key: cord-0701246-ledk75ak
authors: Diamond, Michael; Chen, Rita; Winkler, Emma; Case, James; Aziati, Ishmael; Bricker, Traci; Joshi, Astha; Darling, Tamarand; Ying, Baoling; Errico, John; Shrihari, Swathi; VanBlargan, Laura; Xie, Xuping; Gilchuk, Pavlo; Zost, Seth; Droit, Lindsay; Liu, Zhuoming; Stumpf, Spencer; Wang, David; Handley, Scott; Stine, W; Shi, Pei-Yong; Garcia-Knight, Miguel; Andino, Raul; Chiu, Charles; Ellebedy, Ali; Fremont, Daved; Whelan, Sean; Crowe, James; Purcell, Lisa; Corti, Davide; Boon, Andrianus
title: In vivo monoclonal antibody efficacy against SARS-CoV-2 variant strains
date: 2021-04-23
journal: Res Sq
DOI: 10.21203/rs.3.rs-448370/v1
sha: 7902eb3b620029f4b5fe7da953c6e37ea29cf471
doc_id: 701246
cord_uid: ledk75ak

Rapidly-emerging variants jeopardize antibody-based countermeasures against SARS-CoV-2. While recent cell culture experiments have demonstrated loss of potency of several anti-spike neutralizing antibodies against SARS-CoV-2 variant strains1-3, the in vivo significance of these results remains uncertain. Here, using a panel of monoclonal antibodies (mAbs) corresponding to many in advanced clinical development by Vir Biotechnology, AbbVie, AstraZeneca, Regeneron, and Lilly we report the impact on protection in animals against authentic SARS-CoV-2 variants including WA1/2020 strains, a B.1.1.7 isolate, and chimeric strains with South African (B.1.351) or Brazilian (B.1.1.28) spike genes. Although some individual mAbs showed reduced or abrogated neutralizing activity against B.1.351 and B.1.1.28 viruses with E484K spike protein mutations in cell culture, low prophylactic doses of mAb combinations protected against infection in K18-hACE2 transgenic mice, 129S2 immunocompetent mice, and hamsters without emergence of resistance. Two exceptions were mAb LY-CoV555 monotherapy which lost all protective activity in vivo, and AbbVie 2B04/47D11, which showed partial loss of activity. When administered after infection as therapy, higher doses of mAb cocktails protected in vivo against viruses displaying a B.1.351 spike gene. Thus, many, but not all, of the antibody products with Emergency Use Authorization should retain substantial efficacy against the prevailing SARS-CoV-2 variant strains.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has caused the global coronavirus disease 2019 (COVID- 19) pandemic and resulted in more than 140 million con rmed infections and over 3 million deaths. The sustained nature of the COVID-19 pandemic and its accompanying extensive morbidity and mortality have made the development and immediate deployment of therapeutics and vaccines an urgent global health priority 4 . Indeed, the emergency use authorization (EUA) of several monoclonal antibody (mAb) therapies and mRNA, inactivated, and viral-vectored vaccines has provided hope for controlling infection and curtailing the pandemic.

Currently authorized antibody countermeasures against SARS-CoV-2 target the spike protein from strains circulating during the early phases of the pandemic in 2020. The SARS-CoV-2 spike protein binds the cell-surface receptor angiotensin-converting enzyme 2 (ACE2) to facilitate viral entry into and infection of human cells 5 . Upon cell attachment, SARS-CoV-2 spike proteins are cleaved by host proteases into S1 and S2 fragments. The S1 protein includes the Nterminal (NTD) and receptor binding (RBD) domains, whereas the S2 protein promotes membrane fusion. The RBD, in particular, is the target of many potently neutralizing monoclonal 6-10 and serum polyclonal antibodies 11 . and authentic infectious SARS-CoV-2 strains suggest that neutralization by a substantial fraction of previously generated antibodies may be diminished against variants expressing mutations in the spike gene, especially at position E484 [1] [2] [3] 12, 13 . However, the in vivo signi cance of this loss of mAb neutralizing activity remains uncertain, particularly for combination mAb therapies, as high doses could compensate for changes in neutralization potency. Here, using mice and hamsters, we assessed the protective activity of clinically relevant mAbs against WA1/2020 strains and a panel of SARS-CoV-2 variants including a B.1.1.7 isolate, and chimeric strains with South African (B.1.351) or Brazilian (B.1.1.28) spike genes. We tested cocktails of mAbs from AbbVie (2B04/47D11) and Vir Biotechnology (S309/S2E12) as well as ones corresponding to those from AstraZeneca (COV2-2130/COV2-2196), Regeneron (REGN10933/REGN10987), and Lilly (LY-CoV555) as prophylaxis or therapy against SARS-CoV-2 in K18-hACE2 transgenic mice, 129S2 immunocompetent mice, and Syrian hamsters. Whereas several antibody combinations conferred protection in both mouse models with all variant strains tested, the 2B04/47D11 combination and LY-CoV555 showed reduced or complete loss of protective activity. One of the combinations (COV2-2130/COV2-2196) also showed equivalent protective activity in hamsters against WA1/2020 D614G and the chimeric strain with a B.1.351 spike.

