key: cord-0700440-n5e7osav
authors: Odiwuor, Nelson; Xiong, Jin; Ogolla, Faith; Hong, Wei; Li, Xiaohong; Khan, Fazal Mehmood; Wang, Nuo; Yu, Junping; Wei, Hongping
title: A point-of-care SARS-CoV-2 test based on reverse transcription loop-mediated isothermal amplification without RNA extraction with diagnostic performance same as RT-PCR
date: 2022-02-15
journal: Anal Chim Acta
DOI: 10.1016/j.aca.2022.339590
sha: b4ed7514ab0a01879f2b44250631bd61ce0b3086
doc_id: 700440
cord_uid: n5e7osav

The global public health crisis and economic losses resulting from the current novel coronavirus disease (COVID-19) pandemic have been dire. The most used real-time reverse transcription polymerase chain reaction (RT-PCR) method needs expensive equipment, technical expertise, and a long turnaround time. Therefore, there is a need for a rapid, accurate, and alternative technique of diagnosis that is deployable at resource-poor settings like point-of-care. This study combines heat deactivation and a novel mechanical lysis method by bead beating for quick and simple sample preparation. Then, using an optimized reverse transcription loop-mediatedisothermal amplification (RT-LAMP) assay to target genes encoding the open reading frame 8 (ORF8), spike and nucleocapsid proteins of the novel coronavirus, SARS-CoV-2. The test results can be read simultaneously in fluorometric and colorimetric readouts within 40 min from sample collection. We also calibrated a template transfer tool to simplify sample addition into LAMP reactions when pipetting skills are needed. Most importantly, validation of the direct RT-LAMP system based on multiplexing primers S1:ORF8 in a ratio (1:0.8) using 143 patients’ nasopharyngeal swab samples showed a diagnostic performance of 99.30% accuracy, with 98.81% sensitivity and 100% selectivity, compared to commercial RT-PCR kits. Since our workflow does not rely on RNA extraction and purification, the time-to-result is two times faster than other workflows with FDA emergency use authorization. Considering all its strengths: speed, simplicity, accuracy and extraction-free, the system can be useful for optimal point-of-care testing of COVID-19.

Diagnosis constitutes a vital part of guiding epidemiological strategies and public health 45 interventions in controlling the novel coronavirus disease (COVID-19) outbreak. Moreover, in the 46 absence of effective drugs and inequitable access to vaccines against the virus, the importance of wide-scale and targeted testing cannot be overstated. Currently, real-time reverse transcription 7 Industries, New York, USA) at maximum speed (3200 rpm) for 5 min. After vortexing, we let the 139 beads and any possibly generated aerosols settle down at room temperature for 1 min. We promptly 140 obtained the supernatant for subsequent downstream processes. 141 To further examine the impact of our bead beating protocol on RT-LAMP detection, we 142 conducted a systematic investigation on the treatment process. First, we independently evaluated 143 Zirconium oxide and Chelex beads, as well as a combination of the two, on a positive swab sample 144 with and without vortexing for 5 min. Second, a separate swab sample was mechanically lysed 145 (with vortexing) by the beads for 5 min, followed by RNA extraction with the QIAamp Viral RNA 146 Mini Kit (Qiagen, Hilden, Germany), as specified by the manufacturer. We then compared our 156 We extracted total RNA from the inactivated SARS-CoV-2 cell supernatants and clinical 8 Instrument II (Roche, Mannheim, Germany). A cycle threshold (Ct) value of < 40 for SARS-CoV-162 2 targets and < 35 for the human internal control gene was considered positive. 163 164 In our preliminary work [25], we designed five SARS-CoV-2 primers sets. Of which, N-A was 165 the most sensitive primer and was used in some studies [19, 20, 28, 29] . As a follow-up study, we 166 designed more sensitive primer sets targeting highly conserved segments of genes encoding open 167 reading frame 8 (ORF8) protein and the spike protein of SARS-CoV-2. Additionally, we designed 168 internal control primers targeting the human ribonuclease P protein subunit p20 (RPP20) encoded 169 by the POP7 gene. Using the online NEB ® LAMP primer design tool (https://lamp.neb.com/#!/ ) 170 with default parameters, we designed three sets of primers specific for each target region. The 171 primers were evaluated individually, and the best performing set was selected for further analysis.

