et al., 2021) . For both detection targets, positive samples show a fluorescence ratio over 4-fold with respect to negative samples. For results interpretation, the fluorescence ratio of the RNaseP human gene must be considered (see below).

The fluorescence signal RNaseP gene must increase over time for both SARS-CoV-2 positive and negative clinical samples. Fluorescence ratios of the RNaseP target over the NTC control are expected to be around 25 independently of the viral RNA load ( Figure 4C ). Fluorescence ratios for the RNaseP target are higher than the ones observed for SARS-CoV-2 targets. In the validation study, the median fluorescence ratio for the 100 tested clinical samples for RNaseP was around 25 (Alcántara et al., 2021) . If the fluorescence ratio is less than two, the assay must be repeated to rule out any technical error. If the repeated test fluorescence ratio is less than two, the sample quality must be checked, or a new sample should be required (see Troubleshooting section).

Fluorescence ratios for positive controls must be higher than the negative controls. In the validation study with 100 clinical samples, a mean fluorescence ratio of 13.96 ± 1.72 RFU and 0.64 ± 0.14 RFU were reported for the positive and negative controls for the ORF1ab target, respectively. Likewise, an average fluorescence ratio of 8.37 ± 0.35 RFU and 1.05 ± 0.43 RFU were calculated for the positive and negative controls for the N target, respectively ( Figure 5 ). If fluorescence is not observed, see the Troubleshooting section -Problems 2 and/or 3.

Finally, the observation of fluorescence is indicative of a positive result for SARS-CoV-2. Positive samples show a high fluorescence intensity ( Figure 6 ). If weak fluorescence signal is visualized, see the Troubleshooting section -Problem 4.

In the quantitative approach, the fluorescence ratios over the NTC are evaluated to determine positivity.

Note: An Excel template (Supplemental File S2. Fluorescence ratios calculation template) can be used to calculate the fluorescence ratio of each sample. Sheet 1 is the original readout report and exported as an Excel file from the Biotek instruments. The template must be modified if using a different instrument and software. Sheet 2 shows the normalized fluorescence ratios between the sample and the NTC control.

1. Export the raw data for all samples as an Excel spreadsheet. Relative fluorescence unit (RFU) time courses will appear in one column for each sample/well (Table 1) . 2. Normalize the fluorescence signal by subtracting the first value (Time = 0) for each sample (Table 2) . Divide the fluorescence signal (RFU) of test samples (positive control or NEC) by the NTC values, both measured at the timepoint 30 minutes. 5. Determine positivity following the algorithm shown in Figure 7 , Note: The method using this protocol showed a Limit of Detection (LoD) of 10 2 ge/µL using SARS-CoV-2 genomic RNA (NR-52347, BEI Resources). During the validation process five out of 50 clinical samples showed false negative results. All discordant samples showed Cq values more than 33 (Alcántara et al., 2021) . However, Cq value distribution in infected people peaked between 23 -25 Cq values (Buchan et al., 2020) . In that context, the described protocol here should be able to detect all clinical samples.

This protocol has been validated only with clinical upper-respiratory samples (n = 100) and performed in one country (Peru). Although no mutations have been reported in the SARS-CoV-2 target sequences used in this protocol (ORF1ab and N) , the test sensitivity could vary depending on local circulating SARS-CoV-2 strains. The detection targets, used in this protocol, have been selected considering genome regions with low variability, we cannot exclude that false negative results could arise due to future variants of SARS-CoV-2. We recommend conducting a local clinical validation before using it as a laboratory-developed test (LDT) for clinical analysis. Negative results do not exclude COVID-19 disease. Molecular tests are part of the diagnostic algorithms worldwide that include other variables such as symptoms, contact to diagnosed patients, among others. False negative results can be produced by errors during sample manipulation and processing. This protocol is not authorized by any governmental institution yet. A technical guide to validate in-house diagnostic tests can be downloaded from the FIND website (https://www.finddx.org/reports-and-landscapes/in-house-testdevelopment-for-molecular-detection-of-sars-cov-2-en-fr-pt/). Other outcome readouts such as lateral flow assay on paper strips has not been validated with this protocol.