To evaluate the effects of SARS-CoV-2 strain variation on mAb protection, we assembled a panel of infectious SARS-CoV-2 strains with sequence substitutions in the spike gene (Fig 1a-b) . A B.1.1.7 isolate from the United Kingdom had signature changes in the spike gene 14 including the 69-70 and 144-145 deletions, and N501Y, A570D, D614G, and P681H substitutions. A B.1.429 isolate from California contained the characteristic S13I, W152C, and L452R changes. We also used a previously generated Washington SARS-CoV-2 strain with a D614G substitution (WA1/2020 D614G), a SARS-CoV-2 strain with N501Y and D614G substitutions (WA1/2020 N501Y/D614G), and recombinant, chimeric SARS-CoV-2 strains with a South African (Wash SA-B.1.351; D80A, D215G, 242-244 deletion, K417N, E484K, N501Y, D614G, and A701V) or Brazilian (Wash BR-B.1.1.28; L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, and V1176F) spike genes in the Washington strain background 1, 15 . All viruses were propagated in Vero cells expressing transmembrane protease serine 2 (TMPRSS2) to prevent the emergence of mutations at or near the furin cleavage site in the spike protein, which occurs with passage in Vero E6 cells 16 and can impact virulence 17 . All viruses were deep-sequenced to con rm the presence of expected mutations prior to use in vitro or in vivo (Supplementary Table S1 ).

We rst assessed the impact of SARS-CoV-2 spike variation on antibody neutralization in Vero-TMPRSS2 cells (Fig 1c-d) (Fig 1c-d) . In comparison, REGN10987 or LY-CoV555 respectively showed a ~10-fold or complete loss in inhibitory activity against the B.1.429 strain, which is consistent with studies identifying L452 and adjacent residues as interaction sites for these mAbs (Table 1) . Moreover, REGN10933, LY-CoV555, and 2B04 exhibited a marked loss or complete absence of neutralizing activity against Wash SA-B.1.351, Wash BR-B.1.1.28, and viruses containing the E484K mutation (Fig 1c-d and Extended Data Fig 1) , which corresponds with structural and mapping studies ( Table 1) . Analysis of mAb cocktails showed that COV2-2130/COV2-2196, S309/S2E12, and REGN10933/REGN10987 neutralized all virus strains tested, with the latter combination retaining potency corresponding to the mAb with inhibitory activity in the cocktail for a given virus. In comparison, while the 2B04/47D11 mAb combination e ciently neutralized WA1/2020 D614G, WA1/2020 N501Y/D614G, B. (Fig 1c-d) .

To evaluate the e cacy of the mAb combinations in vivo, we initially used the K18-hACE2 transgenic mouse model of SARS-CoV-2 pathogenesis in which human ACE2 expression is driven by the cytokeratin-18 gene promoter 18, 19 . In prior studies, we established that low (2 mg/kg) doses of several different anti-RBD neutralizing human mAbs provide a threshold of protection against the WA1/2020 strain when administered as prophylaxis 20 . Accordingly, we gave K18-hACE2 mice a single 40 μg (~2 mg/kg total) dose of mAb combinations (2B04/47D11, S309/S2E12, COV2-2130/COV2-2196, or REGN10933/REGN10987) or LY-CoV555 as monotherapy by intraperitoneal injection one day prior to intranasal inoculation with SARS-CoV-2 ( 21 ,22 yet did not substantively impact neutralization of the mAbs we tested (Fig 1c) . We monitored weight change for six days, and then euthanized animals and harvested tissues for virological and immunological analyses.