In silico analysis of the primers using NCBI primer-BLAST revealed 100% identity to SARS-

CoV-2 and no matches for other closely related human coronaviruses. We additionally checked 174 the frequency of mutations in the targeted segments using the CoVsurver app on the GISAID 175 database (www.gisaid.org). The primers were synthesized by Sangon Biotech (Shanghai, China). replicates at each dilution. The RNA copy was determined by One-step RT-ddPCR Advanced Kit 193 for Probes (BioRad Cat. #1864022) using primers described in our recent report [30] . The 194 observations for each primer or primer combination were then fit in a probit curve. The LOD was 195 defined as the least dilution at which the primers detected 95% of the replicates. The primers were 196 multiplexed in equal ratio or according to their performance in a single-tube reaction of duplex or 197 triplex assays.

To check the primers' specificity, we tested them against a panel of six respiratory pathogens 199 available as laboratory stock. DNA or RNA was extracted from the following pathogens: Influenza ˚C for 0.05 sec, melting curves were generated by temperature increment to 95 ˚C at a ramp rate 207 of 0.5 ˚C/sec, including a plate reading step at each temperature. The BioRad's CFX 96 software 208 manager automatically produced the melting curves at the end of the melt protocol. The products 209 were then subjected to 2% gel electrophoresis stained by GelRed dye, run at 120 V/150 mA for 40 221 We also evaluated the assay's variability in detecting extracted RNA and crude lysates from 222 simulated PBS and saliva samples. The samples were prepared, as mentioned above. In crude 223 lysates, the samples were mechanically lysed by bead beating, and 1 μL was used as the RT-LAMP 224 template. Primer mix S1:ORF8 (1:0.8) and human internal control primers were used in this 225 experiment. 240 We investigated the shelf-life of the ready-to-use RT-LAMP master mix stored at -20 ˚C, 4 ˚C, 241 and room temperature for up to 28 days. After every two days, we tested the stability of the LAMP 242 mix to detect a positive swab sample in four technical replicates. Note that SYTO ® -9 dye was not 243 included in the RT-LAMP reagent-ready mix. The dye was only applied to the mixture shortly 244 before the reaction was set. In Figure1, the combination of two or three primer sets for detection resulted in either specific 277 or non-specific amplification depending on the primer set. Gel electrophoresis showed ladder 278 banding patterns on negative control and NTC, similar to those on dilutions 1-5 when non-specific 279 amplification occurred (Fig. 1D) . In contrast, no such ladder banding patterns were observed for 280 negative control and NTC in case of specific amplification (Fig. 1A) . The HRM analysis revealed 281 more interesting double peaks in the case of non-specific amplification, melting temperature (Tm) 282 of 84˚C at the first peak and higher Tm of 89˚C and 90˚C at the second peaks (Fig. 1F ), and only 283 single peak, Tm of 84˚C, in the case of specific amplification (Fig. 1C) . The NTC showed no peaks 284 in specific amplification but a single peak with a higher Tm of 91˚C in non-specific amplification.

Intriguingly, as the template concentration decreased, the greater the probability of double peaks 286 or single peaks with higher Tm. Based on the HRM analysis, the primer sets S1 and ORF8 designed 287 newly by us, N-A reported previously by us, and RPP20 to detect the human internal control were 288 found quite specific for the detection (Appendix A Fig. S2 and S3 ). Additional peaks with higher 289 Tm seen in non-specific reactions may be due to stable secondary DNA structures requiring higher products of stems and loop, the correct banding pattern of a specific amplification might be simpler and more reliable method to detect false-positive amplification in LAMP reactions than 300 gel electrophoresis, which is routinely used to develop LAMP assays.