Problem 1: No amplification for the positive control in RT-PCR (RT_PCR_outcome)

The lack of RT-PCR products for the positive control indicates that a technical error has occurred during the preparation of the master mix or the RT-PCR running step. Also, that the quality of the reagents could be compromised. Low or null yield amplification can produce a low fluorescence signal that could be misinterpreted as a negative result.

Check that the used cycling conditions are correct. Storage conditions of the reagents, enzymes and aliquots of the controls must be checked. Replace the working stock of reagents, enzymes or aliquots of the controls if necessary.

Problem 2: High fluorescence signal in the no template control and/or negative extraction control (Fluorescence_outcome)

A high fluorescence signal in the NTC indicates contamination during the CRISPR/Cas reaction or more likely during the amplification step (RT-PCR). A high fluorescence signal in the NTC gives lower fluorescence ratios that could be misinterpreted as negative results in the test samples (false negative). In a five-day assay (to assess repeatability), a normalized fluorescence signal average (i.e., time zero subtracted) of 5171 ± 821 RFU (a.u.) and 2725 ± 411 RFU (a.u.) were obtained for both NTC controls of N and ORF1ab targets, respectively, at time point 30 minutes. Similarly, a normalized fluorescence signal average of 5350 ± 234 RFU (a.u.) and 1754 ± 418 RFU (a.u.) were observed for both NEC control of N and ORF1ab targets, respectively. However, these values may change depending on the instrument used and current setup.

Potential Solution:

First, it is recommended to repeat the assay in order to rule out cross contamination between samples or contamination in any reagent used in the CRISPR/Cas reaction. At the same time, it is recommended to run an electrophoresis to visualize any amplicon contamination in the NTC or NEC reaction. If amplicons are observed, contamination in reagents, equipment (i.e., pipettes or tips) or lab area used in the RT-PCR must be considered. Replace the working stock of reagents (i.e., primers, J o u r n a l P r e -p r o o f buffer, dNTP, or enzymes), and tips. Clean the pipettes and working areas with a commercial solution such as LookOut® DNA erase spray (Sigma-Aldrich) or 1 -2% hypochlorite solution. Cleaning procedures of equipment and lab areas must be considered as part of the working routine.

Problem 3: Low fluorescence signal in positive controls (Fluorescence_outcome)

Low fluorescence signal in positive controls could be due to technical errors in the reaction preparation (i.e., miscalculation of reagents or enzymes concentration, improper pipetting dispense, etc.). Also, that the quality of the reagents or enzymes may be compromised. Low fluorescent signals could compromise the analysis of unknown samples, affecting the calculated ratios and the test results. This problem can arise from the RT-PCR step or the Crispr/cas-mediated detection. In a fiveday assay (to assess repeatability), a normalized fluorescence signal average (i.e., time zero subtracted) of 43029 ± 6598.40 RFU (a.u.) and 37837.8 ± 3583.51 RFU (a.u.) were obtained for both SARS-CoV-2 N and ORF1ab targets, respectively, for a time readout of 30 minutes. However, the reported values may change depending on the instrument used and/or the reading setup.

To rule out a potential lack of RT-PCR amplification, check the reaction products by agarose gel electrophoresis. If RT-PCR products are absent see Problem 1. If amplified products are observed, the problem can be solved by focusing on the Crispr/cas reaction. Check the reagents and enzyme calculation, equipment setup, and reagents and enzymes storage conditions. Replace the working reagents and/or enzymes stocks if necessary. If a different fluorophore is used in the double-labeled probe, equipment setup must be standardized before evaluating clinical unknown samples.

Problem 4: Weak fluorescence during direct visualization readout (Visualization_outcome) Naked-eyed detection has been validated using a blue-light transilluminator. High fluorescence signal was reported for high-(Cq < 25) and mid-viral load samples (Cq 25 -31) ( Figure 6 ). Using other transilluminators (e.g., UV-light transilluminator) showed weaker fluorescence signal even for highand mid-viral load samples.