Compared to a control human mAb (anti-West Nile virus hE16 23 ), a single 40 mg prophylaxis dose of the anti-SARS-CoV-2 mAbs conferred substantial protection against WA1/2020 N501Y/D614G-induced weight loss and viral burden in the lungs, nasal washes, brain, spleen, and heart in the K18-hACE2 mice at 6 days post-infection (dpi) (Fig 2a- protection against infection in the brain (Fig 2f-h) . Sanger sequencing analysis of the RBD region of viral RNA of brain, nasal wash, and lung samples from animals treated with these mAbs did not show evidence of neutralization escape (Supplementary Table S2 ). 2B04/47D11 and LY-CoV555-treated animals also showed greater virus breakthrough than the other tested antibodies when challenged with Wash SA-B.1.351 or Wash BR-B.1.1.28 viruses: 2B04/47D11 reduced viral burden in the lungs, nasal washes, and brain (500-10,000-fold) much less e ciently than other mAb cocktails, and LY-CoV555 mAb treatment conferred virtually no virological protection in any tissue analyzed ( An excessive pro-in ammatory host response to SARS-CoV-2 infection is hypothesized to contribute to pulmonary pathology and severe COVID-19 24 . To evaluate further the extent of protection conferred by the different mAb groups against the SARS-COV-2 variant viruses, we measured pro-in ammatory cytokine and chemokines in lung homogenates harvested at 6 dpi (Fig 2q and Extended Data Fig 4) . This analysis showed a strong correspondence with viral RNA levels in the lung: Given that a 40 mg dose of S309/S2E12, COV2-2130/COV2-2196, and REGN10933/REGN10987 combinations prevented infection and in ammation caused by the different SARS-CoV-2 strains, we next tested a ten-fold lower 4 mg dose (~0.2 mg/kg) to assess for possible differences in protection. Prophylaxis with COV2-2130/COV2-2196, S309/S2E12, REGN10933/REGN10987, or 2B04/47D11 protected K18-hACE2 mice against weight loss caused by all four viruses Table S2 ).

Although K18-hACE2 mice have been used extensively to test vaccines and therapeutics against SARS-CoV-2 20,25-28 , the high level and distinct pattern of transgene expression in these animals could impact entry pathways, and neutralization and protection conferred by anti-RBD antibodies. As an alternative model for evaluating mAb e cacy, we tested immunocompetent, inbred 129S2 mice, which are permissive to infection by SARS-CoV-2 strains encoding an N501Y substitution without ectopic hACE2 expression 21, 22 ; presumably, the N501Y adaptive mutation enables e cient engagement of murine (m)ACE2. We administered a single 40 µg (~2 mg/kg) dose of mAb cocktails (COV2-2130/COV2-2196, S309/S2E12, or REGN10933/REGN10987) or a control mAb via intraperitoneal injection one day prior to intranasal inoculation with 10 3 FFU of WA1/2020 N501Y/D614G, Wash SA-B.1.351, or Wash BR-B.1.1.28, and 10 5 FFU of B.1.1.7 (Fig 3) . A higher inoculating dose of B.1.1.7 was required to obtain equivalent levels of viral RNA in the lung compared to the other three viruses. At 3 dpi, we harvested tissues for viral burden analyses; at this time point, reproducible weight loss was not observed. All three mAb cocktails tested (COV2-2130/COV2-2196, S309/S2E12, and REGN10933/REGN10987) protected 129S2 mice against infection in the lung by all SARS-CoV-2 strains as judged by reductions in viral RNA levels (Fig 3a-d) ; despite some variability, we observed a trend toward less complete protection in animals infected with Wash SA-B.1.351 and Wash BR-B.1.1.28 strains (Fig 3c-d and Extended Data Fig 3c-f ). When we evaluated the nasal washes, reductions in viral RNA levels were diminished with the Wash SA-B.1.351 virus, especially for the COV2-2130/COV2-2196 and REGN10933/REGN10987 combinations (Fig 3e-h) . Sequencing analysis of lung samples from the infected 129S2 mice also did not reveal evidence of acquisition of mutations in the RBD (Supplementary Table S2 ).