Another feature of LAMP is that non-specific amplification will eventually occur if the reaction 302 time is prolonged. In theory, the accumulation of background signals in non-template reactions 303 occurs as the reaction progresses. The melting curve analysis was used to determine when non-304 specific products were starting to form for the primer set S1:ORF8 (1:0.8). As shown in Appendix 310 To evaluate the sensitivity of the primers, five-fold serial dilutions of SARS-CoV-2 RNA from 311 cell culture were used. The dilutions were quantified by RT-ddPCR (Appendix A Fig. S1 ). S1 312 primer was found the most sensitive compared to ORF8 and N-A ( Fig. 2A, 2B) . The human 313 internal control primer, RPP20, also performed relatively well on human gene dilutions. Of note, 314 we used an inactivated whole virus rather than synthetic RNA transcripts as the standard control; other beads (Fig. 4B, 4C ). According to RT-PCR, the cycle threshold (Ct) values for samples 1 to were lysed with other beads (Fig. 4B) . Remarkably, using Beads Z+C improved the sensitivity and 385 the reproducibility of the direct RT-LAMP assay, and thus the combination of beads was used in 386 subsequent experiments. Other studies used RNase inhibitors, lysis buffers or proteinase K for 387 described here is a streamlined process that does not have centrifugation and elution steps, which 393 could lead to sample loss. Since the requirement of a vortex may weaken the portability of our 394 system, we recommend a disposable, battery-powered, miniaturized Omnilyse device (Claremont 395 Biosolutions, USA). The device is based on a bead beating technique; the same results can be 396 obtained by simply incorporating the beads identified in this study. To ensure that the beads are producing more target RNA rather than more LAMP signals for 420 unrelated reasons, we further detected the extracted samples using RT-PCR. Indeed, we made a 421 similar observation as in RT-LAMP (Fig.5C) , confirming that the shorter Tt could be due to more effective RNA release, we determined the appropriate mechanical lysis time. The optimal lysis 435 time was found to be 5 min (Fig.5F ). 436 We finally validated our mechanical bead lysis method against a no-bead control with 32 437 clinical swab samples. As detected by RT-LAMP, the amount of amplifiable RNA increased 438 substantially across all samples (Appendix A Table S8 ). However, we observed that the magnitude 439 of the detectable RNA increase varied amongst samples, even those with the same viral load as contain inhibitors or components that others do not, for example, tobacco substances, nasal sprays, 442 and mouth wash chemicals. Regardless of the variation, our mechanical lysis method ensures an 443 accurate and reliable qualitative SARS-CoV-2 detection, which is critical in a point-of-care setting. 444 3.6. SARS-CoV-2 detection in simulated phosphate-buffered saline (PBS) and saliva samples 445 Saliva is a more reliable diagnostic specimen for SARS-CoV-2 than nasopharyngeal swabs [54] . 446 Also, PBS is a potential alternative to VTM [55] . Interestingly, the RT-LAMP assay was slightly 447 more sensitive to the crude lysate (Fig. 6E, 6F ) than extracted RNA (Fig. 6A, 6B) for PBS and 448 saliva. This may be due to sample loss during RNA extraction as a result of the repetitive steps of 449 beads washing, suspension, and sample elution. However, RT-PCR Ct was strongly correlated to 450 RT-LAMP Ct for the extracted RNA (Fig. 6D ) than for the crude lysate (Fig. 6H) . Overall, these 451 results demonstrate the utility of our bead beating protocol and support the hypothesis that 452 mechanical lysis can improve RT-LAMP detection sensitivity for SARS-CoV-2 without 453 necessarily purifying the template. It is worth mentioning that the commercial RNA extraction kit 454 used in this study is based on magnetic beads system. As expected, the internal control gene was 455 detected in the saliva and not in the PBS samples (Fig. 6C, 6G) . No masking of color change by 456 PBS or saliva was observed, as seen in the colorimetric LAMP when swabs in VTM were used. Microbiol. 59 (2021).