It is recommendable to test direct visual readout for control reactions before testing clinical unknown samples, if using other than blue-light transilluminator. If available, top filter or dark box can be used to improve direct fluorescence visualization.

Problem 5: Invalid results (Interpretation_outcome)

Invalid results are obtained when the fluorescence signal in the RNAseP target is low, producing fluorescence ratios < 2. Low fluorescence ratios can be obtained if there is a high fluorescence signal in the NTC or a low signal in the reactions with the test samples.

Verify the presence of RT-PCR products to rule out an amplification problem by agarose gel electrophoresis. If RT-PCR products are absent see Problem 1. If amplified products are observed, the problem can be solved by focusing on the Crispr/cas reaction. Repeat the CRISPR/Cas reaction to rule out any technical error during the preparation of the Cas12a master mix. Verify the storage conditions of the Cas12a and crRNA stocks to assure the reagents quality. If the repeated fluorescence ratio result is < 2 or RT-PCR products are not fully amplied, low sample quality must be considered, and a new sample must be requested. The amplification products were run on a 5% agarose gel at 70 V for 60 minutes. AmpliSize Molecular Ruler (Cat. No. 1708200, Bio-Rad) was used as ladder. Products were visualized using SafeGreen (Cat.

No. G108-G, abm) in the loading buffer TriTrack DNA loading dye 6X (Cat. No. R1161, ThermoFisher). (Hanley and McNeil, 1982) . The selected cut-off values were those that reported the highest percentage of correctly classified samples according to a ROC curve analysis with 100 samples (Alcántara et al., 2021) . * Test again if symptoms occur. If symptoms already present RT-qPCR recommended. ** If an invalid result is obtained, see Troubleshooting section -Problem 5.

Supplemental Data S1: Reaction recipe template, related to CRISPR/Cas12a-mediated detection section. Excel spreadsheet intended to be used for reagents and enzymes volume calculation for CRISPR/Cas reaction preparation. Data about number of reactions, crRNA and Cas12a concentrations must be replaced with the appropriated values. Recommended setup values for the fluorescence reader Synergy H1 (BioTek) are also indicated.

Unlocking low-and middle-income countries to detect SARS-CoV-2

Chapter One Explanatory Chapter PCR Primer Design

Advances in biosensing: The CRISPR/Cas system as a new powerful tool for the detection of nucleic acids

CRISPR-Cas12-based detection of SARS-CoV-2

Distribution of SARS-CoV-2 PCR Cycle Threshold Values Provide Practical Insight Into Overall and Target-Specific Sensitivity Among Symptomatic Patients

Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity

Amplicon residues in research laboratories masquerade as COVID-19 in surveillance tests

Open-source RNA extraction and RT-qPCR methods for SARS-CoV-2 detection

How to Win the Battle with RNase

The meaning and use of the area under a receiver operating characteristic (ROC) curve

Development and evaluation of a rapid CRISPR-based diagnostic for COVID-19

A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity

CRISPR-Cas System: An Approach With Potentials for COVID-19

HOLMESv2: A CRISPR-Cas12b-Assisted Platform for Nucleic Acid Detection and DNA Methylation Quantitation

Molecular diagnosis of respiratory virus infections

Structural Basis for Guide RNA Processing and Seed-Dependent DNA Targeting by CRISPR-Cas12a

Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System

Dos and don'ts for molecular testing, Dos and don'ts for molecular testing

A low-cost and open-source protocol for expression of key molecular biology enzymes

We are very thankful to Dr. Marcos Milla for donating equipment that was used in this study and others. We would also like to thank all lab members of the Adaui and Milón groups for their help, support, and great working atmosphere.

This work was supported by grants from the Peruvian Fondo Nacional de Desarrollo Científico, 

All the authors refer to no present any conflict of interests.

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Pohl Milón (pmilon@upc.pe).

All unique reagents developed in this work can be purchased at any gene synthesis company (i.e., primers and crRNA templates).

Additional Supplemental Items are available from Mendeley Data at http://dx.doi.org/10.17632/8m8z37v8xz.1.