The immunocompetent Syrian golden hamster also has been used to evaluate mAb activity against SARS-CoV-2 infection in the upper and lower respiratory tracts 29, 30 . We used this animal model to assess independently the inhibitory activity and possible emergence of resistance of one of the mAb combinations (COV2-2130/COV2-2196) against viruses containing the B.1.351 spike protein at threshold doses of protection. One day prior to intranasal inoculation with 5 x 10 5 FFU of Wash SA-B.1.351 or WA1/2020 D614G, we treated hamsters with a single 800 µg (~10 mg/kg) or 320 µg (~4 mg/kg) dose of the COV2-2130/COV2-2196 cocktail or isotype control mAb by intraperitoneal injection (Fig 4) . Weights were followed for 4 days, and then tissues were harvested for virological and cytokine analysis. At the 800 µg mAb cocktail dose, hamsters treated with COV2-2130/COV2-2196 and infected with WA1/2020 D614G or Wash SA-B.1.351 showed protection against weight loss (Fig 4a) and reduced viral burden levels in the lungs but not nasal swabs compared to the isotype control mAb (Fig 4b-d) . Correspondingly, RT-qPCR analysis of a previously described set of cytokines and in ammatory genes 20 showed reduced mRNA expression in the lungs of hamsters treated with COV2-2130/COV2-2196 (Fig 4e-h) . Consensus sequencing of the RBD region of viral RNA samples from the lungs of hamsters treated with COV2-2130/COV2-2196 and inoculated with WA1/2020 D614G or Wash SA-B.1.351 did not show evidence of mutation or escape (Supplementary Table S2 ). When the lower 320 µg dose of COV2-2130/COV2-2196 was administered, we observed a trend toward protection against weight loss in hamsters infected with WA1/2020 D614G and Wash SA-B.1.351 (Fig 4i) . Consistent with a partially protective phenotype, hamsters treated with the lower 320 µg dose of COV2-2130/COV2-2196 and inoculated with either WA1/2020 D614G and Wash SA-B.1.351 showed a trend towards reduced viral RNA in the lungs at 4 dpi and markedly diminished (~10 4 to 10 5 -fold) levels of infectious virus as determined by plaque assay (Fig 4j-k) . The reduction in lung viral load conferred by the lower dose COV2-2130/COV2-2196 corresponded with diminished in ammatory gene expression after infection with either WA1/2020 D614G or Wash SA-B.1.351 (Fig 4m-p) . In contrast to the protection seen in the lung, differences in viral RNA were not observed in nasal washes between COV2-2130/COV2-2196 and isotype control mAb-treated animals regardless of the infecting strain (Fig 4l) . Sequencing of the RBD of viral RNA from the lungs of COV2-2130/COV2-2196 or isotype mAb-treated hamsters also did not detect evidence of escape mutation selection after infection with WA1/2020 D614G or Wash SA-B.1.351 (Supplementary Table S2) . Overall, these studies in hamsters with near threshold dosing of the COV2-2130/COV2-2196 mAb cocktail establish equivalent protection and an absence of rapid escape against SARS-CoV-2 containing spike proteins from historical or variant strains.

As mAbs are being developed clinically as therapeutics, we assessed their post-exposure e cacy against the SARS-CoV-2 strain expressing the B.1.351 spike protein using the stringent K18-hACE2 model. We administered a single, higher 200 µg (~10 mg/kg) dose of COV2-2130/COV2-2196, S309/S2E12, REGN10933/REGN10987 or 2B04/47D11 by intraperitoneal injection one day after inoculation with 10 3 FFU of WA1/2020 N501Y/D614G or Wash SA-B.1.351, and then monitored the mice for six days prior to necropsy and virological analysis (Fig 5) . We did not test the LY-CoV555 mAb in these therapeutic experiments, since it failed to protect against Wash SA-B.1.351 as prophylaxis. Compared to the control mAb-treated animals, which lost at least 15% of their starting weight over the 6 days of the experiment, each of the mAb cocktails prevented weight loss induced by WA1/2020 N501Y/D614G or Wash SA-B.1.351 infection (Fig 5a and e) . COV2-2130/COV2-2196, S309/S2E12, and REGN10933/REGN10987 mAb cocktail treatments resulted in reduced infectious virus and viral RNA levels in lung homogenates, and viral RNA levels in nasal washes and brain homogenates from animals infected with either WA1/2020 N501Y/D614G or Wash SA-B.1.351 (Fig 5b-d 34 , showed complete neutralization escape in cell culture and failed to confer any protection against viruses containing E484K substitutions. In contrast, all cocktails of two neutralizing mAbs conferred protection to varying degrees even if one of the constituent mAbs showed reduced activity due to resistance. Moreover, the higher doses of mAbs used in patients (e.g., 2.4 g or ~ 35 mg/kg for casirivimab and imdevimab [REGN mAbs]) could compensate for loss in neutralization potency.