[3] R. Antiochia, Developments in biosensors for CoV detection and future trends, Biosens. ORF8-LB GCTGGTTCTAAATCACCCATT S1-F3 GTGTTTATTACCCTGACAAAGT NC_045512.2 a 21600-22100 Spike protein S1-B3 CTCTTATTATGTTAGACTTCTCAGT S1-FIP TGGAACCAAGTAACATTGGAAAAGATCAGATCCTCAGTTTTACATTC S1-BIP GCTATACATGTCTCTGGGACCAATGGAAGCAAAATAAACACCATCA S1-LF AGGTAAGAACAAGTCCTGAGTT S1-LB GGTACTAAGAGGTTTGATAACCCT RPP20-F3 GGTGGCTGCCAATACCTC GeneBank U94316.1 a Ribonuclease P Subunit P20 RPP20-B3 ACTCAGCATGCGAAGAGC RPP20-FIP GTTGCGGATCCGAGTCAGTGGCCGTGGAGCTTGTTGATGA RPP20-BIP AACTCAGCCATCCACATCCGAGTCACGGAGGGGATAAGTGG RPP20-LF TCCCGTGTGTCGGTCT RPP20-LB TCTTCAGGGTCACACCCA J o u r n a l P r e -p r o o f 

Single-color multiplexing by the integration of high-673 resolution melting pattern recognition with loop-mediated isothermal amplification

A 676 novel One-pot rapid diagnostic technology for COVID-19

Standard Quantified by Multiple Digital PCR Platforms for Quality Assessment of 680 Molecular Tests

Rapid and visual detection 683 of 2019 novel coronavirus (SARS-CoV-2) by a reverse transcription loop-mediated 684 isothermal amplification assay

Visual detection of isothermal nucleic acid 694 amplification using pH-sensitive dyes

Classification of Multiple DNA 696

Prospect for Point of Care Setting

Rapid Lysis Devices for Biodefense Nucleic Acid Diagnostic Systems

Mechanical 702 cell lysis device, 14th Int

Recent advances in lab-on-a-chip 705 technologies for viral diagnosis

The effect of shear stress on protein conformation: Physical 707 forces operating on biochemical systems: The case of von Willebrand factor

Mechanical stress induced protein 710 precipitation method for drug target screening

Chelex 100 as a Medium for Simple Extraction of 712 DNA for PCR-Based Typing from Forensic Material

RNA extraction using magnetic beads for rapid large-scale testing by RT-qPCR and RT-722 LAMP

Point-724 of-care bulk testing for SARS-CoV-2 by combining hybridization capture with improved 725 colorimetric LAMP

Sensitive extraction-free SARS-CoV-2 RNA virus detection using a chelating resin

Direct on-the-spot detection of SARS-CoV-2 in patients

Saliva is a 735 reliable tool to detect SARS-CoV-2

A. saline, and minimum essential medium as potential alternatives to viral transport media for 739 SARS-CoV-2 testing

Duration of infectiousness and correlation with RT-PCR cycle threshold 742 values in cases of COVID-19

 Table 3 . Diagnostic performance of direct approach RT-LAMP compared to RT-PCR.Abbreviations: CI; Confidence Interval; PLR, Positive Likelihood Ratio; NLR, Negative Likelihood Ratio; N/A, Not Applicable. a; Primer N-A used in the initial screening, b; primer mix S1+ORF8 (1:0.8) used in the second screening. Table S1 (Primer N-A) and S2 (Primer S1+ORF8) (see Appendix B).

The diagnostic parameters were calculated using the online MedCalc' Diagnostic test evaluation calculator (https://www.medcalc.org/calc/diagnostic_test.php).