Combination therapy with multiple mAbs in our study (COV2-2130/COV2-2196, S309/S2E12, REGN10933/REGN10987, or 2B04/47D11) was protective in mice and hamsters against the variant strains, highlighting the importance of using multiple mAbs recognizing distinct epitopes rather than monotherapy to control SARS-CoV-2 infection. Indeed, the emergency use authorization for bamlanivimab (LY-CoV555) as monotherapy recently was revoked, since the antibody does not e ciently reduce SARS-CoV-2 infection of several variants of concern that are spreading globally 35 ; instead, a combination of bamlanivimab and etesevimab is now recommended even though some strains containing E484 and K417 mutations (e.g., B.1.351 and B.1.1.28) likely will have resistance to both mAb components ( 2,36 and Extended Data Fig 6) . In our study, combination therapy with two mAbs including one (2B04) that failed to neutralize a virus containing the E484K mutation still protected when administered at higher doses, although the reduction in viral burden was less than with other mAb cocktails at equivalent doses. Beyond a loss of potency against already circulating resistant variants, antibody monotherapy can be compromised within an individual by rapid selection of escape mutations de novo or enrichment of pre-existing mutants in the quasispecies present at low frequency. Consistent with this idea, in other animal experiments with SARS-CoV-2, we have observed the rapid emergence of resistance against antibody monotherapy, resulting in the accumulation of mutations at RBD residues 476, 477 484, and 487, only some of which were detectable in our parental virus stocks by next generation sequencing ( 37 and M. Diamond, A. Boon, and A. Ellebedy, unpublished data). Remarkably, and despite amplifying the RBD sequence from 96 brain, nasal wash, and lung samples from mice and hamsters treated with the different mAb combinations, we did not detect a single escape mutant. Although further study is warranted, combination mAb treatment may prevent escape through synergistic interactions in vivo or by driving selection of mutants with compromised tness.

At the lower doses of mAbs tested, we observed some differences in mAb cocktail e cacy between rodent models, which could be due to host variation, viral variation, or both. For example, mutations in the RBD can affect mAb binding as well as ACE2 binding 38 . Mutation at position 501 of the spike is of particular interest, since it enables mouse adaptation 21, 22 and is present in many variants of concern (e.g., B. 1.1.7, B.1.351, and B.1.1.28) . The N501Y change associated with infection of conventional laboratory mice could facilitate virus engagement with murine ACE2 or possibly other putative target receptors 39 . Beyond this, polymorphisms in or differences of expression of host receptors on key target cells also could impact SARS-CoV-2 infection in different hosts and the inhibitory effects of neutralizing antibodies. As both viral and host sequences determine the interface between SARS-CoV-2 spike and its cell entry receptors like ACE2, mAb interactions and potency could be affected in different species of animals. Changes in the a nity of interaction between spike proteins and receptors can impact the stoichiometry of neutralizing antibody binding required to inhibit infection 40 . Although further study of antibody-based countermeasures in vivo is required, the complexity of antibody-spike protein-receptor interactions likely explains some of the variation in protection K18-hACE2 mice, 129S2 mice, and hamsters. Alternatively, the pharmacokinetics and/or biodistribution of antibodies in these animals also could vary and affect e cacy. In the animal models we tested, we did not observe marked differences in serum antibody levels in the context of viral challenge (Supplementary Table S3 ). in Vero-TMPRSS2 cells and subjected to next-generation sequencing as described previously 1 to con rm the introduction and stability of substitutions (Supplementary Table S1 ). All virus experiments were performed in an approved biosafety level 3 (BSL-3) facility.

Monoclonal antibody puri cation. The mAbs studied in this paper (COV2-2196, COV2-2130, S309, S2E12, 2B04, 47D11, REGN10933, REGN10987, LY-CoV555, and CB6) have been described previously 6,8,10,44,48-51 . COV2-2196 and COV2-2130 mAbs were produced after transient transfection using the Gibco ExpiCHO Expression System (ThermoFisher Scienti c) following the manufacturer's protocol. Culture supernatants were puri ed using HiTrap MabSelect SuRe columns (Cytiva, formerly GE Healthcare Life Sciences) on an AKTA Pure chromatographer (GE Healthcare Life Sciences). Puri ed mAbs were buffer-exchanged into PBS, concentrated using Amicon Ultra-4 50-kDa centrifugal lter units (Millipore Sigma) and stored at -80 °C until use. Puri ed mAbs were tested for endotoxin levels (found to be less than 30 EU per mg IgG). Endotoxin testing was performed using the PTS201F cartridge (Charles River), with a sensitivity range from 10 to 0.1 EU per mL, and an Endosafe Nexgen-MCS instrument (Charles River). S309, S2E12, REGN10933, REGN10987, CB6, and LY-CoV555 mAb proteins were produced in CHOEXPI cells and a nity puri ed using HiTrap Protein A columns (GE Healthcare, HiTrap mAb select Xtra #28-4082-61). Puri ed mAbs were suspended into 20 mM histidine, 8% sucrose, pH 6.0. The nal products were sterilized by ltration through 0.22μm lters and stored at 4°C.

Mouse experiments. Animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381-01). Virus inoculations were performed under anesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.

Heterozygous K18-hACE2 C57BL/6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) and 129 mice (strain: 129S2/SvPasCrl) were obtained from The Jackson Laboratory and Charles River Laboratories, respectively. Animals were housed in groups and fed standard chow diets. Six-to ten-week-old mice of both sexes were administered 10 3 or 10 5 FFU of the respective SARS-CoV-2 strain by intranasal administration.

For antibody prophylaxis and therapeutic experiments, animals were administered the indicated mAb dose by intraperitoneal injection one day before or after intranasal inoculation with the indicated SARS-CoV-2 strain.

Hamster experiments. Six-month-old male Syrian hamsters were purchased from Charles River Laboratories and housed in microisolator units. All hamsters were allowed free access to food and water and cared for under United States Department of Agriculture (USDA) guidelines for laboratory animals. Hamsters were administered by intraperitoneal injection mAbs COV2-2130 + COV2-2196 or isotype control (4 or 10 mg/kg depending on the experiment). One day later, hamsters were given 5 x 10 5 FFU of SARS-CoV-2 (2019-nCoV/USA-WA1/2020) by the intranasal route in a nal volume of 100 μL. All hamsters were monitored for body weight loss until humanely euthanized at 4 dpi. Nasal swabs were collected 3 dpi. All procedures were approved by the Washington University School of Medicine (assurance number A3381-01). Virus inoculations and antibody transfers were performed under anesthesia that was induced and maintained with 5% iso urane. All efforts were made to minimize animal suffering.

Focus reduction neutralization test. Serial dilutions of mAbs (starting at 10 mg/mL dilution) were incubated with 10 2 focus-forming units (FFU) of different strains or variants of SARS-CoV-2 for 1 h at 37°C. Antibody-virus complexes were added to Vero-TMPRSS2 or Vero-hACE2-TMPRSS2 cell monolayers in 96well plates and incubated at 37°C for 1 h. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in MEM supplemented with 2% FBS. Plates were harvested 24 h later by removing overlays and xed with 4% PFA in PBS for 20 min at room temperature. Plates were washed and sequentially incubated with an oligoclonal pool of SARS2-2, SARS2-11, SARS2-16, SARS2-31, SARS2-38, SARS2-57, and SARS2-71 52 anti-S antibodies and HRP-conjugated goat antimouse IgG (Sigma, 12-349) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin. SARS-CoV-2-infected cell foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot microanalyzer (Cellular Technologies).

Measurement of viral burden. Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1000 μL of DMEM medium supplemented with 2% heat-inactivated FBS. Tissue homogenates were clari ed by centrifugation at 10,000 rpm for 5 min and stored at −80°C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scienti c) on the King sher Flex extraction robot (Thermo Fisher Scienti c). RNA was reverse transcribed and ampli ed using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scienti c). Reverse transcription was carried out at 48°C for 15 min followed by 2 min at 95°C. Ampli cation was accomplished over 50 cycles as follows: 95°C for 15 s and 60°C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay 53 . Brie y, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained nal concentrations of primers and probe of 500 and 100 nM, respectively.

Plaque assay. Vero-TMPRSS2-hACE2 cells were seeded at a density of 1×10 5 cells per well in 24-well tissue culture plates. The following day, medium was removed and replaced with 200 μL of material to be titrated diluted serially in DMEM supplemented with 2% FBS. One hour later, 1 mL of methylcellulose overlay was added. Plates were incubated for 72 h, then xed with 4% paraformaldehyde ( nal concentration) in PBS for 20 min. Plates were stained with 0.05% (w/v) crystal violet in 20% methanol and washed twice with distilled, deionized water.

Cytokine and chemokine protein measurements. Lung homogenates were incubated with Triton-X-100 (1% nal concentration) for 1 h at room temperature to inactivate SARS-CoV-2. Homogenates then were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array / Chemokine Array 31-Plex (MD31) platform.

Data availability. All data supporting the ndings of this study are available within the paper and are available from the corresponding author upon request.

Statistical analysis. All statistical tests were performed as described in the indicated gure legends using Prism 8.0. Statistical signi cance was determined using an ordinary one-way ANOVA with Dunnett's post-test when comparing three or more groups. to antibodies described in this paper. The Ellebedy laboratory has received funding support in sponsored research agreements from AbbVie Inc. and Emergent BioSolutions. The Boon laboratory has received funding support in sponsored research agreements from AI Therapeutics, GreenLight Biosciences, AbbVie, and Nano targeting & Therapy Biopharma. The Shi laboratory has received sponsored research agreements from P zer, Gilead, Merck, and IGM Sciences Inc. D.C. and L.P. are employees of Vir Biotechnology and may hold equity in Vir Biotechnology. L.P. is a former employee and may hold equity in Regeneron Pharmaceuticals. W.B.S. is an employee of AbbVie and may hold equity. 

Resistance of SARS-CoV-2 variants to neutralization by monoclonal and serum-derived polyclonal antibodies

Antibody Resistance of SARS-CoV-2 Variants B.1.351 and B.1.1.7

mRNA vaccine-elicited antibodies to SARS-CoV-2 and circulating variants

Pandemic Preparedness: Developing Vaccines and Therapeutic Antibodies For COVID-19

Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses

Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody

Potent neutralizing antibodies against SARS-CoV-2 identi ed by high-throughput single-cell sequencing of convalescent patients' B cells

Rapid isolation and pro ling of a diverse panel of human monoclonal antibodies targeting the SARS-CoV-2 spike protein

SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies

Ultrapotent human antibodies protect against SARS-CoV-2 challenge via multiple mechanisms

SARS-CoV-2 Serologic Assays in Control and Unknown Populations Demonstrate the Necessity of Virus Neutralization Testing

SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma

Neutralization of viruses with European, South African, and United States SARS-CoV-2 variant spike proteins by convalescent sera and BNT162b2 mRNA vaccine-elicited antibodies

Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom

Neutralization of SARS-CoV-2 spike 69/70 deletion, E484K and N501Y variants by BNT162b2 vaccine-elicited sera

SARS-CoV-2 growth, furin-cleavage-site adaptation and neutralization using serum from acutely infected hospitalized COVID-19 patients

Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis

SARS-CoV-2 infection of human ACE2-transgenic mice causes severe lung in ammation and impaired function

Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus

Human neutralizing antibodies against SARS-CoV-2 require intact Fc effector functions for optimal therapeutic protection

The N501Y mutation in SARS-CoV-2 spike leads to morbidity in obese and aged mice and is neutralized by convalescent and postvaccination human sera. medRxiv : the preprint server for health sciences

Adaptation of SARS-CoV-2 in BALB/c mice for testing vaccine e cacy

Development of a humanized monoclonal antibody with therapeutic potential against West Nile virus

Complex Immune Dysregulation in COVID-19 Patients with Severe Respiratory Failure

Post-exposure protection of SARS-CoV-2 lethal infected K18-hACE2 transgenic mice by neutralizing human monoclonal antibody

COVID-19 vaccine candidates based on modi ed vaccinia virus Ankara expressing the SARS-CoV-2 spike induce robust T-and Bcell immune responses and full e cacy in mice

COVID-19 treatments and pathogenesis including anosmia in K18-hACE2 mice

A Single-Dose Intranasal ChAd Vaccine Protects Upper and Lower Respiratory Tracts against SARS-CoV-2

Robust SARS-CoV-2 infection in nasal turbinates after treatment with systemic neutralizing antibodies

Extremely potent human monoclonal antibodies from COVID-19 convalescent patients

Concerns about SARS-CoV-2 evolution should not hold back efforts to expand vaccination

Neutralization of SARS-CoV-2 Variants B.1.429 and B.1.351

SARS-CoV-2 immune evasion by variant B.1.427/B.1.429. bioRxiv

A Neutralizing Monoclonal Antibody for Hospitalized Patients with Covid-19

Effect of Bamlanivimab as Monotherapy or in Combination With Etesevimab on Viral Load in Patients With Mild to Moderate COVID-19: A Randomized Clinical Trial

Complete map of SARS-CoV-2 RBD mutations that escape the monoclonal antibody LY-CoV555 and its cocktail with LY-CoV016

A public vaccine-induced human antibody protects against SARS-CoV-2 and emerging variants

Mutation N501Y in RBD of Spike Protein Strengthens the Interaction between COVID-19 and its Receptor ACE2

r) New Perspective on SARS-CoV-2 Biology

A game of numbers: the stoichiometry of antibody-mediated neutralization of avivirus infection

Neutralization potency of monoclonal antibodies recognizing dominant and subdominant epitopes on SARS-CoV-2 Spike is impacted by the B.1.1.7 variant

The effect of spike mutations on SARS-CoV-2 neutralization

Evidence of escape of SARS-CoV-2 variant B.1.351 from natural and vaccine-induced sera

Antibody cocktail to SARS-CoV-2 spike protein prevents rapid mutational escape seen with individual antibodies

Meeting modern challenges in visualization and analysis

TMPRSS2 and TMPRSS4 promote SARS-CoV-2 infection of human small intestinal enterocytes

Spike mutation D614G alters SARS-CoV-2 tness

A Potently Neutralizing Antibody Protects Mice against SARS-CoV-2 Infection

REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters

LY-CoV555, a rapidly isolated potent neutralizing antibody, provides protection in a non-human primate model of SARS-CoV-2 infection

A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2

Identi cation of SARS-CoV-2 spike mutations that attenuate monoclonal and serum antibody neutralization

Growth, detection, quanti cation, and inactivation of SARS-CoV-2

Potently neutralizing and protective human antibodies against SARS-CoV-2

Genetic and structural basis for recognition of SARS-CoV-2 spike protein by a two-antibody cocktail

Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail

Prospective mapping of viral mutations that escape antibodies used to treat COVID-19

A human monoclonal antibody blocking SARS-CoV-2 infection

Antibodies to the SARS-CoV-2 receptor-binding domain that maximize breadth and resistance to viral escape

The neutralizing antibody, LY-CoV555, protects against SARS-CoV-2 infection in non-human primates

SARS-CoV-2 variant substitutions mapped onto the structure of the spike protein. Schematic layout of the spike protein monomer is depicted at the top. Structure of spike monomer (PDB: 7C2L with RBD from PDB: 6W41) is depicted as a cartoon, with NTD, RBD, RBM, and S2 colored orange, green, magenta, and light blue, respectively

Substitutions shown in cyan (E484K and K417[N/T]) are shared by B.1.351 and B.1.1.28. Substitutions shown in black (D614G and N501Y) are shared by B.1.1.7, B.1.351, and B.1.1.28. Pink and brown triangles show approximate locations of S13 and P681

Viruses used with indicated mutations in the spike protein. (c) Summary of EC50 values (ng/mL) of neutralization of SARS-CoV-2 viruses performed in Vero-TMPRSS2 cells. Blue shading of cells indicates a partial (EC50 > 1,000 ng/mL) or complete (EC50 > 10,000 ng/mL) loss of neutralizing activity

Antibody prophylaxis against SARS-CoV-2 variants in K18-hACE2 mice. (a-q) 8-10-week-old female and male K18-hACE2 transgenic mice received 40 g

Tissues were collected at 6 dpi. (a, e, i, m) Weight change following infection with SARS-CoV-2 (mean ± SEM; n = 6-12 mice per group, two experiments; oneway ANOVA with Dunnett's test of area under the curve: ns, not signi cant, **** P < 0.0001). Viral RNA levels in the lung (b, f, j, n), nasal washes (c, g, k, o), and brain (d, h, l, p) were measured (n = 6-12 mice per group, two experiments; one-way ANOVA with Dunnett's test with comparison to control mAb: ns, not signi cant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001). Dotted line indicates the limit of detection of the assay. Heat map of cytokine and chemokine protein expression levels in lung homogenates

Antibody-mediated protection against SARS-CoV-2 variants in 129S2 mice. 6-7-week-old female and male immunocompetent 129S2 mice received 40 mg

mg/kg) of the indicated mAb treatment by intraperitoneal injection one day before intranasal inoculation with 103 FFU of WA1/2020 N501Y/D614G, Wash SA

Tissues were collected at 3 dpi. Viral RNA levels in the lung (a-d) or nasal washes (e-h) were determined (n = 7-12 mice per group, pooled from two experiments; one-way ANOVA with Dunnett's test with comparison to control mAb: ns

This study was supported by grants and contracts from NIH (R01 AI157155, U01 AI151810, U01AI141990, U01AI 151810, R01 AI118938, 75N93019C00051,